a new geophysical tool to investigate the thermohaline structure of the oceans
Báo cáo y học: " Study protocol: The development of a pilot study employing a randomised controlled design to investigate the feasibility and effects of a peer support program following discharge from a specialist first-episode " pdf
Ngày tải lên :
11/08/2014, 16:22
... in a treatment questionnaire (see below) and via a telephone call made by the RA to the new treating clinician asking about attendance at appointments and medication adherence These treatment adherence ... between the PSW and the participant will take place on-site with the case manager and the peer support coordinator present The nature of the intervention will be explained again and both the participant ... other health appointments, help them to locate information about mental health services and social groups, and help them find ways to ensure good mental health once the program is over A total of...
- 7
- 443
- 0
Báo cáo toán học: " A new approach to investigate the interactions between sediment transport and ecotoxicological processes during flood events" ppt
Ngày tải lên :
20/06/2014, 21:20
... SR, AS and HH contributed equally to the content of the article and gave their final approval All authors read and approved the final manuscript Competing interests The authors declare that they ... kg−1) A total amount of about 700 kg artificial sediment was prepared for the experiments in the annular flume and half of the sediment was spiked with the abovedescribed PAHs This approach was ... one of the major challenges of this proofof-concept study The characterization of sedimentological parameters resulted in critical bed shear stresses and temporal variations of suspended particulate...
- 5
- 435
- 0
A computational study to investigate the effects of insulation and EGR in a diesel engine
Ngày tải lên :
05/09/2013, 16:11
... Transactions, vol 92, 1983, p 3.1086 [29] Arash Nemati, Shahram Khalilarya, Samad Jafarmadar, Hassan Khatamnejhad, Vahid Fathi Numerical parametric investigation of a gasoline fuelled partially-premixed ... temperature regions for baseline and adiabatic with EGR cases are the same Also at adiabatic case for 400°CA and 420°CA, these regions more spread out in the main chamber and the values of local ... working as a faculty in the department of Mechanical Engineering at Jubail University, Jubail, Saudi Arabia He also worked as a Professor and Head of department in the Department of Mechanical Engineering,...
- 20
- 643
- 0
Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc
Ngày tải lên :
19/02/2014, 17:20
... GACANNNNNNNNNNNNNNTGRTATAATNNNNAA GTAATAAAATATTCGGAGGAATTTTGAAATGAATA AACGTGTAAAAATCG-3¢) (N ¼ A, T, G, C) and pykback (5¢-CTCTACATGCATTTCAACAATAGGGCCTG TC-3¢) for amplification of pyk The resulting PCR ... equal amounts of formate and acetyl-CoA and the resulting acetyl-CoA is then metabolized into equal amount of ethanol and acetate to maintain the redox balance Discussion In this study we quantified ... (5¢-GGAAGGA TCCTTTGTCAATTAATGATCTTAAAAC-3¢) and pyk4 (5¢-CTAGTCTAGATGAGCTCCAGAAGCTTCC-3¢) were amplified The PCR products were digested with XhoI ⁄ BamHI and BamHI ⁄ XbaI, respectively, and cloned...
- 12
- 616
- 0
Báo cáo " Using multi‐criteria analysis as a tool to select the feasible measures for sustainable development of brackish water shrimp culture in Quang Tri Province " doc
Ngày tải lên :
22/03/2014, 12:20
... environment [3]. One of the disadvantages is that the relative importance of evaluation criteria is determined without considering the scales on which the criteria are measured. Another disadvantage is the large amount of ... and accounts for 75% to 85% of the total yearly rainfall, whereas the dry season lasts up to 6 months, from February to July and occupies only 15‐25% of the total rainfall. ... negative impacts, especially in the future, when the province has the plan to develop the aquaculture to be the key sector of local economics [6]. A re a (h e c ta r s ) January and ...
- 13
- 487
- 0
báo cáo hóa học: " The AMC Linear Disability Score (ALDS): a cross-sectional study with a new generic instrument to measure disability applied to patients with peripheral arterial disease" potx
Ngày tải lên :
18/06/2014, 19:20
... stages of disease to evaluate the ALDS for the whole spectrum of PAD Patients visited the vascular laboratory or vascular nursing ward of our hospital between January 2007 and November 2007 All ... potentially useful tool to measure activities of daily life in patients with PAD Abbreviations ABI: Ankle/brachial index; ADL: Activities of daily life; ALDS: AMC Linear Disability Score; AMC: Academic ... revised the manuscript critically, RJH was involved in design, analysis and interpretation of the data and drafting of the manuscript All authors read and approved the final manuscript 10 11 12 Additional...
