3 2 facs analysis of cd40 expression on 4t1 breast cancer cell surface a isotype control and b anti cd40 antibody detection of the cd40 receptor expression on the surface of 4t1 breast cancer cells

Development of new neural stem cell based tumor targeted gene therapy approaches

Development of new neural stem cell based tumor targeted gene therapy approaches

Ngày tải lên : 09/09/2015, 10:06
... tumor-targeted gene therapy for CD40+< /b> cancers 1 .3.< /b> 2 < /b> CD40 < /b> expression < /b> and < /b> function in human cells In the year 1985, CD40 < /b> was identified as a < /b> surface < /b> marker on < /b> bladder carcinoma cells and < /b> on < /b> B cells ... After 24< /b> h, cells were fixed and < /b> stained with a < /b> mouse anti- VSVG monoclonal antibody (clone P5D4) and < /b> then with a < /b> FITC-conjugated anti- mouse secondary antibody Then, the presence of < /b> VSV-G on < /b> the cell < /b> ... 69 Fig 3.< /b> 1 Establishment of < /b> CD40L-expressing NSC using baculovirus 86 Fig 3.< /b> 2 < /b> FACS < /b> analysis < /b> of < /b> CD40 < /b> expression < /b> on < /b> 4T1 < /b> breast < /b> cancer < /b> cell < /b> surface < /b> 89 XI Fig 3.< /b> 3 Cytokine antibody array ...
  • 148
  • 577
  • 0
WiX 3.6: A Developer''''s Guide to Windows Installer XML doc

WiX 3.6: A Developer''''s Guide to Windows Installer XML doc

Ngày tải lên : 16/03/2014, 07:20
... 27< /b> 2 -sl 27< /b> 2 -spdb 27< /b> 2 -sval 27< /b> 2 Link-time variables 2 < /b> 73 < /b> Localization variables 2 < /b> 73 < /b> Binder variables 2 < /b> 73 < /b> Custom linker variables 27< /b> 5 Building an installer without Visual Studio 27< /b> 6 Summary 27< /b> 8 ... 24< /b> 7 Publishing control < /b> events 22< /b> 7 Subscribing to control < /b> events 23< /b> 1< /b> Publish events 23< /b> 2< /b> DoAction 23< /b> 3< /b> EndDialog 23< /b> 4< /b> NewDialog 23< /b> 5< /b> AddLocal 23< /b> 6< /b> Publishing a < /b> property 23< /b> 9< /b> Subscribe events 23< /b> 9< /b> ScriptInProgress 24< /b> 0 ... statements and < /b> iterations if elseif else ifdef ifndef Iterations Errors and < /b> warnings Preprocessor extensions Light.exe Command-line arguments (linking) 25< /b> 1 25< /b> 1 25< /b> 2 25< /b> 2 25< /b> 2 25< /b> 2 25< /b> 2 25< /b> 2 2 < /b> 53 < /b> 2 < /b> 53 < /b> 2 < /b> 53 < /b> 2 < /b> 53 < /b> 25< /b> 3...
  • 488
  • 7.4K
  • 1
How to translate some of the metaphors in Harry potter Books (book 3 and book 7) into Vietnamese

How to translate some of the metaphors in Harry potter Books (book 3 and book 7) into Vietnamese

Ngày tải lên : 26/11/2012, 09:53
... Translation of < /b> metaphors by the professional translator This chapter is devoted to the analysis < /b> of < /b> the translaion of < /b> metaphors in the two books Harry Potter and < /b> the Prisoner of < /b> Azkaban and < /b> Harry ... Potters books, Harry Potter and < /b> the Prisoner of < /b> Azkaban and < /b> Harry Potter and < /b> the Deathly Hallows The results of < /b> the analysis < /b> of < /b> professional translation shows that metaphors could be translated ... Prisoner of < /b> Azkaban and < /b> Harry Potter and < /b> the Deathly Hallows: . 32 /b> III .2 < /b> Translation of < /b> dead metaphors in Harry Potter books 33< /b> III .3 < /b> Translation of < /b> live metaphors in Harry Potter books .34< /b> III .3.< /b> 1...
  • 45
  • 1.2K
  • 5
Báo cáo khoa học: A steady-state modeling approach to validate an in vivo mechanism of the GAL regulatory network in Saccharomyces cerevisiae ppt

