abuse of dominance in licensing and refusal to license a apos more economic approach apos to competition by imitation and the competition by substitution
... of grammatical meaning and lexical meaning Grammatical meaning unites all grammatical characteristics ofa word and lexical meaning is a realization ofa concept or notion Lexical meaning includes ... Syntactic and semantic features of negation ofthe text of President Barack Obamas inaugural address After having a careful analysis on syntactic and semantic features of negation in English and ... foreign language According to Carl James,1980:10 Contrastive analysis : CA is a form of inter-language study anda central concern of applied linguistics As a matter of fact, CA has had much to offer...
... decrease by almost a quarter in Ghana, by almost a third in Kenya, andby half in Ethiopia This scenario also affects livestock income, reducing it by almost a third in Kenya andby almost half in ... countries in SSA The study countries include Ethiopia and Kenya in East Africa and Ghana and Nigeria in West Africa The HPAI virus has been circulating in SSA since February 2006, when the first case ... implemented bythe Kenya National Bureau of Statistics andthe Human Resources Social Services Department ofthe then Ministry of Finance and Planning Finally, for Ethiopia we used the data from the...
... from the liver of yellowtail, and found that the one-sided accumulation of arachidonic acid into PtdIns is attained inthe presence of large amounts of docosahexaenoic acid and that several acyltransferase ... systems ofthe yellowtail enable PtdIns to accumulate arachidonate inthe presence of large amounts of docosahexaenoic acid anda limited supply of arachidonic acid As PtdIns plays an important role ... clarify the involvement ofthe PtdIns cycle inthe accumulation of arachidonic acid in PtdIns of fish Fig Effects of docosahexaenoic acid (DHA) on the incorporation of [14C]arachidonic acid (*AA)...
... Thailand, Indonesia, Viet Nam, Sri Lanka, Malaysia, southern part of India, tropical part of China, part of Lao PDR, Myanmar, Bangladesh, Brunei, Cambodia, the Philippines and Papua New Guinea ... guidelines to further assist countries efforts to safeguard against the incursion of SALB into the PRA area The purpose of this PRA is to: i examine and evaluate the risks of SALB being associated ... spread to Trinidad and Central American andto Bahia and Sao Paulo areas of Brazil was presumably through infected material when attempts were made to grow rubber in these regions The spread of...
... developments of acupuncture in Australia indicate that through adequate and appropriate evaluation, acupuncture is being integrated into mainstream health care in Australia Competing interests The authors ... CX, AZ, AY, SZ and DS interpreted the data and revised the manuscript All authors read and approved the final version ofthe manuscript Acknowledgements The authors thank the researchers at the ... Goods Administration andthe Australian New Zealand Clinical Trial Registry Following the introduction ofthe Consolidated Standards of Reporting Trials (CONSORT Statement) in 1996 [28] and its...
... Authoritarianism in Southeast Asia Comparing Indonesia and Malaysia Edited by Ariel Heryanto and Sumit K Mandal Cooperative Security andthe Balance of Power in ASEAN andthe ARF Ralf Emmers Cooperative ... Sumatra and Kalimantan in 1997 The haze, that reached 26 Cooperative security: ASEAN andthe ARF Malaysia, Singapore and Brunei and parts of Thailand andthe Philippines, marked a significant failure ... dispositions inthe South China Sea The methodological approach adopted in this monograph aims to combine a theoretical and factual understanding of ASEAN andthe ARF The methodology is based on a historical...
... Ireland bythe operation ofthe penal laws, the patriarchal family has a crucial role in both Burke’s anti-Jacobin arguments and his prescriptions for ‘‘attaching’’ catholic Ireland to England ... discipline in sexual and familial relations, conceived as central tothe maintenance of order For part of what Burke fears inthe Jacobin revolt is the unfixing ofthe proper bounds of feminine and ... among the most important of scholarly tasks at hand today; acknowledging that Ireland andthe Irish were assigned a crucial place inthe ideological work of English nation-formation inthe past...
... Initial recognition of meaning of short Material held in STM and Related to materials already held in STM Related materials arriving in STM Meaning extracted from message and retained in LTM ... usually apply the skills, the same uses in listening in their mother tongue, predict what they will hear and try to match them with the things they actually hear Therefore, in teaching listening, the ... speaking, writing and reading can arise from listening, especially from post-listening work The order and organization ofa language lesson are usually not decided at the same time integrating these...
... Approaches to language teaching and their relevance to vocabulary 1.4 Recent research about teaching and learning second language vocabulary 1.5 Advantages ofthe use games in vocabulary teaching ... teaching and their relevance to vocabulary 1.4 Recent research about teaching and learning second language vocabulary 1.5 Advantages ofthe use of games in vocabulary teaching and learning Part two: ... teaching and learning 1.2.1 A neglect aspect of foreign language methodology 1.2.2 Ineffective vocabulary learning 1.2.3 The status of vocabulary in current language teaching and learning 1.3 Approaches...
... GGCCATCATACAGGTGACTAGGAGGGT GGGTGATTTGACACACGGTTTTGATGGA ATGGGATATGTTCTCAGT ACAGATTTACGACTCCTCCTG CATGTTGCTGTAGCAGTTTGAT ATATAAGCTTATCCTCTGATAGC GACCCATCATCGAGGACTA ACCACAAGGGTTTCAAGCAG CCACACCAGGAAGGTCTTGT ... GGTGGAGGAAACCTTGGACT ACGTCAACATGTCCGACAAA CGGTGGAGACAACAAGGACT TGCGTTTCGTTTGACTTCAC GGCTGATGGCTTCTCAAAAC Hemolymph titers of PO-CHH and ES-CHH in response to changes in dissolved oxygen Hypoxia induced ... cRNA standards of quantitative RT-PCR, including PO-CHH and ES-CHH, AK and eIF 4A, were initially PCR amplified using a combination of LF and LR primers (Table 1) Further cRNA synthesis and RNA...
