a reliable tool for the analysis of cellular processes

APPLICATIONS OF IMMUNOCYTOCHEMISTRY pot

Ngày tải lên : 28/06/2014, 08:20

... Chapter Immunoelectron Microscopy: A Reliable Tool for the Analysis of Cellular Processes 65 Ana L De Paul, Jorge H Mukdsi, Juan P Petiti, Silvina Gutiérrez, Amado A Quintar, Cristina A Maldonado ... number of species, a wide, versatile range of secondary antibodies are available to detect any primary antibody An additional advantage of using secondary antibodies is that several secondary antibody ... channels at the plasma membrane using ICC, only the small extracellular parts of the ion channel are available for antibody binding Such extracellular loops are relatively well-conserved between channels...

330
233
1

Tài liệu Báo cáo khoa học: Post-translational modiﬁcations of the linker histone variants and their association with cell mechanisms docx

Ngày tải lên : 18/02/2014, 08:20

... A A A P – pS P P P P A A – P A S A A A P A A A A A A A mK K K K K aK – A A A A A A A K K K K K K amK A A P A A A R K K K K K K pS A A A A A A pS T T T T T T T K K K K K K A K K K K K K K K K K ... variation acting as a marker for a particular phenotype However, the main aim of Sarg et al [34] was to demonstrate the use of a particular chromatography technique, rather than to ﬁrmly establish ... human and mouse were taken from [43], and the data for chicken were taken from [44] Chicken H101 H110 H102 H103 H11L H11R H5 a- S a- S a- S a- A a- S a- A a- pT T T T pT T pT pS A A A A A A A A A A A P...

13
633
0

báo cáo khoa học: " Manufacture of IRDye800CW-coupled Fe3O4 nanoparticles and their applications in cell labeling and in vivo imaging" ppt

Ngày tải lên : 11/08/2014, 00:22

... biodegradability of superparamagnetic core-shell nanoparticles Biomaterials 2010, 31:1316-1324 19 Hatanaka S, Matsushita N, Abe M, Nishimura K, Hasegawa M, Handa H: Direct immobilization of fluorescent ... 14 Lacava LM, Garcia VAP, Kuckelhaus S, Azevedo RB, Lacava ZGM, Silva O, Pelegrini F, Gansau C, Buske N, Morais PC: Magnetic resonance and light microscopy investigation of a dextran coated magnetic ... JC, Gazeau F: Intracellular uptake of anionic superparamagnetic nanoparticles as a function of their surface coating Biomaterials 2003, 24:1001-1011 57 Wilhelm C, Gazeau F: Universal cell labelling...

14
399
0

Intein mediated generation of n terminal cysteine proteins and their applications in live cell bioimaging and protein microarray

Ngày tải lên : 08/11/2015, 16:30

... TCC AAC TGC AGA GCC atg tcc cct ata cta- 3’ 5’-GGT GGT CTG CAG tca gtc acg atg cgg-3’ 19 pT-Rex-DEST30-intein/EGFP 5’-GGGG ACA AGT TTG TAC AAA AAA GCA GGC TTC GAA GGA GAT AGA ACC ATG GCT ATC ... minimal modifications to the target protein, apart from the introduction of a few extra amino acid residues at the N-terminus of the target protein We have shown that the strategy may be readily applied ... glutathione was conjugated with Cy3-NHS (Amersham Pharmacia, USA) for 1h in 0.1M NaHCO3, pH according to the manufacturer’s protocol and purified through a NAP-5 column (Amersham Pharmacia, USA)...

77
200
0

Aspects of carbohydrate quality and their relevance for risk markers of type 2 diabetes and related health outcomes

Ngày tải lên : 25/11/2015, 14:52

... [40] The mean of the individual ratios of the two measured AUC are then multiplied by 100 to derive the foods GI value Over the years, GI values for a wide THEORETICAL BACKGROUND range of carbohydrate ... indicated a prevalence of 7.2% among adults aged between 18 and 79 years with an additional 2.1% of undiagnosed cases [65] Compared to data from the German National Health Interview and Examination ... cytokines and macrophages, inflammatory signaling pathways can also be activated intracellularly through metabolic 19 THEORETICAL BACKGROUND stress [118]: the functional capacity of the ER can be overburdened...