Báo cáo khoa học: A steady-state modeling approach to validate an in vivo mechanism of the GAL regulatory network in Saccharomyces cerevisiae ppt

Ngày tải lên : 07/03/2014, 16:20
... G8 02 < /b> G3*G3*Š þ ½D2G 42 < /b> G8 02 < /b> G3*G 42 < /b> Š þ ½D2G 42 < /b> G8 02 < /b> G3*G3*G 42 < /b> Š þ ½D2G 42 < /b> G8 02 < /b> G3*G 42 < /b> G8 02 < /b> Š þ ½D2G 42 < /b> G8 02 < /b> G3*G3*G8 02 < /b> G8 02 < /b> Š þ ½D2G 42 < /b> G8 02 < /b> G3*G3*G 42 < /b> G8 02 < /b> G3*Š þ ½D2G 42 < /b> G8 02 < /b> G3*G3*G 42 < /b> G8 02 < /b> G3*G3*Š ... interaction between Gal80p and < /b> Gal3p based on < /b> translocation and < /b> dimerization possibilities of < /b> Gal3p The steady-state response analysis < /b> rules out dimerization or translocation of < /b> Gal3p Further, the analysis < /b> ... þ ½D2G 42 < /b> G8 02 < /b> G3*Š þ  ½D2G 42 < /b> G8 02 < /b> G3*G3*Š þ ½D2G 42 < /b> G8 02 < /b> G3*G 42 < /b> Š þ  ½D2G 42 < /b> G8 02 < /b> G3*G3*G 42 < /b> Š þ ½D2G 42 < /b> G8 02 < /b> G3*G 42 < /b> G8 02 < /b> Š þ  ½D2G 42 < /b> G8 02 < /b> G3*G3*G 42 < /b> G8 02 < /b> Š þ  ½D2G 42 < /b> G8 02 < /b> G3*G3*G 42 < /b> G8 02 < /b> G3*Š...
  • 11
  • 490
  • 0
An integration of the four english skills in teaching reading texts to beginner learners at asemlink international language centre

An integration of the four english skills in teaching reading texts to beginner learners at asemlink international language centre

Ngày tải lên : 18/12/2013, 10:08
... particular has many advantages over the approach to teaching language skills separately Among those advantages, three important benefits that an integrated approach can bring about are it enhances the ... start realizing the meaning of < /b> the words as well as grammar and < /b> discourse markers And < /b> then they can understand the whole part of < /b> the reading The readers have to go from the smallest part to the ... communicate naturally bacause they have already met the situation in their real learning In fact, there have been a < /b> great number of < /b> people who are very good at writing and < /b> reading skills, but they can...
  • 90
  • 576
  • 1
How to get out of the friendzone: turn your  friendship into a  relationship

How to get out of the friendzone: turn your friendship into a relationship

Ngày tải lên : 10/02/2014, 18:17
... intimacy Jackson and < /b> Ali both work at a < /b> trendy fusion restaurant They don’t see each other at the restaurant that much because they have opposite shifts But the entire staff hangs out at the bartender’s ... had a < /b> ton of < /b> The Truth About the Friend Zone 33< /b> successes; you might as well be one of < /b> them You’re sexy, smart, funny, and < /b> an all-around amazing catch Now is the time to make a < /b> change, a < /b> real ... have to move to Iceland and < /b> become a < /b> trapeze artist or a < /b> shrimp boat captain You are always walking that tightrope between best- and < /b> worst-case scenarios WHY IS IT A < /b> PROBLEM? Some of < /b> you may be...
  • 240
  • 1.1K
  • 1
Tài liệu University Oars Being a Critical Enquiry Into the After Health of the Men Who Rowed in the Oxford and Cambridge Boat-Race, from the Year 1829 to 1869, Based on the Personal Experience of the Rowers Themselves pdf

