a comparison of the effects of yct with mgf
Induction of anti tumor response by dendritic cell based vaccination
Ngày tải lên :
16/09/2015, 15:54
... localization of transferases and the competition of transferase for acceptor Chains are generally extended by the addition of polylactosamine side chains and terminated by the addition of sialic acid, ... haematopoiesis 1.4 Tumor associated antigens (TAA) 1.4.1 Overview The identification of tumor associated antigens (TAA) has provided an alternative for tumor therapy intervention TAA can be classified ... partial cDNA from human mammalian epithelium which first demonstrated the concept of tandem repeat At that time, it was surprising that the same core protein was cloned from breast and pancreatic...
- 200
- 304
- 0
Báo cáo y học: "Mechanisms of HIV non-progression; robust and sustained CD4+ T-cell proliferative responses to p24 antigen correlate with control of viraemia and lack of disease progression after long-term transfusion-acquired HIV-1 infection" pdf
Ngày tải lên :
13/08/2014, 05:21
... predictor for an increased rate of HIV disease progression [5,6] The bias toward an aged population requiring transfusion is part of the composite disadvantage of transfusion as a route of HIV infection ... 1) Initiation of antiretroviral therapy is defined by an arrow in the viral load panels Other reasons for loss of non-progressor status are summarised in Additional file Page of 14 (page number ... to associate genetic and immune factors with viraemia and non-progressor status Results Status of the non-progressor cohort From all reported TAHIV cases from the state of NSW, Australia, a cohort...
- 14
- 253
- 0
More Show Me How: Everything We Couldn't Fit in the First Book Instructions for Life from the Everyday to the Exotic Perfect Paperback
Ngày tải lên :
15/01/2014, 12:15
... navigate adolescence help a teen navigate adolescence Being a teenager can be like playing a fast-paced game ne with common —o trials and traps, as well as tricks that can make the game easier ... snap wrist toward plate pitch a curveball Grip with seam upright 398 Hold with seam vertical Conceal behind back serve a volleyball Stand at the end line; aim serve Lower ball and draw ar back ... eyeshadow, then darken the crease Make a crease of dark shadow over a lighter color Leave brows thick and dramatic Apply tinted moisturizer for a dewy glow Apply false eyelashes to top and bottom...
- 25
- 674
- 0
Tài liệu Báo cáo khoa học: Identification of different isoforms of eEF1A in the nuclear fraction of human T-lymphoblastic cancer cell line specifically binding to aptameric cytotoxic GT oligomers ppt
Ngày tải lên :
21/02/2014, 00:20
... cross-linking assay, the samples were incubated at room temperature, as described above for the EMSA assay, and then irradiated at 302 nm for 10 using a transilluminator (Bio-Rad Laboratories) The samples ... performed a comparative bidimensional PAGE analysis of nuclear extracts coupled to Western blotting analysis with an eEF 1A mAb As an internal normalizer of loading amounts and focusing position, the ... El’skaya, A. V (1997) Evidence for the formation of an unusual ternary complex of rabbit liver EF-1alpha with GDP and deacylated tRNA FEBS Lett 407, 13–17 31 Tatsuka, M., Mitsui, H., Wada, A. , Nagata,...
- 12
- 552
- 0
Báo cáo khoa học: Protein kinase Ch activity is involved in the 2,3,7,8tetrachlorodibenzo-p-dioxin-induced signal transduction pathway leading to apoptosis in L-MAT, a human lymphoblastic T-cell line potx
Ngày tải lên :
23/03/2014, 13:20
... translocated in TCDD-treated L-MAT cells We performed an nPKC translocation assay by fractionating L-MAT cells into cytosol and particulate fractions and then examining the translocation of each of the ... myr-PKCh-PPI (as indicated) for 30 at 37 °C in 95% air and 5% CO2, followed by treatment with TCDD for h Then, a caspase-3 activation assay was performed for the evaluation of apoptosis Data are presented ... genomic DNA contaminant Then, 10 lg of total RNA was reverse-transcribed to synthesize cDNA by means of AMV (avian myeloblastosis virus)-reverse transcriptase from Pharmacia using random hexamer,...
- 13
- 426
- 0
báo cáo hóa học:" Protective CD8+ T-cell responses to cytomegalovirus driven by rAAV/GFP/IE1 loading of dendritic cells" pdf
Ngày tải lên :
18/06/2014, 15:20
... KB participated in the design of the study and revised and drafted the manuscript MC participated in study design and coordination and revised and drafted the manuscript AM participated in the ... JE, Radio SJ, Kandolf R: Cytomegalovirus and other herpesviruses: they have a role in the development of accelerated coronary arterial disease in human heart allografts? J Heart Lung Transplant ... studies showed that rAAVloading DCs can rapidly generate antigen-specific CTLs against viral antigens [16] The IE1 protein has been proposed as a target for immunotherapy The IE genes are the first...
- 8
- 451
- 0
báo cáo hóa học:" Comparative study on the immunogenicity between an HLA-A24-restricted cytotoxic T-cell epitope derived from survivin and that from its splice variant survivin-2B in oral cancer patients" pot
Ngày tải lên :
18/06/2014, 15:20
... Kurotaki T, Yamamoto M, Yagihashi A, Ohmura T, Yamaguchi K, Katsuramaki T, Yasoshima T, Sasaki K, Mizushima Y, Minamida H, Kimura H, Akiyama M, Hirohashi Y, Asanuma H, Tamura Y, Shimozawa K, Sato ... Tsukahara T, Nabeta Y, Sahara H, Ikeda H, Torigoe T, Ichimiya S, Kamiguchi K, Wada T, Nagoya S, Hiraga H, Kawai A, Ishii T, Araki N, Myoui A, Matsumoto S, Ozaki T, Yoshikawa H, Yamashita T, Sato ... Sato Y, Nabeta Y, Tsukahara T, Hirohashi Y, Syunsui R, Maeda A, Sahara H, Ikeda H, Torigoe T, Ichimiya S, Wada T, Yamashita T, Hiraga H, Kawai A, Ishii T, Araki N, Myoui A, Matsumoto S, Umeda...
- 11
- 410
- 0
báo cáo hóa học:" Regulatory activity of azabisphosphonate-capped dendrimers on human CD4+ T cell proliferation enhances ex-vivo expansion of NK cells from PBMCs for immunotherapy" potx
Ngày tải lên :
18/06/2014, 15:20
... proliferation a) Detailed structure of the julolidine analogue of 3a- G1 Dashed frame highlights the julolidine moiety that has replaced one of the azabisphosphonate claws of the parental 3a- G1 dendrimer ... interaction of azabisphosphonate branched dendrimers using a fluorescent analogue of 3a- G1 To further analyze the cellular interaction of phosphonate-capped dendrimers, we used an analogue of the 3aG1 in ... Statistical analysis Statistical analyses were carried out using the biostatistic software GraphPad Prism (GraphPad Software, Inc) Wilcoxon signed-rank test was performed to compare amplification...
- 13
- 404
- 0
Báo cáo hóa học: " A quantitative real time PCR method to analyze T cell receptor Vb subgroup expansion by staphylococcal superantigens" doc
Ngày tải lên :
18/06/2014, 16:20
... gcgcggatccttaacttgtatataaata cgcgctcgagctacttttcatataaata SEE M21319 ggtagccatatgagcgaagaaataaatgaa gcgcggatcctcaagttgtgtataaata SEG AF064773 tgtgcatatgcaacccgatcctaaatta gcgcggatcctcagtgagtattaaga SEI AF285760 ... tgctctcgaggatattggtgtaggtaac cgcgctcgagttagttactatctacata SElM AF285760 cgcacatatggatgtcggagttttgaat gcgcggatcctcaactttcgtccttata SElN AF285760 aatgctcatatggacaaaaaagatttaaag gcgcggatccttaatctttatataaaa ... gcgcggatccttaatctttatataaaa SElO AF285760 tgcactcgagaatgaagaagatcctaaa cgcgctcgagttatgtaaataaataaac Seo et al Journal of Translational Medicine 2010, 8:2 http://www.translational-medicine.com/content/8/1/2 Basal...
- 9
- 568
- 0
Báo cáo hóa học: "Comparison of anti-CD3 and anti-CD28-coated beads with soluble anti-CD3 for expanding human T cells: Differing impact on CD8 T cell phenotype and responsiveness to restimulation" pot
Ngày tải lên :
18/06/2014, 16:20
... performed with beads coated with anti-CD3 and anti-CD28 at a ratio of 1:20 but similar results were obtained using beads coated at ratios of 1:5, and 1:80 and with commercially available T cell expander ... their design, and reviewed the manuscript RK participated in the design of the studies, performed the statistical analysis and wrote the manuscript Both authors read and approved the final manuscript ... Preparation of anti-CD3/CD28 beads To prepare antibody-coated beads of varying composition, streptavidin-labeled beads were coated with varying mixtures of biotinylated anti-CD3 and anti-CD28 antibodies...
- 15
- 503
- 0
Báo cáo hóa học: "IL-2 as a therapeutic target for the restoration of Foxp3+ regulatory T cell function in organ-specific autoimmunity: implications in pathophysiology and translation to human disease" doc
Ngày tải lên :
18/06/2014, 16:20
... type diabetes subjects Immunogenetics 2010, 62:101-107 36 Kawasaki E, Awata T, Ikegami H, Kobayashi T, Maruyama T, Nakanishi K, Shimada A, Uga M, Kurihara S, Kawabata Y, et al: Genetic association ... to assess the effects and benefits of this double therapy Combination therapy with cellular infusion The idea of cellular therapy has also been examined The major challenge in this case is the ... translating these therapies to humans remains to be assessed One potential limitation of the process is the identification of those antigens that are the most relevant as targets, as the human auto-antigen-specific...
- 12
- 573
- 0
Báo cáo sinh học: " Thottapalayam virus is genetically distant to the rodent-borne hantaviruses, consistent with its isolation from the Asian house shrew (Suncus murinus)" potx
Ngày tải lên :
18/06/2014, 18:20
... Taruishi M, Sungdee A, Pattamadilok S, Ibrahim IN, Erlina S, Agui T, Yanagihara R, Arikawa J: Development of serological assays for Thottapalayam virus, an insectivore-borne Hantavirus Clin Vaccine ... Mitra S, Sathish N, Vijayakumar TS, Abraham OC, Jesudason MV, Abraham P, Yoshimatsu K, Arikawa J, Sridharan G: A pilot study for serological evidence of hantavirus infection in human population ... evolutionary history of the hantaviruses, and the development of specific diagnostic assays should provide the means to assess the potential public health importance of these shrew-associated hantaviruses...
- 5
- 406
- 0
Báo cáo sinh học: "The combined transduction of copper, zincsuperoxide dismutase and catalase mediated by cell-penetrating peptide, PEP-1, to protect myocardium from ischemia-reperfusion injury" ppt
Ngày tải lên :
18/06/2014, 19:20
... Bcl-2 and increase of Bax expression with the corresponding myocardial apoptosis and myocardial infarction [31] These data suggest that the levels of regional myocardial expression of Bcl-2 and Bax ... measured the effects of PEP-1-SOD1 and PEP1-CAT on myocardial infarct size with 1% TTC staining of the rat hearts with myocardial ischemia-reperfusion Huang et al Journal of Translational Medicine 2011, ... prevent heart from myocardial ischemia-reperfusion-induced injury In addition, myocardial infarction area is correlated with the exercise tolerance capability The smaller the infarction area, the better...
- 11
- 349
- 0
Báo cáo hóa học: " Thottapalayam virus is genetically distant to the rodent-borne hantaviruses, consistent with its isolation from the Asian house shrew (Suncus murinus)" pdf
Ngày tải lên :
20/06/2014, 01:20
... Taruishi M, Sungdee A, Pattamadilok S, Ibrahim IN, Erlina S, Agui T, Yanagihara R, Arikawa J: Development of serological assays for Thottapalayam virus, an insectivore-borne Hantavirus Clin Vaccine ... Mitra S, Sathish N, Vijayakumar TS, Abraham OC, Jesudason MV, Abraham P, Yoshimatsu K, Arikawa J, Sridharan G: A pilot study for serological evidence of hantavirus infection in human population ... evolutionary history of the hantaviruses, and the development of specific diagnostic assays should provide the means to assess the potential public health importance of these shrew-associated hantaviruses...
- 5
- 316
- 0
Báo cáo hóa học: " Impairment of the CD8+ T cell response in lungs following infection with human respiratory syncytial virus is specific to the anatomical site rather than the virus, antigen, or route of infection" pdf
Ngày tải lên :
20/06/2014, 01:20
... version of the manuscript Acknowledgements We thank Lijuan Yang for excellent technical assistance This study was supported by the Intramural Research Program of the National Institute of Allergy and ... pulmonary CTL function As the mucosal surfaces of the respiratory tract are a common site of entry and replication for various pathogens, the design of more effective vaccines and therapeutics ... that tetramer+CD8+ CTL from the lungs of Examples ofof individual mice Figure the spleens primary data of flow cytometry analysis of tetramer/pentamer+CD8+ and IFNγ+CD8+ cells from the lungs and...
- 8
- 381
- 0
Báo cáo hóa học: " Characterization of the IFN-γ T-cell responses to immediate early antigens in humans with genital herpes" doc
Ngày tải lên :
20/06/2014, 01:20
... HSV[9,20,21] The immediate early antigens are also of interest as potential vaccine antigens because they appear at the start of a replicative cycle and responses to them could act early in infection ... reproducible, and was capable of measuring responses to a large panel of antigens in an individual regardless of genetic background One advantage of the IFN-γ ELISPOT assay is that it does not require a ... needed for the assay which is of great value for cellular assays where the amount of sample is usually limiting The IFN-γ ELISPOT assay was, therefore, split into two separate assays The CD4 IFN-γ...
- 15
- 329
- 0
báo cáo hóa học:" Metabolic and anthropometric parameters contribute to ART-mediated CD4+ T cell recovery in HIV-1-infected individuals: an observational study" potx
Ngày tải lên :
20/06/2014, 08:20
... counts) is associated with chronic inflammation and increased immune activation, with alteration of metabolic parameters associated with lipid metabolism and increased atherogenic risk (as assessed ... Witwatersrand, Johannesburg, South Africa 4Department of Chemical Pathology, National Health Laboratory Service and University of the Witwatersrand, Johannesburg, South Africa 5Department of Hematology ... data management, data analysis, and manuscript and illustration preparation ASF supervised the statistical analysis, and contributed to data discussion and manuscript preparation CF was responsible...
- 9
- 469
- 0
Báo cáo sinh học: "Life and death as a T lymphocyte: from immune protection to HIV pathogenesis" doc
Ngày tải lên :
06/08/2014, 19:21
... models Although any results have to be extrapolated to the human system with caution, the extensive array of tools available in experimental mouse models to track the rates of division and death of ... [8] A variant of the CD4+ T depletion hypothesis more consistent with available data is that the loss of particular subsets of effector CD4+ T cells, presumably as a result of direct viral depletion, ... Changes in the underlying dynamics of the CD4+ and CD8+ T cell compartments in the OX40-DTA mouse are summarized in Table and Figure Although there is no alteration in the size of the naïve and...
- 6
- 281
- 0