203
431
0

GROWTH PERFORMANCE AND SPERM QUALITY OF STRESS NEGATIVE PIÉTRAIN BOARS AND THEIR HYBRIDS WITH DUROC

Ngày tải lên : 28/08/2013, 11:59

... performance evaluation started at months (60 days) of age and ended on 7.5 months (225 days) of age The animals were weighted using an electronic balance at starting (BW60) and ending (BW225) dates ... Wysokinska, A. , S Kondracki, D Kowalewski, A Adamiak, E Muczynska (2009) Effect of seasonal factor on the ejaculate properties of crossbred DurocxPiétrain and PiétrainxDuroc boars as well as purebred ... Frédéric, Pascal Leroy and Đặng Vũ Bình The data were analyzed using the general linear model (GLM) procedure of SAS software (SAS 1989) in order to identify significant sources of variation The least-squares...

6
734
0

Characteristics of Leachate from Citrus Groves and their Changes in the Collecting Reservoirs in Matsuyama, Japan

Ngày tải lên : 05/09/2013, 10:17

... Osaka, Kobe, Hiroshima, and others Therefore, it is considered that a large amount of pollutants runs into the sea from the urban as well as industrial areas As the area around the Seto Inland ... around Matsuyama for multipurpose usage such as agriculture and urban life There are citrus groves around the urban area of Matsuyama, which occupy more than 14% of the whole area Therefore, it ... increased amount of SS to the increased amount of Chl .a was higher than that of the algae Increased amount of SS were higher in the cases of high nitrate concentration - 117 - Journal of Water and...

10
717
0

A study of the linguistic features of suggestion verbs in english and their vietnamese equivalents

Ngày tải lên : 26/11/2013, 13:17

... find out the similarities and differences between the syntactic features of ESVs and VSVs - Analyzing data of ESVs and VSVs in terms of the semantic features and making a contrastive analysis to ... 22 Table 4.46 A Summary of the Meaning Nuances of SUGGEST Table 4.48 A Summary of the Comparison of the Meaning and Their Vietnamese Equivalents Verb English Meaning Nuances Vietnamese Equivalents ... of any status can have good ideas to suggest - More relate to the moral or emotional aspects Table 4.49 The Semantic Specification of the Groups of SVs Table 4.47 A Summary of the Meaning Nuances...

13
1.3K
5

A study of semantic and syntactic features of english famous love sayings and their vietnamese translation

Ngày tải lên : 26/11/2013, 13:21

... beliefs, arts, morals, law, custom, and any other capabilities, and habits acquired by man as a member of a society” ♦ Relation of Culture and Language The relationship between language and culture are ... below Authentic Data I have had a survey at a foreign language class at Quang nam university In which, the learners are asked to translate some EFLSs into Vietnamese The result shows that the learners ... process, maybe culture or habits of using languages of Vietnamese translators It means that the translation process is a complicate process Therefore, the learners and the translators of English may...

26
1.2K
3

Tài liệu an analySiS of euro area Sovereign CDS anD their relation With government bonds docx

Ngày tải lên : 16/02/2014, 02:20

... before the peak of the crisis in fall 2008 Since the start of the crisis, with a dramatic re-pricing of risk, for Germany, France, the Netherlands, Austria and Belgium the cash market has a predominant ... This table reports the results of a factor analysis on the residuals of the baseline regressions (1) of CDS and bond spread changes on the explanatory variables The sample periods are January 2006 ... for the position are quite volatile and may be sizable 16 Chart also shows the impact of the increased concerns about the fiscal situation of a number of euro area countries on the basis Furthermore,...

