a novel factor in the individualization of thiopurine therapy
Báo cáo khoa học: Light regulation of CaS, a novel phosphoprotein in the thylakoid membrane of Arabidopsis thaliana doc
Ngày tải lên :
30/03/2014, 04:20
... 5¢-AAATGGCAACGAAGTCTTCAC-3¢ and 5¢-CAGTCGGAGCTAGGAAGGAA-3¢ Isolation of plasma membrane, intact chloroplasts, stroma and thylakoids The plasma membrane fraction of Arabidopsis was isolated as ... GGCTTAAUATGGCTATGGCGGAAATGG CAACGA) and nt115 (reverse: GGTTTAAUTAAGGATC CTTAATTAAGCCTCAGCGGGTCGGAGCTAGGAAG GAACTT), where the underlined sequence was included for regeneration of a USER cloning cassette The PCR ... is a crucial component of the protein phosphorylation cascade involved in CaS phosphorylation Characterization of the CaS mutant lines The mutant Arabidopsis lines with T-DNA insertion in the intron...
- 11
- 446
- 0
báo cáo hóa học: " A role for DNA-dependent activator of interferon regulatory factor in the recognition of herpes simplex virus type 1 by glial cells" pot
Ngày tải lên :
19/06/2014, 22:20
... Rintahaka J, Søby S, Horan KA, Poltajainen A, Østergaard L, Paludan SR, Matikainen S: Early innate recognition of herpes simplex virus in human primary macrophages is mediated via the MDA5/MAVSdependent ... isolated from the brains of infected animals (Figure 3B) in the absence of significant increases in levels of this viral sensor in total brain protein isolates (Figure 3A) Finally, we assessed the ... HSV-1 and elicit inflammatory CNS damage Replicating DNA viruses generate genomic DNA that serves as a ligand for DAI DAI then associates with IPS-1 and STING, subsequently activating NF-kB via the...
- 12
- 529
- 0
Báo cáo y học: "Familial Polycythemia Caused by a Novel Mutation in the Beta Globin Gene: Essential Role of P50 in Evaluation of Familial Polycythemi" potx
Ngày tải lên :
08/08/2014, 16:23
... interface of alpha and beta chains of the Hb tetramer Several hemoglobin variants have substitutions affecting this interface All these substitutions can affect the cooperative nature of oxygen binding ... Hemoglobin 2005, 29:91-106 Giardine B, van Baal S, Kaimakis P, Riemer C, Miller W, Samara M, Kollia P, Anagnou NP, Chui DH, Wajcman H, Hardison RC, Patrinos GP HbVar database of human hemoglobin variants ... polycythemia in her mother, maternal grandmother and her younger sister Physical examination was unremarkable Laboratory parameters were remarkable for elevated hemoglobin (17.2 gm%) and hematocrit...
- 5
- 418
- 0
Báo cáo y học: "γ A novel mechanism for the regulation of IFN-γ inducible protein-10 expression in rheumatoid arthritis" ppsx
Ngày tải lên :
09/08/2014, 01:21
... IP-10 in RA synovitis, because most of the leukocytes infiltrating the SF of rheumatoid joints are PMNs PMNs in the RA SF are in an activated state, and produce a variety of other inflammatory ... a potent angiogenic factor, namely vascular endothelial growth factor, was markedly induced by the interaction of FLS with synovial leukocytes via the integrin/ICAM-1 pathway [19] Taken together, ... of IP-10 as compared with OA SF Immunolocalization analysis indicated that IP-10 was associated mainly with infiltrating macrophage-like cells, and fibroblast-like cells in the RA synovium, as...
- 8
- 446
- 0
báo cáo khoa học: " The transcription factor PHR1 plays a key role in the regulation of sulfate shoot-to-root flux upon phosphate starvation in Arabidopsis" potx
Ngày tải lên :
11/08/2014, 11:21
... 10:78 Tomatsu H, Takano J, Takahashi H, Watanabe-Takahashi A, Shibagaki N, Fujiwara T: An Arabidopsis thaliana high-affinity molybdate transporter required for efficient uptake of molybdate from ... role in sulfate translocation within developing seeds Plant Physiol 2010, 154:913-926 Kataoka T, Watanabe-Takahashi A, Hayashi N, Ohnishi M, Mimura T, Buchner P, Hawkesford MJ, Yamaya T, Takahashi ... M, Hawkesford MJ, Saito K: The roles of three functional sulphate transporters involved in uptake and translocation of sulphate in Arabidopsis thaliana Plant J 2000, 23:171-182 Kataoka T, Hayashi...