Tài liệu University Oars Being a Critical Enquiry Into the After Health of the Men Who Rowed in the Oxford and Cambridge Boat-Race, from the Year 1829 to 1869, Based on the Personal Experience of the Rowers Themselves pdf

Ngày tải lên : 14/02/2014, 21:20
... OARS a < /b> pretty fair state of < /b> health, being able to stand a < /b> considerable amount of < /b> hard work, in the shape of < /b> a < /b> 20< /b> or 30< /b> miles walk, or a < /b> good long pull on < /b> the river." Q also appears to have passed ... to 22< /b> UNIVERSITY OARS the eight Oars an after life of < /b> 38< /b> 9 instead of < /b> 32 /b> 0 years, and < /b> to each man 48*6 instead of < /b> 40 years The Table regarding these two first crews of < /b> the year 1 829< /b> m a < /b> y be calculated ... Lucknow, one foundered on < /b> board the " London" in the Bay of < /b> Biscay, another was drowned in swimming a < /b> young horse across a < /b> river in Australia, another was murdered by poachers, and < /b> another accidentally...
  • 419
  • 541
  • 0
A Review of Approaches to Mobility Telemonitoring of the Elderly in Their Living Environment potx

A Review of Approaches to Mobility Telemonitoring of the Elderly in Their Living Environment potx

Ngày tải lên : 05/03/2014, 21:20
... user interaction to maintain and < /b> operate them TABLE Summary of < /b> wearable systems discussed Author Mathie and < /b> Celler5 ,22< /b> , 23< /b> ,< /b> 25< /b> Prado 43,< /b> 44 Wilson and < /b> Dadd 12,< /b> 59 Noury et al . 32 /b> (VTAMN) Sarela46 CSIRO ... worn at the waist, 12,< /b> 22,< /b> 23< /b> ,< /b> 25< /b> ,59 sacrum 43 < /b> or chest28 ,31< /b> to multiple sensors distributed on < /b> the body.11 ,20< /b> ,30< /b> , 53 < /b> Data Logging Wearables Data logging systems have the advantage of < /b> being able to monitor ... Wearable data forwarding systems, the lightest wearable option, are suited to the frail and < /b> housebound as they analyze the data in real-time and < /b> can raise immediate alerts Data-logging wearables...
  • 17
  • 603
  • 1
Báo cáo khoa học: The N-terminal region of the bacterial DNA polymerase PolC features a pair of domains, both distantly related to domain V of the DNA polymerase III s subunit ppt

Báo cáo khoa học: The N-terminal region of the bacterial DNA polymerase PolC features a pair of domains, both distantly related to domain V of the DNA polymerase III s subunit ppt

Ngày tải lên : 05/03/2014, 23:20
... Escherichia coli DNA polymerase III and < /b> interaction with the alpha subunit Nucleic Acids Res 35< /b> , 28< /b> 25 2 < /b> 8 32 /b> 20< /b> Abe Y, Jo T, Matsuda Y, Matsunaga C, Katayama T & Ueda T (20< /b> 07) Structure and < /b> function of < /b> ... N-terminal region 28< /b> 29< /b> 30< /b> 31< /b> 32 /b> 33< /b> 34< /b> 35< /b> 36< /b> 37< /b> 38< /b> 39< /b> 40 41 cini P, Yokoyama S et al (20< /b> 07) Structural aspects of < /b> RbfA action during small ribosomal subunit assembly Mol Cell < /b> 28< /b> , 434< /b> –445 Noirot-Gros ... 2aya, 2e0g, 2wp0) Models (based on < /b> 2aya, 2e0g, 2wp0) 74 74 )8.4 ()7.8; )8 .2)< /b> NMR, 2aya NMR, 2e0g X-ray, 2wp0 X-ray, 2dyj NMR, 2e7g Model (based on < /b> 2e0g) Model (based on < /b> 2aya) 72 < /b> 77 86 82 < /b> 89 72 < /b> 77...
  • 10
  • 419
  • 0
JUDGMENTS OF THE COURT OF APPEAL OF NEW ZEALAND ON PROCEEDINGS TO REVIEW ASPECTS OF THE REPORT OF THE ROYAL COMMISSION OF INQUIRY INTO THE MOUNT EREBUS AIRCRAFT DISASTER potx

