a comparative analysis and evaluation of the two popular modeling approximations

Báo cáo khoa học: "Analysis and simulation of the architecture of a growing root system: application to a comparative study of several tree seedlings" ppsx

Báo cáo khoa học: "Analysis and simulation of the architecture of a growing root system: application to a comparative study of several tree seedlings" ppsx

Ngày tải lên : 09/08/2014, 02:21
... oaks and several acacias, which show marked differences in shoot growth and ramification Materials and Methods Acorns of oaks (Quercus petraea Liebl., Q rubra du Roi) and seeds of acacias (Acacia ... Statistical studies of these ture are data allow the determination of elongation laws and branching patterns They may then be integrated into a deterministic three-dimensional model (Pages and ... number of lateral roots and rate of extension are greatly increased by mutilation of the taproot tip (Hackett, 1971) In the same way, effects of water stress on lateral root initiation and elongation...
  • 6
  • 362
  • 0
Báo cáo khoa học: "Analysis and Synthesis of the Distribution of Consonants over Languages: A Complex Network Approach" pptx

Báo cáo khoa học: "Analysis and Synthesis of the Distribution of Consonants over Languages: A Complex Network Approach" pptx

Ngày tải lên : 08/03/2014, 02:21
... A L Barab´ si 2000 The large-scale organization of a metabolic networks Nature, 406:651-654 R Jakobson and M Halle 1956 Fundamentals of Language, The Hague: Mouton and Co P Ladefoged and I Maddieson ... Two Regimes Let us assume that the inventory of all the languages comprises of 21 consonants We further assume that the consonants are arranged in their hierarchy of preference A language traverses ... preferential attachment can be interpreted as the tendency of a language to choose a consonant that has been already chosen by a 131 not all of the first 21 consonants Therefore, the probability of the...
  • 8
  • 550
  • 0
báo cáo khoa học: " Comparative genomic analysis and expression of the APETALA2-like genes from barley, wheat, and barley-wheat amphiploids" pdf

báo cáo khoa học: " Comparative genomic analysis and expression of the APETALA2-like genes from barley, wheat, and barley-wheat amphiploids" pdf

Ngày tải lên : 12/08/2014, 03:20
... CGGCCACCGCGCTCCCATGCCATA CACACCCGTCGACCRCCGTCCAT GAYTGCGGGAAGCAGGTCTACTTG AGATGCTMCACCTGACGTCGAAAATGAG CTTCAACTTCGCTGTCRAAMAGCCCAAGAT GGCCGCTGGGAGGCAAGGATGG GCCGCCCTGTCGTACGCCCTTG GAAGCGCCGCCCTATCGTAGGCTCT ... [GenBank: AF048900, AAC05206], the Oryza sativa transcription factor AP2D2 mRNA [GenBank: AY685113, AAO65862] and the A thaliana APETALA2 [GenBank: U12546, AAC13770] All these genes belong to an AP2 ... Zea mays the preBank: protein from the AP2-like gene of H vulgare cv Betzes (H106) Oryza sativa lines [GenBank: AAL50205] and [GenAlignment of the AP2-like proteins of Arabidopsis thaliana (AAC13770),...
  • 13
  • 343
  • 0
Báo cáo y học: "Analysis and evaluation of environmental tobacco smoke exposure as a risk factor for chronic cough" docx

Báo cáo y học: "Analysis and evaluation of environmental tobacco smoke exposure as a risk factor for chronic cough" docx

Ngày tải lên : 13/08/2014, 08:20
... ETS and the symptom of cough has not been analysed in great detail so far Therefore, the present study aimed to analyse the association of ETS and cough on the basis of database searches and ... Furusho S, Kita T, Katayama N, Abo M, Ohkura N, Herai Y, Hori A, Ishiura Y, Nobata K, Ogawa H, Yasui M, Kasahara K, Nakao S: Comparison of cough reflex sensitivity after an inhaled antigen challenge ... ambient air pollution and respiratory symptoms in adults (SAPALDIA study) The SAPALDIA Team Am J Respir Crit Care Med 1999, 159(4 Pt 1):1257-1266 Feleszko W, Zawadzka-Krajewska A, Matysiak K, Lewandowska...
  • 6
  • 304
  • 0
Báo cáo y học: "implementation and evaluation of the SPRINT protocol for tight glycaemic control in critically ill patients: a clinical practice change" ppsx

Báo cáo y học: "implementation and evaluation of the SPRINT protocol for tight glycaemic control in critically ill patients: a clinical practice change" ppsx