... cannot read with understanding, think about and analyze what they’ve read, and then write clearly and effectively about what they’ve learned and what they think, then they may never be able to ... today are not meeting even basic writing standards, and their teachers are often at a loss for how to help them In an age overwhelmed by information (we are told, for example, that all available ... Farnan, N (2005, April) An investigation ofthe influence of teaching grammar in writing to accomplish an influence on writing Paper presented at the annual meeting ofthe American Educational...
... participated in all the research phases and advised RMB and CA during the statistical analysis ofthe condition-specific modules and revised the manuscript All authors read and approved the final manuscript ... An item was added toa domain if it correlated with a domain, it loaded only on one domain, and it generally made sense to include the item inthe domain [29] The reliability ofthe domain, including ... 'Impact' Over half ofthe extra items that were included on the basis of clinical relevance after the pilot study analysis were integrated inthe final domains Example: the asthma field study analysis...
... 64-QAM, corresponding with an increase ofthe range of 1425 m, 176 m, and 1253 m, respectively The lower increase ofthe range for 16-QAM may be caused bythe fact that all range calculations are ... 2.4) 2.3 Parameters Used to Analyze Performance This paragraph defines the parameters used to analyze the range ofthe DVB-H system First, MpegLock and MpegDataLock are explained Next, parameters ... The ranges are calculated as the distance from a location noted as the “imaginary transmitter” ITx The location ((x, y, z)-coordinates) of this imaginary transmitter is chosen as a weighted average...
... 5'-TCAAGTCTTCCAATTTCTACCCAGTGCTGC-3' for AtYLMG1-1, 5'CCTCAACATATATAACACCATC-3' and 5'-GACAGGTTCAGGTCATAGAAG-3' for At5g21920, 5'-TATCTGAACACTCCGTTGACGGTA-3' and 5'-CAAAGATA AACGGAATACGATC-3' for At4g27990, 5'-GCAATGGGAAGCAGTGGTGG-3' ... identify the inserted 35S-cDNA inthe FOX lines, the insertion was amplified by PCR using primers 5'GTACGTATTTTTACAACAATTACCAACAAC-3' and 5'-GGATTCAATCTTAAGAAACTTTATTGCCAA-3', and then sequenced bya ... resistance to kanamycin, was amplified by primers 5'-ATGTCTAGAAGCTATGACCATGATTACGAA-3' and 5'-ATGTC TAGAAAGTCAGCGTAATGCTCTGCC-3' (the XbaI site is underlined), digested with XbaI, and inserted into...
... designed by AS, NS, PS, DR, VM and UA, and data were gathered and analyzed by Novartis All authors vouch for the accuracy ofthe data andthe analysis, and contributed tothe interpretation ofthe data ... anti-canakinumab antibodies at baseline and at eight weeks post-dose using a validated Biacore® binding assay (Biacore International AB, Uppsala, Sweden) [25] Pain intensity scores (according tothe ... impact of anti-inflammatory therapy on quality of life in patients with acute Gouty Arthritis and demonstrates the significant value of potent anti-inflammatory therapy We also report that canakinumab...
... from the beginning ofthe year 2000 tothe end of January 2009 an atypical form ofthe disease (Nor98) was found on one farm in Area II and on two farms in Area VI The diagnosis of scrapie inthe ... Area VII than in Areas I, III and V It was also significantly higher in Areas II and VI than in Area V Table 3: The means of Fe, Mn, Cu and Zn analyses in forage from farms in Categories and ... units for classification into scrapie categories and are, therefore, the basic random units and repeated samples on a farm are subsampling Regional variations or trends within Areas are inthe model...
... [9,10,14] to further examine the association between neutralization sensitivity to reagents targeting the CD4 binding site and macrophage tropism The capacity of HIV to enter macrophages correlated with ... into macrophages is associated with sensitivity to neutralizing mAb b12 anda broadly neutralizing HIVEnhanced Enhanced HIV entry into macrophages is associated with sensitivity to neutralizing ... suggesting that other Env determinants influence exposure ofthe b12 epitope DuenasDecamp et al showed that an arginine at position 373 inthe C3 region, proximal tothe CD4 binding site, increased...
... inthe absence of CQ CA-p24 or ng/ml was used as input for monitoring replication A) day 37 of passage, B) day 77 of passage, C) day 103 of passage, D) day 147 of passage, E) day 183 of passage ... loss of these amino acids may also explain the reduction inthe DC-SIGN mediated transfer ofthe CQ passaged virus Variation inthe V1V2 and V3 regions have also been shown to be involved with altered ... strain to be analyzed and using the assay described below The CA-p24 levels inthe culture supernatants were determined using a standard ELISA protocol Virus stocks were generated either in the...
... interactions of these factors means a greater proportion ofthe unexplained variation can be accounted for – increasing the power ofthe meta-analysis Other advantages of individual patient data meta-analyses ... gives the appearance of random variation (or the variation might be misassigned to another factor, such as trial quality), whereas in reality it is an important finding The traditional approach has ... using individual patient data Individual patient data meta-analysis Analysing data at an individual patient level is the most powerful meta-analytic technique available Statistical significance...