JUDGMENTS OF THE COURT OF APPEAL OF NEW ZEALAND ON PROCEEDINGS TO REVIEW ASPECTS OF THE REPORT OF THE ROYAL COMMISSION OF INQUIRY INTO THE MOUNT EREBUS AIRCRAFT DISASTER potx

Ngày tải lên : 06/03/2014, 12:21
... Whether the crash of < /b> the aircraft or the death of < /b> the passengers and < /b> crew was caused or contributed to by any person (whether or not that person was on < /b> board the aircraft) by an act or omission ... lies' was seen by him as so wide as to cover all those persons Paragraph 37< /b> 7 is the culmination of < /b> a < /b> series of < /b> paragraphs beginning with paragraph 37< /b> 3 and < /b> separately headed by the Commissioner 'The ... to appear and < /b> be heard as if he had been cited as a < /b> party Then in 1980, just as the Erebus Commission was about to start, the section was replaced and < /b> strengthened The main changes made are that...
  • 87
  • 406
  • 0
Báo cáo khoa học: Inhibition of PI3K/Akt partially leads to the inhibition of PrPC-induced drug resistance in gastric cancer cells pdf

Báo cáo khoa học: Inhibition of PI3K/Akt partially leads to the inhibition of PrPC-induced drug resistance in gastric cancer cells pdf

Ngày tải lên : 07/03/2014, 03:20
... TTTGGTGATACACATCTGCTCAACATGAGCAGATGTGTATCACCTTTTT CTAGAAAAAGGTGATACACATCTGCTCATGTTGAGCAGATGTGTATCAC TTTGTAGTCATTGTCCTCCAGCACAGCTGGAGGACAATGACTACTTTTT CTAGAAAAAGTAGTCATTGTCCTCCAGCTGTGCTGGAGGACAATGACTA CTCGAGGAATCAGCATTCAG ... Sense Antisense CCCAAGCTTGGGATGGCGAACCTTGGCTGCT CGGGATCCTCCCACATCAGGAAGATGAGGA TTTGTTGCTGTACTCATCCATGACACATGGATGAGTACAGCAACTTTTT CTAGAAAAAGTTGCTGTACTCATCCATGTGTCATGGATGAGTACAGCAA TTTGGTGATACACATCTGCTCAACATGAGCAGATGTGTATCACCTTTTT ... nuclear-stained using 4¢,6-diamidino-2phenylindole (DAPI) The primary antibody combinations consisted of < /b> monoclonal antibody against p-Akt and < /b> monoclonal antibody against PrP SGC7901/ADR cells...
  • 10
  • 448
  • 0
To Cut or Not to Cut? That is the (Central Bank’s) Question In Search of the Neutral Interest Rate in Latin America pdf

To Cut or Not to Cut? That is the (Central Bank’s) Question In Search of the Neutral Interest Rate in Latin America pdf

Ngày tải lên : 15/03/2014, 14:20
... ta Rica 2.< /b> 6 4.1 - - - - 3.< /b> 7 3.< /b> 5 Dom inican Republic 3.< /b> 2 < /b> 4 .2 < /b> 1.7 2.< /b> 7 3.< /b> 8 3.< /b> 1 3.< /b> 9 3.< /b> 2 < /b> Guatem ala 2 < /b> .3 < /b> 3 .2 < /b> - - - 2.< /b> 0 3.< /b> 7 2.< /b> 8 Paraguay 2.< /b> 0 3.< /b> 8 1.0 1 .3 < /b> 2.< /b> 2 2.< /b> 2 3.< /b> 2 < /b> 2 .2 < /b> Source: Authors ' calculations ... Mexico 20< /b> 00 20< /b> 02 < /b> 2004 20< /b> 06 20< /b> 08 20< /b> 10 20< /b> 12 < /b> Peru 20< /b> 01 20< /b> 02 < /b> 20 03 < /b> 20< /b> 04 20< /b> 05 20< /b> 06 20< /b> 07 20< /b> 08 20< /b> 09 20< /b> 10 20< /b> 11 20< /b> 12 < /b> Costa Rica -2 < /b> -1 -2 < /b> Chile -4 -1 -2 < /b> 2000 20< /b> 02 < /b> 2004 20< /b> 06 20< /b> 08 20< /b> 10 20< /b> 12 < /b> Guatemala 20< /b> 00 20< /b> 02 < /b> ... 5 .21< /b> 4.69 4.18 3.< /b> 67 3.< /b> 17 5. 93 < /b> 5.41 4.90 4 .39< /b> 3.< /b> 89 Paraguay Guatemala 4 .26< /b> 3.< /b> 75 3.< /b> 24< /b> 2.< /b> 73 < /b> 2.< /b> 22 < /b> 3.< /b> 88 3.< /b> 36 2.< /b> 85 2 < /b> .34< /b> 1.84 4. 82 < /b> 4 .31< /b> 3.< /b> 80 3.< /b> 29< /b> 2.< /b> 78 5.41 4.90 4 .39< /b> 3.< /b> 88 3.< /b> 37 26< /b> Table The Neutral...
  • 48
  • 504
  • 0
Báo cáo khoa học: A characteristic Glu17 residue of pig carnitine palmitoyltransferase 1 is responsible for the low Km for carnitine and the low sensitivity to malonyl-CoA inhibition of the enzyme docx

Báo cáo khoa học: A characteristic Glu17 residue of pig carnitine palmitoyltransferase 1 is responsible for the low Km for carnitine and the low sensitivity to malonyl-CoA inhibition of the enzyme docx

Ngày tải lên : 16/03/2014, 04:20
... generated from the construct PMCPT1STOP ⁄ pBSSK+ [ 23< /b> ]< /b> To obtain D18PigCPT 1B and < /b> D28PigCPT 1B, deletion primers DH671 (5¢-AGCTGAATTCATGGTCGACTTCAGGCTC AGC -3< /b> ) and < /b> DH7 62 < /b> (5¢-AGCTGAATTCATGAAACATA TCTACCTGTCCGGG -3< /b> ) ... (5¢-GGAGTTGCTGGCC AAAGAGTTCCAGGACAAGACTGCCC -3< /b> ) and < /b> DH870 FEBS Journal 27< /b> 6 (20< /b> 09) 21< /b> 0 21< /b> 8 ª 20< /b> 08 The Authors Journal compilation ª 20< /b> 08 FEBS 21< /b> 5 D17E as a < /b> malonyl-CoA sensitivity determinant of < /b> ... mutate human CPT 1B cDNA, we used the construct pGEMT–5¢HumanCPT 1B as a < /b> template in a < /b> PCR reaction with primers DH6 73 < /b> (5¢-AGCTGAATTC ATGGCGGAAGCTCACCAG -3< /b> ) and < /b> DH8 03 < /b> (5¢-TCCA CCCATGGTAGCAGAGAAGCAGCTTAAGGGTTTGG...
  • 9
  • 550
  • 0
Báo cáo khoa học: Contributions to catalysis and potential interactions of the three catalytic domains in a contiguous trimeric creatine kinase doc

Báo cáo khoa học: Contributions to catalysis and potential interactions of the three catalytic domains in a contiguous trimeric creatine kinase doc