Ngày tải lên : 13/08/2014, 10:20
... data collection and the analysis and interpretation of the data DL provided statistical assistance CH provided mathematical assistance during the development of SPRINT All authors read and approved ... in data collection and the analysis and interpretation of the data, and helped draft the manuscript T Lonergan and MW helped conceive and develop the SPRINT protocol XWW, JL, and T Lotz assisted ... dynamics Chase and colleagues [21,23,38] and Hann and colleagues [38] used a model that captured the rate of insulin utilisation, insulin losses, and saturation dynamics and that has been validated...
  • 15
  • 250
  • 0
Báo cáo y học: "Mirror-Image Arachnoid Cysts in a Pair of Monozygotic Twins: A Case Report and Review of the Literature"

Báo cáo y học: "Mirror-Image Arachnoid Cysts in a Pair of Monozygotic Twins: A Case Report and Review of the Literature"

Ngày tải lên : 25/10/2012, 11:00
... our case, the lack of a previous history of trauma, infection and head surgery leads us to believe that the AC was due to a congenital anomaly Mirror images in MZ and AC are not relatively rare ... 19 Aarhus M, Helland CA, Lund-Johansen M, et al Microarray-based gene expression profiling and DNA copy number variation analysis of temporal fossa arachnoid cysts Cerebrospinal Fluid Research ... temporal fossa AC Helland et al 20 found the Na+–K+–2Cl− cotransporter NKCC1 gene was escalated in AC and NKCC1 was present in the AC wall These finding indicated NKCC1 gene might play an important...
  • 4
  • 652
  • 0
A Concise History and Directory of the City of Norwich for 1811 pptx

A Concise History and Directory of the City of Norwich for 1811 pptx

Ngày tải lên : 08/03/2014, 00:20
... filled, appears to the best advantage, and then any person who has a taste for theatrical amusements, neatness and elegance, cannot fail being agreeably entertained with the appearance of the audience, ... considered as the cause of it, the abandonment of the spinning school was unanimously agreed; and the number from that time has gradually increased From the last state of the charity, it appears that ... time of Alfred the Great, about the year 872; another in the early part of the reign of Athelstan about the year 925, and several others; besides three coins minted here of Ethelred, called the...
  • 116
  • 532
  • 0
Báo cáo khoa học: "Contents and evaluation of the first Slovenian-German online dictionary" doc

Báo cáo khoa học: "Contents and evaluation of the first Slovenian-German online dictionary" doc

Ngày tải lên : 17/03/2014, 22:20
... BESEDA and its texts Available: http://bos.zrcsazu.si /a_ about.html Metka uk, Marjanca Mihelie and Cita Vuga 1996 Odkrivajmo sloven,Wino Ljubljana: Filozofska fakulteta, Seminar slovenskega jezika, ... items The dictionary will be enlarged based on these quantitative and qualitative corpus and query analyses Using a tagset covering the grammar information necessary for the Slovenian language ... a dictionary user can understand of the lexical content of the newspaper text In the case of non-related lemmas, one of them is usually much more frequent (as with avto and avt), whereas in the...
  • 4
  • 321
  • 0
analysis and determination of the stress intensity factor of load-carrying cruciform fillet welded joints

analysis and determination of the stress intensity factor of load-carrying cruciform fillet welded joints

Ngày tải lên : 24/05/2014, 20:40
... cold-lab cracks increased with the increase in crack size  The path of crack propagation in case of root crack is longer than that in cases of toe and cold-lab cracks 35 Journal of American Science ... case of root crack is longer than that in cases of toe and cold-lab cracks Values of stress intensity factor (KI) in cases of toe and cold-lab cracks are higher than that in case of root crack ... the same crack size which means that the failure by unstable fracture in the elastic load range is more likely to occur in case of toe and cold-lab cracks than in case of root crack 6.1.2 Crack...
  • 7
  • 412
  • 0
báo cáo hóa học:" Arthroscopic debridement of the osteoarthritic knee combined with hyaluronic acid (Orthovisc®) treatment: A case series and review of the literature" docx

báo cáo hóa học:" Arthroscopic debridement of the osteoarthritic knee combined with hyaluronic acid (Orthovisc®) treatment: A case series and review of the literature" docx

Ngày tải lên : 20/06/2014, 01:20
... patients carried a preliminary diagnosis of osteoarthritis (via MRI and plain radiograph) and were candidates for primary arthroscopic treatment of a unilateral knee secondary to a meniscal pathology, ... performed all thirty knee arthroscopies Standard medial and lateral parapatellar portals were established to perform the procedure The patellofemoral joint, medial femoral tibial joint, and lateral ... patellofemoral joint had the greatest amount of involvement with an average grade of 3.1 +/- 0.5 The medial compartment revealed an average ICRS grade of 2.8 +/- 0.8 and the lateral compartment...
  • 8
  • 709
  • 0
báo cáo hóa học:" Isolated thumb carpometacarpal joint dislocation: a case report and review of the literature" potx

báo cáo hóa học:" Isolated thumb carpometacarpal joint dislocation: a case report and review of the literature" potx

