... primers: Aba, 5¢-ATGGACGCTGAAT
TCCGTCACGACTCTGGTTACGAAGTTCACCACCAG
AAGCTGGTG-3¢;Abb, 5¢-GTTCACCACCAGAAGCT
GGTGTTCTTC GCTGAA GACGT GGGTTCT AACAAG
GGTGCT-3¢;Abc, 5¢-CACAACGCCACCAACCATCAGA
CCGATGATAGCACCCTTGTTAGAACCCAC-3¢;Ab-
start, ... 5¢-CACAACGCCACCAACCATCAGA
CCGATGATAGCACCCTTGTTAGAACCCAC-3¢;Ab-
start, 5¢-GCGTAGGGTCGACATATGGACGCTGAATT
CCGTCACG-3¢;Abstop, 5¢-CCTGCCGAGCTCCTATTA
CACAACGCCACCAACCATCAG-3¢.
The PCR solution was prepared in the buffer supplied
with ... (F19P, A2 1G, E22G, E22K, E22Q and
D23N), and the availability of a rapid and simple
expression and purification protocol will facilitate
large-scale investigations of the molecular determinants
of aggregation...
... tsA58T Ag cDNA carry-
ing the A4 38V mutation were PCR-amplified from COS-7
cDNAs using the following primers: LTA-1F, 5¢-CTC
GAGATGGATAAAGTTTTAAACAGAG-3¢ and LTA-
1R, 5¢-TGAAGGCAAATCTCTGGAC-3¢ for ... isolation and long-term
culture of organ-specific blood vascular and lymphatic
endothelial cells of the mouse
Takashi Yamaguchi, Taeko Ichise, Osamu Iwata, Akiko Hori, Tomomi Adachi, Masaru Nakamura,
Nobuaki ... Oreda B
et al. (20 03) The conditional inactivation of the
beta-catenin gene in endothelial cells causes a defective
vascular pattern and increased vascular fragility. J Cell
Biol 1 62, 1111–1 122 .
8...
... Vietnamese nation was formed early in the history and often
had to carry out wars of resistance against foreign invaders, which
created a prominent cultural feature: a patriotism that infiltrated ... which people can share as they enjoy the special
occasion.
• During festivals or Tet Holidays, betel and areca nut is used for
inviting visitors and making acquaintances.
• Nowadays, the custom ... school.
- A major part of adapting to the customs of a new country is learning
that country’s language.
- Children learn the language in school, and use it daily while going to
class and playing...
...
d) to make
6) Most of the goods ____________in this factory are exported
a) is made
b) making
c) are made
d) made
7) February has ___________ days than March
a) more ... TEST FOR GRADE 12
(2)
Choose the best answer A, B, C or D for each of the following
sentences.
1) Lan: “Are you American?” – John: “__________”
a) Sorry!
b) Yes?
c) Excuse me?
d) Pardon? ... Pardon?
2) A: “Would you like some more tea?” – B: “__________.”
a) Yes, please
b) Here you are
c) It doesn’t matter
d) I’m OK
3 )A: Could I have an early morning call at...
...
hoa và câu ứng dụng.
Mục tiêu : Hs viết đúng chữ hoa
A, M, N, Q, V kiểu 2.
*GV đính chữ mẫu kiểu 2.
-GV viết mẫu A, M, N, Q, V và
nêu cách viết.
-GV giới thiệu câu ứng dụng
“Việt nam, ... dõi.Viết bảng con 2
lượt.
-2 hs đọc.
-Hs nêu.
-Quan sát nhận xét.
-Theo dõi viết bảng con 2
lượt.
*Hoạt động 2 : Hướng dẫn viết
vào vở, chấm ch a bài.
Mục tiêu : Viết đúng chữ hoa và
câu ...
“Việt nam, Nguyễn Ai Quốc, Hồ
Chí Minh”
-Y/C hs nêu ý ngh a câu ứng
dụng.
-Y/C hs quan sát nhận xét về độ
cao,
-GV viết mẫu và hướng dẫn cách
viết.
-Hs quan sát, nhận xét cấu...
... stocks.
Large-cap is short for large market capitalization. Small-cap is the abbrevia-
tion for small market capitalization. Market capitalization is a fancy phrase
for a company’s market value, ... $2 a share wasn’t a bargain.
Investors were buying Berkshire Hathaway because they thought it was
cheap. They determined its intrinsic value (actual value) was $ 125 ,000. It had
a great management ... 3 /24 /10 8 :28 PM3 /24 /10 8 :28 PM
92
Part II: Selecting an Investment Approach and Picking Stocks
✓ Taxes can chip away at any gains. Don’t forget that anything not in a
tax-deferred account is...
... European Chapter of the Association for Computational Linguistics, pages 16–19,
Avignon, France, April 23 - 27 20 12.
c
20 12 Association for Computational Linguistics
TransAhead: A Writing Assistant ... train TransAhead, we used British National
Corpus and Hong Kong Parallel Text and
deployed GENIA tagger for POS analyses.
To evaluate TransAhead in CAT and CALL,
we introduced it to a class ... Ortiz-Martinez, L. A. Leiva, V. Alabau, I. Garcia-Varea,
and F. Casacuberta. 20 11. An interactive machine
translation system with online learning. In Proceedings
of ACL System Demonstrations, pages...
... be:
28 p A Science Roadmap for Food and Agriculture
2 p A Science Roadmap for Food and Agriculture
16 p A Science Roadmap for Food and Agriculture
Grand Challenge 1
hollowing-out will continue, and ... economic data are
needed to provide more accurate estimates
of climate change impacts, the potential
costs and benets of adaptation, and to
validate and calibrate models.
• Quantify costs and ... of
adaptation at the farm level and for
specialty crops and livestock as well as
grain crop production systems.
• Assess economic impacts and costs of
adaptation beyond the farm gate for...