... give an illustration ofthe
behavior ofthe morphological and syntactic
parsers on a more complicated example:
Ngarrka-ngku.ka marlu marna-kurra luwa.rnu
ngarni.nja-kurra (man-ergative-aux kangaroo ... 07974.
Barbara Brunson*
AT&T Bell Laboratories
and
Department of Linguistics
University of Toronto
Toronto, Ontario, Canada M5S 1A1 .
Abstract
We present a model of morphological
processing ... namely prosody and the non-
isomorphism of syntactic and phonological
structure. We maintain that these are are
central tothe task ofa morphological analyzer
and, hence, have incorporated...
... judgment, all words in the upper
branch ofthe hierarchical tree are related tothe
hand sense of palm, and all other words are related
to its tree sense. However, it is somewhat unsatis-
factory ... vectors. To see this, let us
bring our attention tothe various species of ani-
mals that are among the top 30 associations to
poach. Some of them seem more often affected by
cooking (pheasant, ... consid-
ered as one of its senses. Aproblem that we see
with this approach is that it allows only as many
senses as clusters, thereby limiting the granularity
of the meaning space. This problem is avoided...
... CCCCATGTCGCCTTTAGT
OMCB-KO-R TCGCTAGAACACATTGAC
OMCA-F ATGATGAAACGGTTCAAT
OMCA-R TTAGTTACCGTGTGCTTC
OMCB-F CTGCTGCTCGCAGCAAGT
OMCB-R GTGTGATCTGCAACTGTT
OMCA-PBAD-F CACCGAGGAATAATAAATGATG
AAACGGTTCAATTTC
OMCA-PBAD-R ... CACCGAGGAATAATAAATGATG
AAACGGTTCAATTTC
OMCA-PBAD-R TTAGTTACCGTGTGCTTC
OMCB-PBAD-F CACCGAGGAATAATAAATGATG
AACGCACAAAAATCA
OMCB-PBAD-R TTACATTTTCACTTTAGT
Shewanella oneidensis MR-1 OmcA and OmcB kinetics J. Borloo et al.
3736 ... MR-1R was used as a positive control to display omcA
(lane 1) and omcB (lane 6). DNA standards are indicated at the left
and right ofthe agarose gels. (B) Visualization and separation of
high...
...
vector comparisons. Fortunately, theproblemof
data sparseness can be minimized by reducing the
dimensionality ofthe matrix. An appropriate alge-
braic method that has the capability to reduce ... salient.
Also, widely and rural are well within the adjective
cluster. The comparison ofthe two dendrograms
indicates that the SVD was capable of making ap-
propriate generalizations. Also, when ... number of rows toa vocabulary appropriate for
evaluation purposes. Since we are not aware of any
standard vocabulary previously used in related
work, we manually selected an ad hoc list of 50...
... Italian), pastarant (pasta + restaurant)
and peatza (pizza + eat). These three suggestions are
amusing and have a nice ring to them. As a matter
of fact, it turns out that the name Eatalian is actually
used ... eating), pizza and pasta
(which are found AtLocation restaurant) to generate
an appropriate name. The three “palatable” neolo-
gisms generated are eatalian (from the combination
of eat and Italian), ... Computational Linguistics
A Computational Approachtothe Automation of Creative Naming
G
¨
ozde
¨
Ozbal
FBK-Irst / Trento, Italy
gozbalde@gmail.com
Carlo Strapparava
FBK-Irst / Trento, Italy
strappa@fbk.eu
Abstract
In...
... not only the Messiah and the
Son of God but also the Son of Man who will be seated at the right
hand of God and will come ‘with the clouds of heaven’ at the climax of
history to gather in the elect ... the ritual ofthe Day of Expiation.
1 John may also have in mind the ceremony on the Day of
Expiation, when it speaks of Christ as the hilasmos (means of expi-
6
See D. P. Wright, ‘Day of Atonement’, ... blessed and broke
it, and gave it to them, and said: “Take, this is my body.” And he took
a cup, and when he had given thanks he gave it to them, and they all
drank of it. And he said to them,...
... 135
Human Capital and Transformational Change 137
Human- Capital Management in Government 138
Challenges Facing Human Resources Managers 139
Challenges in Sustained Leadership 142
A Human- Capital ... McNabb entered a second career in academia. He
advanced tothe rank of professor on the faculty at Pacific Lutheran University.
He has a BA from California State College at Fullerton, an MA from ... Only then can they integrate thenew way of operating into the
organization’s culture.
External causes of an organizational crisis can spring from any ofthe uncontrol-
lable factors that result...
... matter of fact, C .A has had
much to offer not only to practical language but also to translation theory, the
description of particular language, language typology and the study of language
universals. ... Nga – K 1 1A
30
Graduation paper
Declaration
Title: Anewapproachto semantic and syntactic
functions of English adjectives A contrastive–
analysis with their Vietnamese equivalents
(Graduation ... 2.2.2 Gradable and non- gradable adjectives
According to L. G. Alexander (1988, 108) adjectives can be also
divided into gradable and non- gradable.
Gradable adjectives mean a large class of words...
... residues, vari-
able oxidation of methionine and variable deamidation of
asparagine and glutamine. Parent and fragment mass toler-
ances were set to 1 Da. Up to two missed cleavages and
half tryptic ... may
speculate that hmeprin has activity similar to BMP-1 ⁄
TLD-like metalloendopeptidases in that it acts as a
procollagen C protease as well as an activator of lysyl
oxidase. Therefore, an important ... S, Navarro JD, Amanchy R, Kristiansen TZ,
Jonnalagadda CK, Surendranath V, Niranjan V,
Muthusamy B, Gandhi TK, Gronborg M et al. (2003)
Development ofhuman protein reference database as
an initial...
... Evaluation,
pages 719-
724.
Sadao Kurohashi, Masaki Murata, Yasunori
Yata, Mitsunobu Shimada, and Makoto
Nagao. 1998. Construction of Japanese
nominal semantic dictionary using " ;A ... a Japanese morphological analyzer,
and KNP, a Japanese syntactic and case ana-
lyzer (Kurohashi and Nagao, 1994; Kurohashi
and Nagao, 1998). Then, a genus word for a
head word, like
a person ... Stanford, Califor-
nia.
Eiichiro Sumita, Hitoshi Iida, and Hideo Ko-
hyama. 1990. Translating with examples: A
new approachto machine translation. In Pro-
ceedings ofthe 3rd TMI,
pages...