- 8
- 386
- 0
báo cáo hóa học: " A tool to measure the attributes of receiving IV therapy in a home versus hospital setting: the Multiple Sclerosis Relapse Management Scale (MSRMS)" pot
Ngày tải lên :
20/06/2014, 15:20
... discriminate amongst those who rate the care as excellent Rasch analysis in particular can aid the selection of these additional items Rasch analysis can also further assess the unidimensionality of the ... equally to the variance of the total score, and can be summed without weighting Item-total scale correlations for all scales were satisfactory implying that the items in each scale contain a similar ... (Table 2), and their transcripts content analysed This generated conceptual ideas about the main areas of relapse management, with around 1000 statements on people’s Riazi et al Health and Quality...
- 8
- 492
- 0
báo cáo hóa học:" The AMC Linear Disability Score (ALDS): a cross-sectional study with a new generic instrument to measure disability applied to patients with peripheral arterial diseas" potx
Ngày tải lên :
20/06/2014, 16:20
... stages of disease to evaluate the ALDS for the whole spectrum of PAD Patients visited the vascular laboratory or vascular nursing ward of our hospital between January 2007 and November 2007 All ... potentially useful tool to measure activities of daily life in patients with PAD Abbreviations ABI: Ankle/brachial index; ADL: Activities of daily life; ALDS: AMC Linear Disability Score; AMC: Academic ... revised the manuscript critically, RJH was involved in design, analysis and interpretation of the data and drafting of the manuscript All authors read and approved the final manuscript 10 11 12 Additional...
- 8
- 335
- 0
báo cáo khoa học: "A Study to investigate the role of p27 and Cyclin E immunoexpression as a prognostic factor in early breast carcinoma" pptx
Ngày tải lên :
09/08/2014, 01:24
... spread and vascular invasion with distant metastases free survival (MFS) in all invasive carcinomas and the subgroup of IDC in an univariate analysis However, there was no significant association ... breast ductal carcinoma: pathologic correlations and prognostic implications Hum Pathol 2001, 32(1):89-94 Sasano H, Frost AR, Saitoh R, Taniyama Y, Nagura H, Matsunaga G, Takehana K, Kimura M, ... node spread and vascular invasion were still significant in a stepwise multivariate analysis for all invasive carcinomas and the subgroup of IDC (Table 2) Further univariate analyses revealed no...
- 9
- 423
- 0
Báo cáo y học: " Using an Ishikawa diagram as a tool to assist memory and retrieval of relevant medical cases from the medical literature" ppt
Ngày tải lên :
11/08/2014, 00:23
... information on an Ishikawa diagram can cultivate lifelong learning habits in medical professionals Medical educators can also apply Ishikawa diagrams to facilitate problem-based learning when teaching ... ‘chemotherapy and radiotherapy’ are indicated in the branch of the ‘fishbone’ that shows the cause of ovarian failure, a potential cause for secondary amenorrhea/oligomenorrhea (Figure 1) The cited ... brainstorming sessions and search in the literature to find the potential causes, then categorize these causes in an Ishikawa diagram The Ishikawa diagram can then be kept by individual learners...
- 3
- 381
- 0
Báo cáo y học: "Is research working for you? validating a tool to examine the capacity of health organizations to use research" doc
Ngày tải lên :
11/08/2014, 05:21
... discussion that took place as a result of the item on the tool, rather than the actual score assigned The tool was less useful in the government sector, suggesting that additional tailoring of the instrument ... noted that the tool seemed to be geared to a more formal type of organization Furthermore, the tool was focused on management and policy research, not the clinical practice research and the health ... questions), there were some highly skilled people in an organization who were available to access research Furthermore, there was an awareness of the research being available via internal databases and...
- 9
- 506
- 0
báo cáo khoa học: " Is research working for you? validating a tool to examine the capacity of health organizations to use research" pdf
Ngày tải lên :
11/08/2014, 16:20
... discussion that took place as a result of the item on the tool, rather than the actual score assigned The tool was less useful in the government sector, suggesting that additional tailoring of the instrument ... noted that the tool seemed to be geared to a more formal type of organization Furthermore, the tool was focused on management and policy research, not the clinical practice research and the health ... questions), there were some highly skilled people in an organization who were available to access research Furthermore, there was an awareness of the research being available via internal databases and...
- 9
- 412
- 0
Báo cáo y học: "Head repositioning errors in normal student volunteers: a possible tool to assess the neck''''s neuromuscular system" doc
Ngày tải lên :
13/08/2014, 14:20
... position The CA-6000 linkage measures head position relative to the base affixed at the first thoracic vertebra Matching Lucite blocks, one attached to the headband of the CA-6000, and the other attached ... Mathsoft Inc, Cambridge, MA) Variables of primary interest were the average head orientation at the target position for seconds before deconditioning and the average head orientation at the target ... CA) was used to measure head position and motion with respect to the upper thoracic spine in the cardinal planes: sagittal (AP-flexion), frontal (lateral flexion), and horizontal (rotation) The...
- 7
- 211
- 0
A study to investigate the involvement of nadph oxidase 5 (NOX5) in resveratrol (RSV) induced reactive oxygen species (ROS) production in u937 cells
Ngày tải lên :
26/09/2015, 10:44
... II (Ang II) results in the activation of AT1 receptor (AT1R) and its translocation to the caveolin-1 containing lipid raft domains (Cai et al., 2003; Park et al., 2006) The activation of AT1 ... necrosis and autophagic cell death Apoptosis is referred to as a form of programmed cell death The ‘hallmarks’ or morphological characteristics associated with apoptosis are plasma membrane blebbing, ... 2007) Another major role of NOX enzymes would be in regulating the levels of pro-inflammatory and anti-inflammatory cytokines (Kawahara et al., 2007) ROS generated via NOX serve as secondary signaling...
- 110
- 528
- 0
Indoor tests to investigate the effect of brine depth on the performance of solar still
Ngày tải lên :
05/09/2013, 16:10
... series to supply a total current of 4.5 A, a voltage of 220 V and a total power flux of approximately 1000 W/m² to simulate the solar radiation intensity A variac was used to regulate the input ... tests) These values are the initial value of the production line in the figures This may be due to the large thermal capacity of water, which is directly related to water mass, causing a continuous ... solar radiation by suitable variable heating system The indoor tests allow a greater control on the input power and eliminate many factors that may affect the accuracy of the experimental results...
- 8
- 534
- 0
A study on techniques to improve the 1st year english majors' speaking skill at HPU
Ngày tải lên :
14/12/2013, 16:45
... (http://www.researchgate.net) Approaches to the teaching of speaking 4.1 The Grammar- translation Method In the Grammar- translation method, students are taught to analyze grammar and to translate from ... performers a chance to participate and monitoring their performance to see that it is satisfactory 5.3 The role of the teacher at the production stage At the final stage, the production one, the teacher ... people have a hard time understanding each other, and thus many people strive to change their accent There is a fact that people hardly can get rid of their accent They just can actually change their...
- 70
- 1.5K
- 12
Tài liệu Báo cáo khoa học: Identification, sequencing, and localization of a new carbonic anhydrase transcript from the hydrothermal vent tubeworm Riftia pachyptila docx
Ngày tải lên :
18/02/2014, 16:20
... pseudoobscura, the mosquitoes A aegypti and A gambiae, the clam T gigas and larval sequences from the cnidarian F scutaria Finally, we chose an outgroup comprising a- CAs from a cyanobacteria (Nostoc ... in the Archaea and Bacteria domains [11] Among the broad range of physiological processes in which they participate, CA can play a significant role in autotrophic organisms, serving as an inorganic ... ATT AGC CTT GCT AGC AGT ACG AGG 613–630 822–839 706–723 466–483 AAG AGC AAA GAT GAT AGT GAT TAC GCC ATC CCA CAG ATT AGC ATC AAT AGC AGT CAG C TGC 613–630 822–839 616–634 844–861 a Primers designed...
- 14
- 591
- 0
Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf
Ngày tải lên :
18/02/2014, 17:20
... GAGATGGATAAAGTTTTAAACAGAG-3¢ and LTA1R, 5¢-TGAAGGCAAATCTCTGGAC-3¢ for the former, and LTA–M2F, 5¢-CAGCTGTTTTGCTTGAATTATG-3¢ and LTA–2R, 5¢-GAATTCATTATGTTTCAGGTTCA GGGG-3¢ for the latter The PCR products ... the wild-type SV40T Ag and the 3¢ portion of the tsA58T Ag cDNA carrying the A4 38V mutation were PCR-amplified from COS-7 cDNAs using the following primers: LTA-1F, 5¢-CTC GAGATGGATAAAGTTTTAAACAGAG-3¢ ... Dong QG, Bernasconi S, Lostaglio S, De Calmanovici RW, Martin-Padura I, Breviario F, Garlanda C, Ramponi S, Mantovani A & Vecchi A (1997) A general strategy for isolation of endothelial cells from...
- 11
- 873
- 0
Báo cáo khoa học: A new phospholipase A2 isolated from the sea anemone Urticina crassicornis – its primary structure and phylogenetic classification pptx
Ngày tải lên :
06/03/2014, 11:20
... was subjected to factor Xa cleavage according to the manufacturer’s instructions (Qiagen) The final step in obtaining the pure recombinant UcPLA2 was the separation of the cleavage mixture on a ... (http://www.expasy.org/tools/ dna.html) was used to translate DNA sequences All of the nonredundant metazoan representatives of the group I PLA2 family were included in the analysis The PLA2 domain in the newly ... assays was 4.2 lM, that of UcPLA2 was ng, and that of AtxC was ng Fluorescence was measured with a SAFIRE microplate monochromator reader All measurements were taken at the room temperature The...
- 13
- 462
- 0