49
1.5K
0

Tài liệu Báo cáo khoa học: Identiﬁcation of ATP-NADH kinase isozymes and their contribution to supply of NADP(H) in Saccharomyces cerevisiae docx

Ngày tải lên : 20/02/2014, 01:20

... yef1-attB1FSD AAAAAGCAGGCTCCGAAGGAGATATAAAA ATGAAAACTGATAGATTACTG AGAAAGCTGGGTGGATTGCAAAATGAGCCTGAC ACAAGTTTGTACAAAAAAGCAGGCT ACCACTTTGTACAAGAAAGCTGGGT CAATAAATCTGCTTACGTGACATTTTTTACTAAAAGAGAAT ATGCGTACGCTGCAGGTCGAC ... TTAATCGATGAATTCGAGCTCG CATAAATAAAAGGATAAAAAGGTTAAGGATACTGATTAAA ATGCCAATTCTGTGTTTCCCGGAAATG CTTAGAGAATCTCATTGAATCTTTGCATTCAGAGCGT TTAGTAAAGTTCGTTTGCCGATACATG CGTTATGAAAATCACTATTATCCCC AAAAGCTTAGATTGCAAAATGAGCCTGACGA ... ATGCGTACGCTGCAGGTCGAC GAACCCTTGACTACGGAAACGCAGGATGTGGGAAATCG TTAATCGATGAATTCGAGCTCG CATAAATAAAAGGATAAAAAGGTTAAGGATACTGATTAAA ATGCGTACGCTGCAGGTCGAC CTTAGAGAATCTCATTGAATCTTTGCATTCAGAGCGT TTAATCGATGAATTCGAGCTCG...

13
560
0

Tài liệu Báo cáo khoa học: Localization of N-linked carbohydrate chains in glycoprotein ZPA of the bovine egg zona pellucida pptx

Ngày tải lên : 21/02/2014, 03:20

... position of the acidic fraction was the same as that of the monosialylated chain, and all the acidic chains in this fraction were neutralized by sialidase digestion From the peak area, the molar ratios ... excitation at 310 nm and emission at 375 nm Sugar mapping analysis of the pyridylaminated N-linked chains The pyridylaminated neutral fraction of N-linked chains was chromatographed on a Shim-pack ... and Asn527 Sugar mapping of the carbohydrate chains from each N-glycosylation site Fig Time course of N-glycanase digestion of ZPA At least half of the ZPA molecules are speciﬁcally cleaved by an...

10
514
0

Tài liệu An International Comparison of Milk Supply Control Programs and Their Impacts pot

Ngày tải lên : 22/02/2014, 05:20

... The US and New Zealand have both significantly increased their share of the world market, while the EU and Canadian shares have been declining Australia’s share has also declined, but that has ... This means that the remaining farms are more than making up for the production lost by outgoing farms The compound average growth rate (CAGR) in the EU, Canada, and New Zealand are almost exactly ... Eurostat, DG Agri, USDA, CDC, MAF, Informa Estimates The average size of dairy farms is getting larger in all countries examined Increased specialization lets each farmer manage a greater number of...

83
436
0

Báo cáo khoa học: Comprehensive sequence analysis of horseshoe crab cuticular proteins and their involvement in transglutaminase-dependent cross-linking potx

Ngày tải lên : 07/03/2014, 21:20

... R&R Antibacterial Antibacterial Antibacterial Antibacterial Antibacterial Antibacterial Antibacterial Antibacterial Unknown Antibacterial Antibacterial Antibacterial Antibacterial Antibacterial ... Kawabata S, Nagayama R, Hirata M, Shigenaga T, Agarwala KL, Saito T, Cho J, Nakajima H, Takagi T & Iwanaga S (1996) Tachycitin, a small granular component in horseshoe crab hemocytes, is an antimicrobial ... DNA sequence analysis [62] Rapid ampliﬁcation of cDNA ends (RACE) Analysis by 5¢- and 3¢-RACE was performed using a SMARTTM RACE cDNA ampliﬁcation kit (Clontech Laboratories, Palo Alto, CA, USA)...

