a portion of the script pane shows a new textformat object is created and the fontforteid is used as the new font
Báo cáo khoa học: "Adenocarcinoma of the third portion of the duodenum in a man with CREST syndrome" pot
Ngày tải lên :
09/08/2014, 07:21
... duodenal adenocarcinoma has been associated with colon cancer, gastric polyps, especially villous and tubulovillous adenomas, familial adenomatous polyposis (FAP) and Crohn's disease It has been ... has been stated that primary duodenal adenocarcinoma is one of the main causes of death in patients with FAP [11] A case of an early duodenal adenocarcinoma from a Brunner's gland has been reported ... syndrome), sarcoidosis and esophageal adenocarcinoma in a 50-year-old Japanese female has been reported [3] Finally, we report the first case of a male patient with CREST syndrome and duodenal adenocarcinoma...
- 4
- 202
- 0
n order to better illustrate the necessary functions and features of this application, a rainwater retention basin is assumed as example
Ngày tải lên :
01/07/2014, 21:04
... PLC sem Watchdog [006] - Programas demo PLC S7-1200 da SIEMENS (Simatic) This configuration example CE-X25 helps to solve the tasks displayed The focus is on the library blocks which enable SMS-Sending ... Library for STEP Basic V11 Containing also the outdated library based on STEP V10.5 CE-X25_S7-1200_SM S_library.zip Configuration Example X25 (Documentation based on the Startup-Code) ConfigurationExampl ... 25545680 Latest modification Startup-Code and library with the actual version counter V1.2 and the append ant documentations is now adapted to STEP V11 Additional search terms wireless, m2m, without...
- 3
- 300
- 0
The a and b adapters are used as priming sites for both amplification
Ngày tải lên :
19/03/2014, 22:32
... ligase • The strands are denatured using sodium hydroxide to release the ssDNA template library (sstDNA) The Adapters • The A and B adapters are used as priming sites for both amplification and sequencing ... Preparation of the DNA • DNA is fragmented by nebulization • The DNA strand’s ends are made blunt with appropriate enzymes • A and “B” adapters are ligated to the blunt ends using DNA ligase ... (PicoTiterPlate device) • The size of the wells not allow more than one ssDNA bead to be loaded into a well • Enzyme beads and packing beads are added Enzyme beads containing sulfurase and luciferase, and...
- 19
- 390
- 0
By the Light of the SoulMary Eleanor Wilkins-Freeman..By the Light of the Soul A Novel By Mary E. Wilkins Freeman Author of “The Debtor” “The Portion of Labor” “Jerome” “A New England Nun” Etc. etc.1907To Harriet and Carolyn Alden..By the Light o pptx
Ngày tải lên :
16/03/2014, 18:20
... saw, her father enter the room with his bath-robe slipped over his pajamas, and approach the bed “What on earth is the matter?” he said He also laid hands on Maria, and, at his touch, she became ... Chapter II Maria and her father entered the house, which was not far It was a quite new Queen Anne cottage of the better class, situated in a small lot of land, and with other houses very near ... fact scarcely needed words of assent “Damp as it is, too,” said her mother Mrs Edgham extended a lean, sallow hand and felt of the dainty fabric “It is just as limp as a rag,” said she, “about...
- 488
- 398
- 0
Báo cáo khoa học: "The script concordance test in radiation oncology: validation study of a new tool to assess clinical reasoning" potx
Ngày tải lên :
09/08/2014, 09:22
... particular format of the SCT and on the classification of the AJCC (American Joint Committee on Cancer) of the tested cancers Participation was voluntary Demographic data was collected for students and ... coefficient The Levene test was used to evaluate the homogeneity of the variance of the three groups ANOVA analysis was planned for group comparison In case of lack of variance http://www.ro-journal.com/content/4/1/7 ... analysis and interpretation of data and has been involved in revising the manuscript critically DN contributed to acquisition of data and revised the manuscript BC contributed to conception and...
- 6
- 392
- 0
Báo cáo y học: " Induction of the HIV-1 Tat co-factor cyclin T1 during monocyte differentiation is required for the regulated expression of a large portion of cellular mRNAs" pptx
Ngày tải lên :
13/08/2014, 09:20
... YW and XQ constructed and characterized the HIV-1 viruses and lentiviral vectors used in the study CS performed the analysis of DNA microarray data and performed the statistical analysis AR conceived ... in the dendrogram, a two-way ANOVA was fit to each probeset using activation and knockdown state as explanatory variables A linear contrast analysis was then performed to identify differentially ... β-actin (forward): AGCAAGCAGGAGTATGACGAGTC, β-actin: AGAAAGGGTGTAACGCAACTAAGTC (reverse), CSF1R(forward): TTCTGCTGCTCCTGCTGGTG, CSF1R(reverse): ACCGTTGCTCCTGGCTTCAC, LOX1(forward): ACTGTGAAGGACCAGCCTGATG,...
- 16
- 178
- 0
Báo cáo y học: "A prospective observational study of the relationship of critical illness associated hyperglycaemia in medical ICU patients and subsequent development of type 2 diabetes"
Ngày tải lên :
25/10/2012, 10:02
... to the ACC/AHA criteria [26,27] Statistical analyses MedCalc™ v 9.6.2.0 (MedCalc Software, Mariakerke, Belgium) statistical software was used for all statistical analyses Categorical data are ... in the analysis of results and writing the manuscript All the authors read and approved the final version Acknowledgements The authors are very grateful to Edita Lukić, Goran Madžarac and Alen ... shock); ii) acute coronary syndrome (myocardial infarction and unstable angina); and iii) all other admission diagnoses This division was made due to the fact that sepsis and acute coronary syndromes...
- 8
- 656
- 1
Báo cáo khoa học: "Circadian pattern of activation of the medical emergency team in a teaching hospita"
Ngày tải lên :
25/10/2012, 10:45
... constructed the data base, and was the principle author of the manuscript SB, DG, and SW assisted with construction of the data base HO, GG, and RB contributed with the study design and authorship of the ... drugs and defibrillators Outcome measures Information on the activation of all MET calls is maintained on a hospital switchboard logbook that includes the date and time of the call, as well as the ... medical staff should be available on a 24-hour basis to assess and treat acutely ill hospital patients Utilization of a MET system has been associated with a reduction in all-cause hospital mortality...
- 4
- 541
- 0
Báo cáo y học: "Spontaneous Hemoperitoneum Caused By a Diverticulum of the Sigmoid Colon"
Ngày tải lên :
25/10/2012, 10:51
... which makes its wall weak, as compared to the small intestine that is formed of the inner circular and outer longitudinal muscle layers The vasa recta, which supply the mucosa and submucosa of the ... preparation The bleeding was controlled by #3-0 Vycryl intracorporeal suture, and the invagination of the diverticulum was performed laparoscopically The recovery was uneventful, and the patient ... preliminary findings Am J Gastroenterol 1997;92:924-8 Parks TG Natural history of diverticular disease of the colon Clin Gastroenterol 1975;4:53-69 West BA The pathology of diverticulosis: classical...
- 3
- 531
- 0
Báo cáo y học: "Mirror-Image Arachnoid Cysts in a Pair of Monozygotic Twins: A Case Report and Review of the Literature"
Ngày tải lên :
25/10/2012, 11:00
... our case, the lack of a previous history of trauma, infection and head surgery leads us to believe that the AC was due to a congenital anomaly Mirror images in MZ and AC are not relatively rare ... kidney disease Pediatrics 2002; 110: e13 19 Aarhus M, Helland CA, Lund-Johansen M, et al Microarray-based gene expression profiling and DNA copy number variation analysis of temporal fossa arachnoid ... associated with the pathogenesis of temporal fossa AC Helland et al 20 found the Na+–K+–2Cl− cotransporter NKCC1 gene was escalated in AC and NKCC1 was present in the AC wall These finding indicated NKCC1...
- 4
- 652
- 0
Báo cáo y học: "Aplasia and Agenesis of the Frontal Sinus in Turkish Individuals: A Retrospective Study Using Dental Volumetric Tomograph"
Ngày tải lên :
25/10/2012, 11:04
... above a line tangential to the supraorbital margin Frontal sinus aplasia was also defined by an oval-shaped sinus with the lateral margin medial to a vertical line drawn through the middle of the ... higher than that of a right unilateral agenesis in men, which was the opposite of the case in women In addition, the authors also reported that a greater frequency of unilateral agenesis of the sinus ... Sinuses, Nasolacrimal Passageways and Olfactory Organs in Man Philadelphia: P Blakiston’s Son; 1920 Som PM, cCurtin HD Head and neck imaging In: Som PM, Shugar JMA, Brandwein MS, eds Anatomy and Physiology,...
- 5
- 577
- 0
Báo cáo y học: "A Comparative Effectiveness Study of Bone Density Changes in Women Over 40 Following Three Bone Health Plans Containing Variations of the Same Novel Plant-sourced Calcium"
Ngày tải lên :
25/10/2012, 11:10
... had an average age of 57.4 (41-89) which is consistent with the age-related decline of 1% to 2% cited above for women of menopausal age as well as with the data reported in the meta-analysis As ... secured and audited all study data, conducted all of the statistical analyses, and contributed significantly to the preparation and submission of the manuscript Preuss HG contributed to the study ... Exova Labs, Chicago, IL for confirmation of nutrient levels and absence of heavy minerals and other contaminating ingredients Calcium, magnesium and other minerals were validated by Advanced Labs,...
- 12
- 663
- 0
Báo cáo y học: " Experimental ablation of the pancreas with high intensity focused ultrasound (HIFU) in a porcine model"
Ngày tải lên :
25/10/2012, 11:18
... ear veins and ketamine was infused (50 mg/h) for anesthesia Diazepam was administered as needed The HIFU ablation procedure complies with the guidance of the National Standard of China and was ... laparotomy was performed, and the pancreas was ablated directly through the surface of the pancreas with an HIFU transducer In the Group B and Group C, extracorporeal HIFU ablation the pancreas was performed ... locate the target region The real-time US imaging device was used to locate the head of pancreas as the pre-designed target region The spatial volumes of the target regions in the X, Y and Z axes...
- 7
- 481
- 0
Báo cáo y học: "omparative Efficacy and Tolerability of 5-Loxin® and Aflapin® Against Osteoarthritis of the Knee: A Double Blind, Randomized, Placebo Controlled Clinical Study"
Ngày tải lên :
25/10/2012, 11:40
... conducting data analysis and writing the manuscript Abbreviations AKBA: 3-O-acetyl-11-keto-beta-boswellic acid; ANOVA: analysis of variance; ASRAM: Alluri Sitarama Raju Academy of Medical Sciences; ... Krishnaraju AV, Sundararaju D, Vamsikrishna U, Suryachandra R, Machiraju G, Sengupta K and Trimurtulu G Safety and Toxicological Evaluation of Aflapin®: a Novel Boswellia- Derived Anti-inflammatory ... removing volatiles under high vacuum The composition was standardized to contain at least 20% AKBA Study design This trial was performed at Alluri Sitarama Raju Academy of Medical Sciences (ASRAM),...
- 12
- 606
- 0
Báo cáo y học: " Safety and efficacy of undenatured type II collagen in the treatment of osteoarthritis of the knee: a clinical trial"
Ngày tải lên :
26/10/2012, 09:48
... comparisons between the UC-II and G+C groups were made at each visit using analysis of variance, using the baseline visit as a covariate SAS version 9.1 has been used to perform the statistical analysis ... analyzed by MDS Laboratory Services (London, Ontario, Canada) Appropriateness of Measurements The efficacy and safety assessments used in this study were standard for OA and are widely used and ... Ontario and Corunna, Ontario, Canada Physical assessment, medical history, clinical assessments and blood tests as indicated Screening all dogs experienced a relapse of overall pain, exercise-associated...
- 10
- 706
- 0
Báo cáo y học: " Laugh Yourself into a Healthier Person: A Cross Cultural Analysis of the Effects of Varying Levels of Laughter on Health"
Ngày tải lên :
26/10/2012, 09:57
... Statistical analysis The data was analyzed using both parametric and non parametric statistics and the specific test used was indicated with the respective results If assumptions of normality and ... emotional well-being, is defined as the balance between pleasant affect and unpleasant affect (30) Life satisfaction included satisfaction of occupation, marriage and life in general, and emotional ... cortex and pyramidal tract to the ventral brain stem The involuntary path is comprised of amygdala, thalamic, hypothalamic, and subthalamic areas, in addition to the dorsal brain stem Moreover, the...
- 12
- 757
- 0
Báo cáo y học: " A Novel Variable Number of Tandem Repeat of the Natriuretic Peptide Precursor B gene’s 5’-Flanking Region is Associated with Essential Hypertension among Japanese Females"
Ngày tải lên :
26/10/2012, 10:04
... (sense, 5’-AAGGAGGCACTGGGAGAGGGGAAAT-3’ (bases -1323 to -1299) and antisense, 5’CCCCACCAAGCCAACACAGGATGGA -3’ (bases -919 to-895) were used to amplify a 429-bp product from genomic DNA (Fig 1A) The ... AAGGAGGCACTGGGAGAGGGGAAAT -3’ (bases -1323 to -1299 from the major transcriptional initiation site) and antisense, 5’-AATTAGCTGGGCATGGTGGCAGGCG-3’ (bases -1075 to -1051)) that recognize part of the ... in the Japanese Circ Res 2000; 86: 841-5 13 Nakayama T, Soma M, Rahmutula D, Ozawa Y, Kanmatsuse K Isolation of the 5'-flanking region of genes by thermal asymmetric interlaced polymerase chain...
- 7
- 612
- 1
A critical discourse analysis of the news on north korean missile launches part 3
Ngày tải lên :
07/11/2012, 14:39
... LIST OF TABLES Table Names for US-Japan coalition and North Korea in VOA Table Names for US-Japan coalition and North Korea in Nhan Dan Table Negativization of North Korea’s activities in VOA ... in VOA Table Positivization of the US- Japan coalition’s activities in VOA Table Lexicalization of North Korea’s activities in Nhan Dan Table Lexicalization of the US-Japan coalition’s activities ... in Nhan Dan Table Over-lexicalization of the North Korea’s missile launches in VOA Table Over-lexicalization of the North Korea’s missile launches in Nhan Dan Table Quotation patterns of news...
- 4
- 828
- 6