a semi automated method for the determination of fluticasone propionate cci187811 in human plasma using solid phase extraction and liquid chromatography tandem mass spectrometry
A FUNCTIONAL-ANALYTIC METHOD FOR THE STUDY OF DIFFERENCE EQUATIONS EUGENIA N. PETROPOULOU AND potx
... partial difference equations of three and four variables The aim of this paper is to present the generalization of this functional-analytic method for the study of linear and nonlinear partial ... details, see [11] and the references therein) Also, by assuring the existence of a solution of a difference equation in the space or , we obtain information regarding the asymptotic behavior of the ... T < 1, in order to apply Theorem 1.1 to the preceding operator equation and obtain information for the initial linear difference equation under consideration In the case of nonlinear equations,...
- 12
- 257
- 0
Báo cáo y học: "A standardized scoring method for the copy of cube test, developed to be suitable for use in psychiatric populations" pdf
... because it is an index of correlation and not an index of agreement [19-21] The calculation of means and standard deviations for each SCCT item and total score during the rating by each examiner ... reflected in factor analysis The four factors that emerge explain 71% of the total variance The SCCT can be divided into subscales on the basis of the factor analysis and its interpretation In this way, ... and in Additional file The SCCT instructions ask the subject to draw an identical shape on the same piece of paper The template shape was printed on the left half of the sheet leaving space for...
- 10
- 474
- 0
QuEChERS A Mini-Multiresidue Method for the Analysis of Pesticide Residues in Low-Fat Products
... with the means available in the laboratory, the use of larger sample amounts for analysis (scaling up) and/ or the use of Ultra-Turrax during the first extraction step may help to overcome these ... degraded to carbofuran within the samples as well as in the extracts at pH Thus, merely if carbofuran is present in the acidified extract an additional run of the alkaline aliquot is needed Normally ... y-intercept slope of the curve |x|| Added amount of analyte |x||: absolute amount of analyte in the sample extract before fortifing (y=0) Fig 1: Internal calibration using the procedure of standard...
- 12
- 729
- 0
Review of the Existing Techniques for the Determination of Dry Rubber Content in Natural potx
... liberal rules formulated in Travancore during 1860s and subsequently in Cochin for the distribution of forest and wasteland for plantation crops were instrumental for the initial growth and expansion'l", ... expansion'l", In terms of productivity, growth in area and production and the extent of price realization at the farm gate, the Indian plantation industry is ahead of all the other major natural rubber ... administration encouraged them by providing land, labour, capital and trade facilities In 1862, a policy for the issue of land suitable for the cultivation of plantation crop was formulated? The liberal...
- 32
- 890
- 2
Carbon rich silicon (si1 ycy)for defect engineering of ion implantation damage in devices activated by solid phase epitaxy
... helping hand in training for operating the rapid thermal anneal and e-beam evaporator equipment Many apologies for the “troubleshooting” phone calls on Sundays and weekends too! A special mention also ... level of dopant activation while maintaining a zero shift in the diffusion profile A major drawback with the annealing lies with the residual defect at the end -of- range (EOR) of the damage profile ... purpose of the implantations performed in CMOS device fabrication 1.4.1 Implantation induced damage and annealing A drawback with ion implantation is the damage created during the process As incident...
- 170
- 376
- 0
A capillary-based method determining the permeability of sand layer for geothermal applications
... in the modelling of the heat transfer of BHEs in an aquifer for geothermal applications This paper presented a novel laboratory method determining the hydraulic permeability of sand layer using ... amount of test samples The present method can provide an important basis for analyzing the heat transfer process of BHEs in a sand-based aquifer, and also be applied for other porous materials with ... method can also be applied for other porous materials with the grain diameter of 0.1-0.6 mm (ii) The filling height of sand samples and the immersion depth of the capillary tube at the initial state...
- 8
- 449
- 0
Báo cáo khoa học: A novel metallobridged bis(b-cyclodextrin)s fluorescent probe for the determination of glutathione doc
... nm The GSH content of the plasma was derived from the standard curve and the regression equation The average recovery test was made using the standard addition method, and the RSD was generally ... with shaking Plasma proteins were precipitated and removed by centrifugation The nal plasma samples used in the determination of GSH were obtained In order to evaluate the applicability of the proposed ... of glutathione and glutathione disulde in human plasma and tobacco leaves by capillary electrophoresis with laser-induced uorescence detection Talanta 65, 986990 Svardal AM, Mansoor MA & Ueland...