13
582
0

Báo cáo khoa học: Identiﬁcation of microsomal rat liver carboxylesterases and their activity with retinyl palmitate potx

Ngày tải lên : 08/03/2014, 10:20

... follows: for ES10 5¢-ATCAGCTTAGCAATGGGCTTG CTA-3¢; ES4 5¢- TCGGCAGCACTACATTGTCAAC-3¢; ES3 5¢- GAGTCTCCGTGCAAATCCAGCG-3¢; D50580 5¢-TGTTCTTCAGAACAGCCCGCATG-3¢; AB010635 5¢-CAGCGGGAATCATCTTGAAGACC-3¢ and ... the concanavalin A column had only 2% or 19 units of carboxylesterase activity with a Each carboxylesterase protein band that was separated by preparative and analytical nondenaturing PAGE was ... 5¢-AGGCCCAGGAACGGGATTCC-3¢ for 5¢ RACE and 5¢-GATAAATCTGAGGTGGTCTACAAG-3¢ for 3¢ RACE were used to amplify the new gene with the PCR reagent concentrations described above The cDNA was denatured at 95 °C for and...

12
439
0

Polymer assisted synthesis of aligned amorphous silicon nanowires and their core shell structures with au nanoparticles

Ngày tải lên : 16/03/2014, 15:06

... will lead to a large amount of carbon nanoparticles having high chemical activity The growth of SiNWs may start from the reaction of the active carbon nanoparticles with the native oxide layer ... dispersed Au nanoparticles, we explain as followed: under the ultrasonication, some AuClÀ anions in the solution of HAuCl4 are uni4 formly absorbed on the surface of the SiNWs Because of the high standard ... of them are straight and have a smooth surface Fig 3b shows a TEM image of individual curly wire with the average diameter of 400 nm, revealing the typical structure of wire-like spherical particle...

5
467
0

facile synthesis of porous a - fe2o3 nanorods and their application in ethanol sensors

Ngày tải lên : 19/03/2014, 16:48

... capability for practical application For practical use, the selectivity of the sensor is a necessary consideration Hence, we also examined the gas-sensing of the same sensor on the basis of the ... Information) At a shorter reaction time of only min, there are almost no nanorods formed, and the average diameter of the nanoparticles is about nm As the reaction time increased to 10 min, part ... Thermogravimetry-differential thermal analysis (TG-DTA) of the as-prepared R-FeOOH precursor was conducted on a ZRY2P thermal analyzer Ten milligrams of an R-FeOOH sample was heated from room temperature to 600 °C in air...

5
458
1

BENEFITS OF E-CRM FOR BANKS AND THEIR CUSTOMERS pdf

Ngày tải lên : 22/03/2014, 21:20

... cooperative and careful at handling customer’s data availability of customers’ information and staff for assistance 45 DATA ANALYSIS Trust Michael does not perceive any risk from the services of the bank ... He also added up by saying that the banks services have a lot of quality in it Quality features like the availability of latest information about the new services on the website of the organization, ... important quality features seen by him in their services 39 DATA ANALYSIS Chapter 6: Data Analysis This chapter will analyze the empirical data collected and presented in chapter in form of two banks...

73
710
0

Báo cáo khoa học: Identiﬁcation of rice TUBBY-like genes and their evolution Qingpo Liu docx

Ngày tải lên : 23/03/2014, 07:20

... (AtTLPs) as queries, psiblast was seeded to search the local and Oryza sativa protein database in NCBI with an e-value of 10 Moreover, a psi-blast search against the nonredundant GenBank database ... Aa, Aedes aegypti; Ag, Anopheles gambiae; Am, Apis mellifera; At, Arabidopsis thaliana; Bt, Bos taurus; Ca, Cicer arietinum; Cb, Caenorhabditis briggsae; Ce, Caenorhabditis elegans; Cf, Canis familiaris; ... was observed that the chemical properties of the amino acid at site 317 were signiﬁcantly different between plant and animal tubby domains In plants, the amino acid at site 317 was the invariant...

9
381
0

báo cáo hóa học: " Occurrence of post traumatic stress symptoms and their relationship to professional quality of life (ProQoL) in nursing staff at a forensic psychiatric security unit: a cross-sectional study" potx

Ngày tải lên : 18/06/2014, 18:20

6
449
0