... primers: Aba, 5¢-ATGGACGCTGAAT
TCCGTCACGACTCTGGTTACGAAGTTCACCACCAG
AAGCTGGTG -3 ;Abb, 5¢-GTTCACCACCAGAAGCT
GGTGTTCTTC GCTGAA GACGT GGGTTCT AACAAG
GGTGCT -3 ;Abc, 5¢-CACAACGCCACCAACCATCAGA
CCGATGATAGCACCCTTGTTAGAACCCAC -3 ;Ab-
start, ... 5¢-CACAACGCCACCAACCATCAGA
CCGATGATAGCACCCTTGTTAGAACCCAC -3 ;Ab-
start, 5¢-GCGTAGGGTCGACATATGGACGCTGAATT
CCGTCACG -3 ;Abstop, 5¢-CCTGCCGAGCTCCTATTA
CACAACGCCACCAACCATCAG -3 .
The PCR solution was prepared in the buffer supplied
with ... kit (GE Healthcare) and sequenced.
The gene for Ab(L1–42) was then produced by PCR
using the primers Abstart and Ab42stop (5¢-CCTG
CCGAGCTCCTATTAAGCGATCACAACGCCACCAA
CCATCAG -3 ) and a sequence-verified...
... tsA58T Ag cDNA carry-
ing the A4 38 V mutation were PCR-amplified from COS-7
cDNAs using the following primers: LTA-1F, 5¢-CTC
GAGATGGATAAAGTTTTAAACAGAG -3 and LTA-
1R, 5¢-TGAAGGCAAATCTCTGGAC -3 for ... organ-specific blood vascular and lymphatic
endothelial cells of the mouse
Takashi Yamaguchi, Taeko Ichise, Osamu Iwata, Akiko Hori, Tomomi Adachi, Masaru Nakamura,
Nobuaki Yoshida and Hirotake ... medulla and interstitial cells of the cardiac valve. Arrowheads indicate CD31-positive ECs (green). All micrographs are shown
at the same magnification. Scale bar = 50 lm.
A new methodfor mouse...
... c a Edward.
Kate: Good afternoon, Hale and Hearty Foods. Kate speaking.
Edward: Ah yes, could I speak to Harvey Judd please?
Kate: May I ask who‟s calling?
Edward: It‟s Edward Bono.
Kate: ...
Kate: Harvey‟s on another call at the moment. Do you mind holding?
Edward: Sure.
Kate: I‟m afraid that line is still busy. Are you still happy to hold?
Edward:
Actually, could you ask Harvey ... catch that…
Xin lỗi, tôi nghe ch a được rõ lắm…
Edward:
It's Edward from Dazzling Displays.
Edward ở Công ty Triển lãm Dazzling.
Vì ch a nghe rõ lời tự giới thiệu c a Edward nên Kate...
... ATM 33 1
WAN Link Considerations with Windows 2000 33 2
Routing and Scalability 33 3
Planning for the Future Growth of the Company’s
Infrastructure Network Scalability 33 4
Layer 2 Switching 33 5
Layer ... 31 9
Topology 32 1
Application Services 32 3
Server Farm Placement 32 4
Positioning Servers 32 4
Terminal Services Farms 32 5
LAN and Switching Considerations 32 6
Scaling Bandwidth 32 6
Scaling Considerations 32 6
IP ... my grandfather, Arthur Conat, drove a
carriage with horses when he was a teenager. He didn’t have a TV,
or a telephone, or a car, or a refrigerator, or a washing machine, or
running water aside...
... properties and its management’s expertise. Such a company
may be well positioned to take advantage of any recovery in the real estate
market. Of course, a REIT that pays a sizeable dividend and has a ...
laissez-faire attitudes about keeping rates affordable for customers
tend to allow utilities to charge higher rates — bad for consumers, but
good for shareholders. Florida, Texas, and California ... potential for capital appreciation, purchasing them
at bargain prices, and then managing the properties for maximum profit-
ability. The managers who performed well during the real estate melt-
down...
...
participants found TransAhead suggestions
satisfying, accepted, and learned from them; c)
interactivity made translation and language
learning more fun and the participants found
TransAhead ... Ortiz-Martinez, L. A. Leiva, V. Alabau, I. Garcia-Varea,
and F. Casacuberta. 2011. An interactive machine
translation system with online learning. In Proceedings
of ACL System Demonstrations, pages ... on
language learning. Specifically, our goal is to
build a human-computer collaborative writing
assistant: helping the language learner with in-
text grammar and translation and at the same...
... economic data are
needed to provide more accurate estimates
of climate change impacts, the potential
costs and benets of adaptation, and to
validate and calibrate models.
• Quantify costs and ... of
adaptation at the farm level and for
specialty crops and livestock as well as
grain crop production systems.
• Assess economic impacts and costs of
adaptation beyond the farm gate for ... given that regional
variations in soils and climate are large
and that there are a number of potential
bioenergy crops, along with algae, that can
be considered.
This complexity mandates an integrated...
... Annual Meeting
of the Association for Computational Linguistics,
pages 188-195.
Ferreira da Silva, J. and G. Pereira Lopes (1999). A
local maxima method and a fair dispersion
normalization for ... 605–6 13,
Ann Arbor, June 2005.
c
2005 Association for Computational Linguistics
A Nonparametric Methodfor Extraction of Candidate Phrasal Terms
Paul Deane
Center for Assessment, Design and ... C-
Value and NC-Value Method. International
Journal on Digital Libraries 3( 2):115- 130 .
Gil, A. and G. Dias. (200 3a) . Efficient Mining of
Textual Associations. International Conference on
Natural...
... Bombay Calcutta Madras Karachi
Petaling Jaya Singapore Hong Kong Tokyo
Nairobi Dar es Salaam Cape Town
Melbourne Auckland
and associated companies in
Berlin Ibadan
Oxford English
and the
Oxford ... Books for Children
are packed with
engaging and creative tasks to help your pupils
learn English. All the activities are attractively
ill
ustrated and have been carefully designed to
practise ... isn't happy.
LI
She isn't happy
.
]
U
5
/
L
H2 isn't happy. I
r She is happy.
Draw a pink cat.
It is happy.
Draw a purple fish.
It isn't happy.
a
12
I am the
oldesi
I am...