- 8
- 429
- 0
a novel method for the synthesis of titania nanotubes using
... band gap of carbon-doped titania nanotubes compared with N2 - and O2 annealed nanotubes The lower the band gap of the titania S.K Mohapatra et al / Journal of Catalysis 246 (2007) 362–369 nanotubes, ... titania nanotubular arrays were annealed in a nitrogen and oxygen atmosphere at 500 ◦ C for h in a CVD furnace at a heating rate of ◦ C/min The UAT samples annealed under these conditions are designated ... annealed titania nanotubes are crystalline (mostly anatase) and show varied activity depending on the material preparation and annealing atmosphere (Fig 12) Titania nanotubes prepared by the sonoelectrochemical...
- 8
- 634
- 0
a novel method for the synthesis of cao nanoparticle
... colloidal particles in water the high surface area due to smaller particle and many non-aqueous solvents by adsorbing size and the reactive sites tailored in the form onto a broad range of materials, ... angle The average particles size nanoparticles was investigated from line by Debye-Scherrer formula was estimated broadening of the peak at 2θ=0 10° via using to be 15 nm The information obtained ... 2-CEPS, mL of final temperature of the oven was programmed isopropanol or heptane as solvent and 10 μL to 60 °C (held for min) and 220 °C, to reach the of toluene as internal standard and 5, 50,...
- 12
- 705
- 0
báo cáo hóa học:" A rapid method for the generation of uniform acellular bone explants: a technical note" pot
... with the planning and preparation of the manuscript PIF and AES participated in the cutting and staining of Page of the bone tissue RGR participated in the planning of the experiments, data analysis ... analysis and the preparation of the manuscript MJS supervised the study planning, data analysis and preparation of the manuscript All authors read and approved the final manuscript Acknowledgements The ... analyzed the data and prepared the manuscript VB participated in the preparation of the bone cores and exposure of the samples to the different treatments, performed the microscopic analysis and helped...
- 4
- 403
- 0
báo cáo hóa học:" Mid-term results of ponseti method for the treatment of congenital idiopathic clubfoot (A study of 67 clubfeet with mean five year follow-up)" pot
... who performs the casting technique in all the patients DP participate and analysis the study HC designed and coordinated and drafted the manuscript All authors read and approved the final manuscript ... patient satisfaction; and of 10 points each for motion of the ankle and foot, position of the heel during stance, and gait For Satisfaction and Function category, data has been recorded from the patients’ ... phase involves application of casts, the maintenance phase where splint fitting is emphasized and the transition phase where the splints are discontinued and regular foot wear allowed Problems can...
- 7
- 531
- 0
báo cáo hóa học:" Mid-term results of ponseti method for the treatment of congenital idiopathic clubfoot (A study of 67 clubfeet with mean five year follow-up)" docx
... who performs the casting technique in all the patients DP participate and analysis the study HC designed and coordinated and drafted the manuscript All authors read and approved the final manuscript ... patient satisfaction; and of 10 points each for motion of the ankle and foot, position of the heel during stance, and gait For Satisfaction and Function category, data has been recorded from the patients’ ... phase involves application of casts, the maintenance phase where splint fitting is emphasized and the transition phase where the splints are discontinued and regular foot wear allowed Problems can...
- 7
- 802
- 0
Báo cáo hóa học: " A quantum dots and superparamagnetic nanoparticle-based method for the detection of HPV DNA" ppt
... Capture probe 5-GAGGAGGATGAAATAGATGGTCCAGCTGG ACAAGCAGAACCGGACAGAGCCCATTACAATAT TGTAACCTTTTGTTGCAAGTGTGACTCT ACGCTTCGGT-3 Secondary probe 5-GGAGCGACCCAGAAAGTTACCACAGTTATGC ACAGAGCTGCAAACAACTA-3 ... conceived of the study, and participated in its design, performed the preparation of nanomaterials and the statistical analysis All authors read and approved the final manuscript Competing interests The ... hybridization assay method only require extraction of DNA of the samples and simple incubation as well as magnetic separation, which has a good acceptability for any average lab assistant Table Comparison...
- 9
- 469
- 0
Báo cáo hóa học: " A Genetic Programming Method for the Identification of Signal Peptides and Prediction of Their Cleavage Sites David Lennartsson" pot
... on the task of identifying signal peptides is presented in Table The individual managed equally well on the training and validation cases and actually had a lower fitness on the validation data ... Fitness for population The fitness of the two best performing individuals on training and validation data tournaments During mating, there were a 98% probability of sexual recombination and 15% probability ... the data and excluded sequences that were too similar to others In this way redundancy in the dataset was reduced For a more detailed description of the extraction and preparation of the dataset,...