- 10
- 427
- 0
báo cáo khoa học: " The isolation and mapping of a novel hydroxycinnamoyltransferase in the globe artichoke chlorogenic acid pathway" pptx
Ngày tải lên :
12/08/2014, 03:20
... GGGTTTCATATGACTATCGGAGCTCGTGAT CGGGATCCCTAGAAGTCATACAAGCATTT TTTTTAAGCTAACACGAGAC TCTCATAGGAGCTGTAATTG TAAAATGGACGATCAGTATC TTATGTTCAGATTTGGACTC TACTTTCTACAACGAGCTTC ACATGATTTGAGTCATCTTC GGGTTTCATATGAAGATCGAGGTGAGAGAA ... CGGGATCCTTAGATATCATATAGGAACTTGC ATATTCACGACGACTCCGATAGCGGTATCG CACGTCGGCTTCGACTGTAGGTCGACT CACGAGACCAAGTCAATGCACTCAAAGGA GATTCGGGCACTTAAACGTATGAGCCCC CGTGGACTATCAGACGATCAACCATCC TCGTCCGTCAGTAGCCACGTACAGTATC ... TCGTCCGTCAGTAGCCACGTACAGTATC CACAAAACCAAAACTTCACATCCCATCC CTCACTATGGATTCTCCTAGCGGTGTCG Page 10 of 13 (page number not for citation purposes) BMC Plant Biology 2009, 9:30 μg protein was incubated in presence of...
- 13
- 650
- 0
Báo cáo y học: " Recently published papers: A review of novel strategies in the prevention of hospital-acquired infections, the ability of intensivists to perform echocardiography, and the benefit of polymyxin B haemoperfusion in abdominal sepsis" pot
Ngày tải lên :
13/08/2014, 18:22
... specific early exercise and mobilisation (physical and occupational therapy) In their group of 104 patients, early physical and occupational therapy significantly increased the number of patients ... [11] They trained a group of intensivists with hours of didactic teaching and hours of practical teaching, and provided a range of pre-recorded examinations for the intensivists to study in their ... and colleagues present the argument that early physical and occupational therapy can reduce the duration of time on a ventilator, and can thereby reduce the mortality associated with this intervention...
- 3
- 471
- 0
Focus - A simplicity manifesto in the Age of Distraction
Ngày tải lên :
05/01/2014, 15:25
... inspiration in what others have done, you get ideas, you gather the raw materials for creating But consuming and communicating aren’t creating They aid creating, they lay the groundwork, but at some point ... what are you afraid of? Then shine a light on these fears with actual facts — what harm has actually been caused so far? Try to a short test — an hour, a day, a few days, a week — and see what ... were insulted or indignant, either feeling like I was insulting their way of doing things, or that I was some kind of prima donna or “diva” for not wanting to be available through email Interesting:...
- 121
- 552
- 1
Báo cáo khoa học: Estrogen-related receptor a and PGC-1-related coactivator constitute a novel complex mediating the biogenesis of functional mitochondria potx
Ngày tải lên :
06/03/2014, 09:22
... 5¢-CCAGTGCCACACCGTTGAA-3¢ and 5¢-TCCCCAGATGATGCCTTTGTT-3¢; ATP synthase subunit b: 5¢-CCTTCTGCTGTGGGCTATCA-3¢ and 5¢TCAAGTCATCAGCAGGCACA-3¢; ND5: 5¢-TAACCCC ACCCTACTAAACC-3¢ and 5¢-GATTATGGGCGTTGA ... respiration Inhibition of ERRa and PRC in the oxidative FTC-133 model led to a decrease in respiratory chain capacity (COX activity) and mitochondrial mass (CS activity) in a coordinated manner, as ... mice lacking ERRa are viable [10,32] and the inhibition of ERRa in other cell models decreases the respiratory parameter only partially [9] This suggests that other factors are involved in the...