Ngày tải lên : 20/06/2014, 04:20
... trapezium and trapeziometacarpal joint J Hand Surg [Am] 1999, 24(4):786-798 Strauch RJ, Behrman MJ, Rosenwasser MP: Acute dislocation of the carpometacarpal joint of the thumb: an anatomic and cadaver ... GA: Bilateral carpometacarpal dislocations of the thumb Am J Orthop 2003, 32:38-41 11 Kural C, Malkoc M, Ugras AA, Sen A: Isolated carpometacarpal dislocation of the thumb: a case report Acta ... the manuscript while B C was a major contributor in writing and in editing the manuscript, as well C L and T.S analyzed and interpreted the patient data regarding the injury A P and P .A have been...
  • 5
  • 445
  • 0
báo cáo hóa học:" Revision hip replacement for recurrent Hydatid disease of the pelvis: a case report and review of the literature" doc

báo cáo hóa học:" Revision hip replacement for recurrent Hydatid disease of the pelvis: a case report and review of the literature" doc

Ngày tải lên : 20/06/2014, 04:20
... with Praziquental and Albendazole and she was discharged home on Albendazole Histology again confirmed the diagnosis of hydatid disease She was reviewed in the clinic on 6/6/00 and had an MRI ... of a Hindquarter amputation can be considerable Subtotal excision of the cyst and joint replacement is an acceptable option based on our case report Subtotal excision of the Hydatid cyst of the ... Hydatid disease of the pelvis: a case report and review of the literature Journal of Orthopaedic Surgery and Research 2010 5:17 Submit your next manuscript to BioMed Central and take full advantage...
  • 5
  • 476
  • 0
báo cáo hóa học:" Low grade fibromyxoid sarcoma: a case report and review of the literature" pot

báo cáo hóa học:" Low grade fibromyxoid sarcoma: a case report and review of the literature" pot

Ngày tải lên : 20/06/2014, 04:20
... work MGL, CA and MD participated in the design of the study and drafted the manuscript IDG and AG participated in the design of the study TAX and AB conceived of the study, and participated in its ... and metastases, as many of those cases were selected on the base of unexplained metastases In a more recent and larger series local Arnaoutoglou et al Journal of Orthopaedic Surgery and Research ... exclude the rare case of LGFMS [4] The clinical presentation is usually long-standing and is mainly related to the anatomic location of the mass LGFMS usually presents as a painless soft-tissue mass...
  • 7
  • 448
  • 0
báo cáo hóa học:" Medial pelvic migration of the lag screw in a short gamma nail after hip fracture fixation: a case report and review of the literature" potx

báo cáo hóa học:" Medial pelvic migration of the lag screw in a short gamma nail after hip fracture fixation: a case report and review of the literature" potx

Ngày tải lên : 20/06/2014, 04:20
... a minor trauma has also been reported [10] Walking and normal weight bearing subjects the implant and bone surface to combined axial and torsional load that may play a role in lag screw migration ... theorized that over time with the compression of the fracture and dynamization of the nail in the setting of an unstable fracture pattern, there was toggling of the nail within the intrameduallary ... Castelein R, et al: Treatment of unstable trochanteric fractures Randomised comparison of the gamma nail and the proximal femoral nail Journal of Bone and Joint Surgery Am 2004, 86:86-94 14 Kannusa...
  • 7
  • 464
  • 0
báo cáo hóa học:" Medial pelvic migration of the lag screw in a short gamma nail after hip fracture fixation: a case report and review of the literature" pot

báo cáo hóa học:" Medial pelvic migration of the lag screw in a short gamma nail after hip fracture fixation: a case report and review of the literature" pot

Ngày tải lên : 20/06/2014, 07:20
... a minor trauma has also been reported [10] Walking and normal weight bearing subjects the implant and bone surface to combined axial and torsional load that may play a role in lag screw migration ... theorized that over time with the compression of the fracture and dynamization of the nail in the setting of an unstable fracture pattern, there was toggling of the nail within the intrameduallary ... Castelein R, et al: Treatment of unstable trochanteric fractures Randomised comparison of the gamma nail and the proximal femoral nail Journal of Bone and Joint Surgery Am 2004, 86:86-94 14 Kannusa...
  • 7
  • 476
  • 0
báo cáo hóa học:" Struma ovarii associated with pseudo-Meigs’ syndrome and elevated serum CA 125: a case report and review of the literature" pdf

báo cáo hóa học:" Struma ovarii associated with pseudo-Meigs’ syndrome and elevated serum CA 125: a case report and review of the literature" pdf

Ngày tải lên : 20/06/2014, 07:20
... benign and solid tumors with the gross appearance of a fibroma (fibroma, thecoma, granulosa cell tumor), accompanied by ascites and hydrothorax While similar clinic manifestations presented in other ... desire of both the patient and her husband and received a hormone replacement therapy subsequently The elevation of CA 125 may have been secondary to the presence of ascites; however, its level was ... replacement therapy Discussion Mature cystic teratomas account for approximately 20% of all ovarian tumors Of these, approximately 15% contain normal thyroid tissue Struma ovarii is a monodermal...
  • 4
  • 540
  • 0
Báo cáo toán học: " IPv6 address autoconfiguration in geonetworking-enabled VANETs: characterization and evaluation of the ETSI solution" ppt

Báo cáo toán học: " IPv6 address autoconfiguration in geonetworking-enabled VANETs: characterization and evaluation of the ETSI solution" ppt

Ngày tải lên : 20/06/2014, 20:20
... network are feasible There are three is the number of available lanes in a road Our pre- parameters that have an impact on the probability of vious analysis is valid regardless of the number of having ... includes a rigorous analysis of the ETSI stateless IPv6 address autoconfiguration mechanism, based on the identified target scenarios An analytical model (Section 4) and a simulation-based evaluation of ... ETSI standardized mechanism In the rest of the paper we refer to the ETSI IPv6 address stateless autoconfiguration solution as ETSI SLAAC ETSI SLAAC adapts the standard IPv6 SLAAC (Stateless Address...
  • 33
  • 381
  • 0
Báo cáo khoa học nông nghiệp " Effects of Stocking Biomass on Growth, Survival and Production of the Two Sizes of Clam Meretrix lyrata Cultured in the Intertidal Areas And Notes on Hatchery Production of Clam Spat " pot

Báo cáo khoa học nông nghiệp " Effects of Stocking Biomass on Growth, Survival and Production of the Two Sizes of Clam Meretrix lyrata Cultured in the Intertidal Areas And Notes on Hatchery Production of Clam Spat " pot

Ngày tải lên : 21/06/2014, 05:20
... (Cigarr a and Fernandez, 2000; Shpigel and Spencer, 1996; Zhang and Yan, 2006) and the use of clam as water quality improvement (Jara-Jara et al., 1997; Shpigel and Fridman, 1990) In Vietnam, the ... stage when the fatty acids normally accumulated Our result confirmed the variation of fatty acid of clam Ruditapes decussatus reared in sea water and effluent from a fish farm in Galicia (JaraJara ... (JaraJara et al., 1997) The fatty acid variation and the factors affecting to this variation need a further research Economic evaluation The estimation of the economic benefit of clam cultured in the...
  • 18
  • 442
  • 0
Báo cáo nghiên cứu khoa học " CLAM CULTURE DEVELOPMENT IN THE INTERTIDAL AREA: EFFECTS OF STOCKING BIOMASS ON GROWTH, SURVIVAL AND PRODUCTION OF THE TWO SIZES CLAM Meretrix lyrata " docx

Báo cáo nghiên cứu khoa học " CLAM CULTURE DEVELOPMENT IN THE INTERTIDAL AREA: EFFECTS OF STOCKING BIOMASS ON GROWTH, SURVIVAL AND PRODUCTION OF THE TWO SIZES CLAM Meretrix lyrata " docx

Ngày tải lên : 22/06/2014, 12:20
... research to establish a standard clam aquaculture protocol to enhance the production and profit of clam culture Among the factors that affect growth and production, feed and feeding of clam have ... stage when the fatty acids normally accumulated Our result confirmed the variation of fatty acid of clam Ruditapes decussatus reared in sea water and effluent from a fish farm in Galicia (Jara-Jara ... and Wf are mean of initial weight and final weight, respectively and t is number of experiment days Size variation of the clam was evaluated according to Wang et al (1998) in which the mean of...
  • 9
  • 443
  • 0
prevalence and influencing factors of the lower reproductive tract infections among sex workers in the centre for treatment - education- labour ii hanoi and evaluation of the intervention

prevalence and influencing factors of the lower reproductive tract infections among sex workers in the centre for treatment - education- labour ii hanoi and evaluation of the intervention

Ngày tải lên : 25/07/2014, 13:32
... because the Centre under the Department of Labor War Invalids and Social Affairs in Hanoi, so they are less of updated well-trained and re-trained for theit practising daily After intervention the ... month The authors also said there is a difference in the rate of HIV / STI and the average number of sexual partners, as many clients as much of risk of infection, however the affectivness of condom ... century, in the countries of Asia, Africa and Latin America the incidence of LRTI icluded Chlamydia chromatis, gonorrhea, Trichomonas vaginalis and siphylus were at high risk women accounting...
  • 14
  • 527
  • 0