- 8
- 430
- 0
báo cáo khoa học: " Whole-Organ analysis of calcium behaviour in the developing pistil of olive (Olea europaea L.) as a tool for the determination of key events in sexual plant " ppsx
... Ca2+ amounts were calculated according to the manufacturer’sprotocol and are given in μg per μl of the sample A standard curve was prepared using known amounts of the Ca 2+ standard included in ... precipitates in the vacuoles of the stigma cells as well as in the intracellular spaces between them The stigmatic surface is the main place for signal exchange between pollen and stigma Ca2+ ions are ... closed and practically isolated from any external biotic and abiotic factors Furthermore, at this stage, the main task of the flower bud is to complete the growth and maturation of anthers and the...
- 12
- 529
- 0
Báo cáo sinh học: " A tree-based method for the rapid screening of chemical fingerprints" potx
... bit In fact we only demand that the data is arranged in some binary tree The match-bits of a given node are computed as all bits that are not a match-bit in any ancestor and for which all fingerprints ... Methods A fingerprint is a bitstring of length N Let A and B be bitstrings, and let |A| denote the number of 1-bits in A Let A ∧ B denote the logical and of A and B, that is, A ∧ B is the bitstring ... 38(6):983-996 Swamidass SJ, Baldi P: Bounds and Algorithms for Fast Exact Searches of Chemical Fingerprints in Linear and Sublinear Time Journal of Chemical Information and Modeling 2007, 47(2):302-317...
- 10
- 372
- 0
Báo cáo khoa học: "SOFA is superior to MOD score for the determination of non-neurologic organ dysfunction in patients with severe traumatic brain injury: a cohort study" doc
... SOFA-defined and MOD-defined cardiovascular failure, SOFA-defined but not MOD-defined cardiovascular failure, MOD-defined but not SOFA-defined cardiovascular failure, and patients without SOFA-defined ... neurocritical care patients will be a function of the cardiovascular and respiratory component scores of the MOD and SOFA scoring systems These data suggest that SOFA-defined cardiovascular failure has ... Visual Basic program determined the most abnormal value for each parameter The program then calculated the appropriate SOFA value (range 0–4), which was then exported to a local longitudinal ICU...
- 10
- 388
- 0
Báo cáo y học: " A method for the generation of standardized qualitative dynamical systems of regulatory networks" doc
... knowledge of the dynamical behavior of a network, especially in those cases where few kinetic data are available Thus, we provide a method for incorporating the dynamical perspective in the analysis of ... Indeed, the method requires as sole input the information regarding the nature and directionality of the regulatory interactions We provide an example of the applicability of our method, using it ... default values for all parameters Indeed, the continuous dynamical system of the Th network has a total of 58 parameters, all of which were set to the default value of 1, and one parameter (the...
- 18
- 288
- 0
Development of a fluorescence correlation spectroscopy method for the study of biomolecular interactions
... was first calibrated with fluorescein and AXSA with a single optic fiber and then tested for cross-correlations with biotinylated rhodamine green nanocontainers and AXSA using an optic fiber array ... Simulations of triple pair-wise CCF amplitudes of the binding of ligands A and ligand B per receptor R 5.12 Simulations of A × B CCF amplitudes of ligands A and ligand B binding ... presented Chapters and describe the theory and experimental realization of dual-color SW-FCCS As a proof -of- principle, the binding of biotin to streptavidin is tested and the resolution of binding is...
- 162
- 393
- 0
Tài liệu Báo cáo khoa học: A systems biology approach for the analysis of carbohydrate dynamics during acclimation to low temperature in Arabidopsis thaliana doc
... 6-phosphate; 30% KOH was added to the control of each assay Reactions were incubated for 30 at 25 and °C, and then at 10 at 95 °C Anthrone 0.2% in 95% H2SO4 was added, and the samples were incubated ... assimilate export to sink organs and flux into further pools of carbon-containing metabolites and structural components, e.g amino acids and cell wall components Therefore, the real rates of export of ... content and a simultanous reduction in hexose concentration, particularly during the initial period of cold exposure Using RNA interference-mediated inhibition of the dominating vacuolar invertase ATbFRUCT4...
- 13
- 707
- 0
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose