a simplified method for the determination of bulldozing resistance
a novel method for the synthesis of titania nanotubes using
Ngày tải lên :
05/05/2014, 15:26
... nanotubular surface
and thus increases the rate of formation of the nanotubes. On the
other hand, the formation of the nanotubes using conventional
magnetic stirring is retarded by the formation of a ... ultrasonic-mediated, mag-
netically stirred, anodized titanium samples are designated in
the main text as UAT and SAT, respectively.
2.3. Annealing of the materials
The anodized titania nanotubular arrays ... However, the annealed titania nanotubes
are crystalline (mostly anatase) and show varied activity de-
pending on the material preparation and annealing atmosphere
(Fig. 12).
Titania nanotubes prepared...
- 8
- 634
- 0
a novel method for the synthesis of cao nanoparticle
Ngày tải lên :
06/05/2014, 08:55
... the nanoparticles
by studying the images indicates that the
synthesized size nanoparticles are less than
100 nm. That means the synthesized catalysts
have nano dimension. Also, the analysis ...
Chemical
Research
www.jacr.kiau.ac.ir
A Novel Method for the Synthesis of CaO Nanoparticle for
the Decomposition of Sulfurous Pollutant
Meysam Sadeghi
*1
, Mir Hassan Husseini
2
1,2
Department ... analysis
For the evaluation of the reaction of 2-CEPS
as a sulfurous pollutant on the CaO NPs/
Polyvinyl pyrrolidone (PVP) surface at ambient
temperature GC analysis was selected. The
effects of the...
- 12
- 705
- 0
Báo cáo khoa học: A novel metallobridged bis(b-cyclodextrin)s fluorescent probe for the determination of glutathione doc
Ngày tải lên :
07/03/2014, 05:20
... from
the standard curve and the regression equation. The
average recovery test was made using the standard
addition method, and the RSD was generally good
when obtained from a series of six plasma ... (II) may lead to a significant fluorescence recovery of the
bis(b-CD)s. Therefore, a rapid and simple spectrofluorimetric method was
developed for the determination of glutathione. The analytical application
for ... platelets [10]. Afterwards, 0.50 mL
of absolute alcohol was added to the plasma
with shaking. Plasma proteins were precipitated
and removed by centrifugation. The final plasma
samples used in the...
- 8
- 429
- 0
Tài liệu "Promoting healthy diets and physical activity: a European dimension for the prevention of overweight, obesity and chronic diseases" doc
Ngày tải lên :
14/02/2014, 13:20
... integrated and comprehensive approach towards the promotion of
healthy diets and physical activity
V.8.1. A coherent and comprehensive approach aimed at making the healthy choices
available, affordable ... lack of physical activity are
therefore the leading causes of avoidable illness and premature death in Europe.
7. The underlying determinants of the risk factors for the major chronic diseases ... Platform for Action on Diet, Physical Activity and Health
IV.1.1. In order to establish a common forum for action the European Platform for Action on
Diet, Physical Activity and Health was launched...
- 22
- 703
- 0
Tài liệu Đề tài " A shape theorem for the spread of an infection " pdf
Ngày tải lên :
16/02/2014, 06:20
... therefore on the movement of all the other particles.
In the present case we can take π
B
= π
A
, which has the great advantage
that the path of ρ does not depend on the paths of the other particles. ... t) has the same distribution at the space-time point (x + y, t + s)asthe
full-space process (started at (0, 0)) at the point (y, s). Again we shall use the
same random walk paths π
A
for all the ... basic inequalities remain valid for
k = 1 by trivial modifications which we again leave to the reader. For the
various estimates we have to take all t
k
large. This will automatically be the
case...
- 67
- 490
- 0
Tài liệu OUTLINES OF DAIRY BACTERIOLOGY A CONCISE MANUAL FOR THE USE OF STUDENTS IN DAIRYING docx
Ngày tải lên :
16/02/2014, 22:20
...
upon arrival at the farm, so that the conditions are favorable for rapid fermentation.
Many of the taints that bother factories are directly traceable to such a cause. A few
dirty patrons will ... made in an approximate manner so as to
serve as a test at the weigh-can or intake. The test is best made by the use of the well
known alkaline tablet which is composed of a solid alkali, and ... hydrogen, carbon, oxygen, together with a
limited amount of mineral matter. The nitrogen and carbon are most available in the
form of organic compounds, such as albuminous material. Carbon in the form...
- 201
- 540
- 0
Tài liệu Carrots, Sticks, and Promises: A Conceptual Framework for the Management of Public Health and Social Issue Behaviors docx
Ngày tải lên :
18/02/2014, 02:20
... have changed dramati-
cally in the past years, and as a result, policy with respect to
managing tobacco usage behavior also has changed. The re-
lationship of behavior management and externalities ... act as
managers wish. If a libertarian were to allow any form of
"
Carrots, Sticks, and Promises / 29
a good understanding of and accommodate the target's
MOAs and the trade-off of free ... to
increase the health of the population and lower the cost of health care
than can treatment of illness.
In this article, a conceptual framework is proposed for the
management of public health and...
- 14
- 780
- 0
Tài liệu Báo cáo khoa học: Hypoxia reduces the expression of heme oxygenase-2 in various types of human cell lines A possible strategy for the maintenance of intracellular heme level pdf
Ngày tải lên :
19/02/2014, 06:20
... 1162–1168.
13 Nakayama M, Takahashi K, Kitamuro T, Yasumoto
K, Katayose D, Shirato K, Fujii-Kuriyama Y & Shiba-
hara S (2000) Repression of heme oxygenase-1 by
hypoxia in vascular endothelial cells. ... HepG2 and HeLa cells
were cultured for 48 h under normoxia or hypoxia, and then harves-
ted. The microsome fraction was prepared and used for the assay
of HO activity. The data are means ± SEM of ... the maintenance of intracellular heme level
Yongzhao Zhang
1
, Kazumichi Furuyama
1
, Kiriko Kaneko
1
, Yuanying Ding
1
, Kazuhiro Ogawa
2,
*,
Miki Yoshizawa
1
, Masaki Kawamura
1
, Kazuhisa Takeda
1
,...
- 12
- 621
- 0
Báo cáo khoa học: The modulation of metal bio-availability as a therapeutic strategy for the treatment of Alzheimer’s disease pptx
Ngày tải lên :
07/03/2014, 10:20
... olig-
omerization, aggregation and fibrilization that Ab
forms amyloid plaques. As amyloid plaques are prom-
inent in the postmortem AD brain, early research the-
ories placed the accumulation of extracellular,
insoluble ... ablated [41].
Amyloid-b
After the 4.5 kDa Ab peptide was identified as a
major component of the amyloid plaques in AD brain
[42,43], global AD research focused on this peptide as
a causative agent ... that could be
expected within the brain. The capacity for metals to
facilitate this process may therefore be a critical factor
in the Ab mediated pathology of the AD brain. Subse-
quent to an...
- 9
- 634
- 0
Báo cáo khoa học: Mycobacterium tuberculosis possesses a functional enzyme for the synthesis of vitamin C, L-gulono-1,4-lactone dehydrogenase doc
Ngày tải lên :
07/03/2014, 12:20
... 5¢-GGGGACAAGTTT
GTACAAAAAAGCAGGCTTCGATGACGACGACAAG
ATGAGCCCGATATGGAGTAATTGGCCT-3¢; and 3rev-
Gulox (reverse), 5¢-GGGGACCACTTTGTACAAGAAA
GCTGGGTCTCAGGGACCGAGAACGCGCCGGGTGT
A- 3¢. The PCR product was ... respectively, as a
direct electron acceptor. The animal and plant l-gul-
onolactone oxidoreductases are also active towards the
l-galactono-1,4-lactone substrate.
Only scarce data are available on the ... horizontal transfer of vitamin C-related genes.
In the process of microbial adaptation, horizontal gene
transfer is essential for the dissemination and assembly
of detoxification pathways that can form...
- 11
- 571
- 0
INTERNATIONAL STANDARD Microbiology of food and animal feeding stuffs — Horizontal method for the detection of Salmonella spp docx
Ngày tải lên :
07/03/2014, 16:20
... prepare International Standards. Draft International Standards adopted
by the technical committees are circulated to the member bodies for voting. Publication as an International
Standard requires ... followed and the reasons for deviations from this method in the
case of particular products.
The harmonization of test methods cannot be immediate, and for certain groups of products International ...
(informative)
Results of interlaboratory trial
An international collaborative test was organized in 2000 by AFSSA Ploufragan in Europe, and BioControl Systems
in the USA, in the frame of the...
- 34
- 690
- 0
Báo cáo khoa học: Distribution of the extrinsic proteins as a potential marker for the evolution of photosynthetic oxygen-evolving photosystem II ppt
Ngày tải lên :
23/03/2014, 15:21
... Maruyama S,
Takahara M, Miyagishima SY, Mori T, Nishida K,
Yagisawa F, Nishida K, Yoshida Y et al. (2004)
Genome sequence of the ultrasmall unicellular red alga
Cyanidioschyzon merolae 10D. Nature ... that Prasinophytes also contain PsbQ. The
thylakoid membranes of P. parkeae and E. gracilis did
not react with any antibodies against the red algal and
cyanobacterial extrinsic proteins (lanes ... heme
c attached. These recombinant proteins were used for pre-
paration of the antibodies against red algal PsbQ¢, PsbV
and PsbU, cyanobacterial PsbU and green algal PsbQ. The
antibodies against...
- 11
- 501
- 0
Review of the Existing Techniques for the Determination of Dry Rubber Content in Natural potx
Ngày tải lên :
23/03/2014, 21:21
... observed that the change in capacitance values with ORC for different latex
samples exhibit a good relation. The principle of the capacitance method,
constructional details of the capacitive transducer, ... an approximate
value can be obtained. The hydrometer method is widely used for getting an
approximate value of the ORC.
The most accurate method having international recognition is the
standard ... calibrated
vessel. The specific heat of the latex or crepe is then computed, after allowing
for the heat absorbed by the flask. It is necessary before the determination of
specific heat of any sample,...
- 32
- 890
- 2
Báo cáo " A numerical model for the simulation of wave dynamics in the surf zone and near coastal structures " pot
Ngày tải lên :
28/03/2014, 15:20
... numerical
model on the simulation of the wave
transformation on a natural beach, existing
experimental data on the wave dynamics in
the nearshore area obtained by Ting and
Kirby ... generation is assumed as the sum of those respectively due to
wavebreakingandhorizontalandverticalshear.
The verification of the numericalmodelagainstdataobtainedfromvariousindoorexperiments
reveals ... the
numerical model can satisfactorily simulate
the wave transformation, including wave
breaking, wave runup on the beach, and
turbulence generated by
wave breaking and
shear. As...
- 11
- 460
- 0
Báo cáo khoa học: "A Bayesian Method for Robust Estimation of Distributional Similarities" pot
Ngày tải lên :
30/03/2014, 21:20
... Estimation of Distributional Similarities
Jun’ichi Kazama Stijn De Saeger Kow Kuroda
Masaki Murata
†
Kentaro Torisawa
Language Infrastructure Group, MASTAR Project
National Institute of Information ... similarity measure. As for BC
b
and BC
a
, the
results for the tuned and several other values for α
are shown. Figure 1 shows the parameter tuning
for BC
b
with MAP as the y-axis (results for BC
a
are ... pro-
files are multinomial distributions, the pri-
ors are Dirichlet, and the base measure is
the Bhattacharyya coefficient, we can de-
rive an analytical form that allows efficient
calculation. For the...
- 10
- 472
- 0
- a framework for the evaluation of text
- a unified statistical model for the identification of english basenp
- a modern method for guitar school of tarrega volume 1 pdf
- graphicalstatistical method for the study of structure and reaction processes of coal
- a new approach for the morphological segmentation of highresolution satellite imagery
- an exact method for the stability analysis of timedelayed linear
Tìm thêm:
- hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam
- xác định các mục tiêu của chương trình
- xác định các nguyên tắc biên soạn
- khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn
- khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản
- khảo sát chương trình đào tạo gắn với các giáo trình cụ thể
- xác định thời lượng học về mặt lí thuyết và thực tế
- tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam
- điều tra đối với đối tượng giảng viên và đối tượng quản lí
- điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1
- khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam
- khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu
- nội dung cụ thể cho từng kĩ năng ở từng cấp độ
- xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct
- phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ
- mở máy động cơ lồng sóc
- mở máy động cơ rôto dây quấn
- các đặc tính của động cơ điện không đồng bộ
- hệ số công suất cosp fi p2
- đặc tuyến hiệu suất h fi p2