- 13
- 503
- 0
Báo cáo khoa học: Predicting the substrate specificity of a glycosyltransferase implicated in the production of phenolic volatiles in tomato fruit pptx
Ngày tải lên :
28/03/2014, 23:20
... SG a Os an ali th A 4B T7 UG 4F2 A na ia al th a an A na a ia alia na al an th ali A th A 4C 1A 4D T7 4E T7 th na alia A th ana hali B1 ana ali A th 1A 1A T9 UG hali A t 1B C1 T9 T91 UG UG A ... vinifera ax T84 A thaliana UGT76F1 UG a lian tha ali ari icum th a 2F rag a 1A lian GT na copers Fa 6A tha ia an T8 H S ly S3950 A al th ali 1A 76E UGT D1 th na alia lor ico a b an TS ali th A A ... B1 A th aliana CaU GT1 C ro seu UG s T7 1C UG 1A T7 th UG alia 1D T8 na UG A 8A T7 th 2E ali A 2A an th a th al ia ali na an a thalia 1A th alia na na 6B1 A UG T76 C UGT7 A1 CAO69089 V vinifera...
- 11
- 661
- 0
Báo cáo khoa học: Inactive forms of the catalytic subunit of protein kinase A are expressed in the brain of higher primates potx
Ngày tải lên :
30/03/2014, 04:20
... TGCCATGAAGATCTTAGA TGAGCAGTACTACGCCATGA GTAGCCCTGCTGGTCAATGA TTCCGTAGAAGGTCCTTGAG (VII) TTCCGTAGAAGGTCCTTGAG (VII) CCTAATGCCCACCAATCCA (VI) TTCCGTAGAAGGTCCTTGAG (VII) TTCCGTAGAAGGTCCTTGAG (VII) CTAATCTATGAAATGGCAG ... splice variants (Pfu Ultra system; Stratagene) Upper primer 5¢-CACCGCCG CCACCATGGGATTGTCACGCAAATCATCAGATGC ATCT-3¢ and lower primer 5¢-TTAAAATTCACCA AATTCTTTTGCACATT-3¢ yielded Cb3ab and Cb3abD4, ... Supplementary material The following supplementary material is available online: Fig S1 Comparison of human and Rhesus monkey PKA Cb amino acid sequence This material is available as part of the online...
- 13
- 344
- 0
Báo cáo khoa học: Acylation of lysophosphatidylcholine plays a key role in the response of monocytes to lipopolysaccharide ppt
Ngày tải lên :
31/03/2014, 01:20
... (Kirkegaard and Perry, Gaithersburgh, MD, USA) per well The plate was incubated in the dark for 20 and the reaction stopped by the addition of 50 lL of 0.5 M sulfuric acid The plate was read on a Labsystems ... confirms that IFN-c can increase the activity of an enzyme, LPCAT, that participates in the rapid turnover of PtdCho Lysophospholipid acyltransferases maintain membrane lipid composition and the asymmetrical ... and one for TNF -a The level of U 1A mRNA was similar in all samples as shown in Fig 4A This indicated equal extraction efficiency and that SK&F 98625 was not a general transcription inhibitor There...
- 7
- 322
- 0
a novel method for the synthesis of titania nanotubes using
Ngày tải lên :
05/05/2014, 15:26
... titania nanotubular arrays were annealed in a nitrogen and oxygen atmosphere at 500 ◦ C for h in a CVD furnace at a heating rate of ◦ C/min The UAT samples annealed under these conditions are designated ... band gap of carbon-doped titania nanotubes compared with N2 - and O2 annealed nanotubes The lower the band gap of the titania S.K Mohapatra et al / Journal of Catalysis 246 (2007) 362–369 nanotubes, ... annealed titania nanotubes are crystalline (mostly anatase) and show varied activity depending on the material preparation and annealing atmosphere (Fig 12) Titania nanotubes prepared by the sonoelectrochemical...
- 8
- 634
- 0
a novel method for the synthesis of cao nanoparticle
Ngày tải lên :
06/05/2014, 08:55
... colloidal particles in water the high surface area due to smaller particle and many non-aqueous solvents by adsorbing size and the reactive sites tailored in the form onto a broad range of materials, ... angle The average particles size nanoparticles was investigated from line by Debye-Scherrer formula was estimated broadening of the peak at 2θ=0 10° via using to be 15 nm The information obtained ... capping CuO, AP-Fe2O3, AP-Al2O3 and AP-CaO [15 agent was reported Then, we have focused 20] There are several methods for the synthesis our attention on the CaO nanoparticles/ of nanoscale CaO,...
- 12
- 705
- 0
Báo cáo hóa học: "Research Article A Novel Approach to the Design of Oversampling Low-Delay Complex-Modulated Filter Bank Pairs" doc
Ngày tải lên :
21/06/2014, 19:20
... EURASIP Journal on Advances in Signal Processing and secondly using the fact that in case of real-valued signals the real part in frequency domain corresponds to the even part in the time-domain ... only in the passband but also in the transition band The mean value of the group delay ranges below that of linear-phase filters of the same length The observed overall signal delay lies within the ... EURASIP Journal on Advances in Signal Processing delay can always be obtained that ranges below the group delay of a corresponding LP FIR filter However, the absolute minimum value of the passband...
- 13
- 623
- 0
báo cáo hóa học:" Research Article Entire Solutions for a Quasilinear Problem in the Presence of Sublinear and Super-Linear Terms" potx
Ngày tải lên :
21/06/2014, 20:20
... Boundary Value Problems The class of problems 1.1 appears in many nonlinear phenomena, for instance, in the theory of quasiregular and quasiconformal mappings 1–3 , in the generalized reaction-diffusion ... no 2, pp 498–505, 1996 13 A V Lair and A W Shaker, “Classical and weak solutions of a singular semilinear elliptic problem,” Journal of Mathematical Analysis and Applications, vol 211, no 2, pp ... Methods & Applications, vol 10, no 1, pp 55–64, 1986 12 A V Lair and A W Shaker, “Entire solution of a singular semilinear elliptic problem,” Journal of Mathematical Analysis and Applications,...
- 16
- 438
- 0
Báo cáo lâm nghiệp: "Results of a phenological study of the tree layer of a mixed stand in the region of the Drahanská vrchovina Upland" ppt
Ngày tải lên :
07/08/2014, 03:22
... times a week In the summer and autumn season, the observations are carried out once a week The ordinal number of a day from the beginning of the calendar year was assigned to the date of particular ... herbs can also occur Phenological data are a certain expression of the climate character of a given region Thus, they can contribute to assess the variability of weather and also to evaluate the ... leaf area is terminated by the autumn phenological stage (autumn yellowing of leaves) According to budbreak 10% beginning of foliage formation 10% beginning of foliage formation 50% beginning of...
- 12
- 386
- 0
Báo cáo khoa học: "Thickness of cumulus cell layer is a significant factor in meiotic competence of buffalo oocytes" potx
Ngày tải lên :
07/08/2014, 18:20
... nuclear material was scattered in the ooplasm indicating spindle damage Statistical analysis Data for meiotic development of oocytes among all groups was analyzed by chi square procedure using Statistix ... Physiology, Department of Animal Science, University of Minnesota, Saint Paul, USA and Dr Muhammad Aleem Bhatti, Associate Professor, Department of Theriogenology, University of Veterinary and Animal Sciences, ... 647-653 Chauhan MS, Katiyar PK, Madan ML In vitro production of blastocyst in goats, sheep and buffaloes Indian J Anim Sci 1997, 65, 394-396 Chauhan MS, Singla SK, Palta P, Manik RS, Madan ML In vitro...
- 5
- 370
- 0
Báo cáo y học: " Chemokine blockade: a new era in the treatment of rheumatoid arthritis" ppsx
Ngày tải lên :
09/08/2014, 01:23
... can be anticipated that several clinical trials exploring this approach will be reported in the near future Competing interests Conclusion The available data in animal models and initial data ... inhibiting the migration of cells that are able to produce an array of proinflammatory cytokines at the site of inflammation The identification of the best targets will be the subject of future research ... Arthritis Research & Therapy Vol No Haringman and Tak Recently, there has been an enormous upsurge in investigations on the potential of chemokine blockade as a novel therapeutic strategy...
- 5
- 460
- 0
báo cáo khoa học: "Bilateral adrenocortical carcinoma in a patient with multiple endocrine neoplasia type 1 (MEN1) and a novel mutation in the MEN1 gene" potx
Ngày tải lên :
09/08/2014, 01:24
... (especially that the proliferation index was about 5%) as well as the data from the literature, the diagnosis of well-differentiated endocrine carcinoma of the pancreas was established Both adrenals ... probably suggesting that they are not a direct result of inactivation of the MEN1 gene Page of Since the malignant potential of MEN1-related adrenal neoplasia is of important clinical significance, ... female MEN1patient, in whom apart from the prolactine producing pituitary adenoma, the hyperplasia of the parathyroid glands and the well-differentiated non functioning pancreatic endocrine carcinoma,...
- 7
- 412
- 0