Ngày tải lên : 16/03/2014, 06:20
... Wild-type D1SD2D3 D1D2SD3 D1D2D3S D1SD2D3S D1D2SD3S D1SD2SD3 D1SD2SD3S 151 178 109 1 63 < /b> 138< /b> 137< /b> 1 73 < /b> 54 100 1 23< /b> < /b> 96 104 90 1 12 < /b> 1 23< /b> < /b> 52 < /b> 3.< /b> 1 2.< /b> 9 2.< /b> 1 2.< /b> 5 3.< /b> 0 1.6 2.< /b> 5 3.< /b> 0 2.< /b> 2 2.< /b> 1 1.9 1.6 2.< /b> 0 1.4 1.7 2.< /b> 9 1.4 ... D1D2D3S D1SD2D3S D1D2SD3S D1SD2SD3 D1SD2SD3S 32 /b> 8 27< /b> 0 180 196 75 125< /b> 1 13 < /b> 0.7 715 586 39< /b> 2 < /b> 427< /b> 164 2 < /b> 73 < /b> 2 < /b> 43 < /b> 1.6 33< /b> 0 28< /b> 0 21< /b> 0 27< /b> 0 80 20< /b> 0 140 0.6 ± ± ± ± ± ± ± ± 16.0 9.1ab 5. 1a < /b> 14. 0a < /b> 1.1ab 7. 6a < /b> 11. 6a < /b> ... 20< /b> 08 The Authors Journal compilation ª 20< /b> 08 FEBS G G Hoffman et al compared with D1D2SD3S and < /b> D1SD2SD3, and < /b> the similar kcat values seen in D1D2SD3S and < /b> D1SD2SD3 Given the wealth of < /b> structural data...
  • 9
  • 567
  • 0
Báo cáo khoa học: Proteolysis of the tumour suppressor hDlg in response to osmotic stress is mediated by caspases and independent of phosphorylation pot

Báo cáo khoa học: Proteolysis of the tumour suppressor hDlg in response to osmotic stress is mediated by caspases and independent of phosphorylation pot

Ngày tải lên : 23/03/2014, 06:20
... during the execution phase of < /b> apoptosis [24< /b> ] We observed a < /b> parallel activation of < /b> these proteases, the activation of < /b> caspase being transient and < /b> the activation of < /b> caspase being stronger and < /b> sustained ... hDlg–D39 7A < /b> hDlg–D74 7A < /b> 10 Control < /b> Sorbitol Fig Quantification of < /b> cells attached and < /b> apoptotic cells after sorbitol treatment (A)< /b> Cell < /b> attachment and < /b> (B) caspase activation were measured as indicated ... high concentrations inhibits all p38 and < /b> JNK isoforms [17], and < /b> SB2 035< /b> 80, which inhibits the isoforms p3 8a < /b> ⁄ b, failed to abolish hDlg degradation (Fig 3C) BIRB0796 at high concentrations (1 and...
  • 14
  • 360
  • 0
Report to the Congress on Practices of the Consumer Credit Industry in Soliciting and Extending Credit and their Effects on Consumer Debt and Insolvency pot

Report to the Congress on Practices of the Consumer Credit Industry in Soliciting and Extending Credit and their Effects on Consumer Debt and Insolvency pot

Ngày tải lên : 29/03/2014, 06:21
... card Carries a < /b> balance Share of < /b> total bank-type card balances 20< /b> 39< /b> .9 Has a < /b> card Carries a < /b> balance Share of < /b> total bank-type card balances 40–59.9 Has a < /b> card Carries a < /b> balance Share of < /b> total bank-type ... bank-type card balances 60–79.9 Has a < /b> card Carries a < /b> balance Share of < /b> total bank-type card balances 80–100 Has a < /b> card Carries a < /b> balance Share of < /b> total bank-type card balances 1970 1977 19 83 < /b> 1989 ... made available to consumers who are not capable of < /b> repaying and < /b> that the accumulation of < /b> such debt may contribute to consumer insolvency Section 122< /b> 9 of < /b> the Bankruptcy Abuse Prevention and < /b> Consumer...
  • 30
  • 543
  • 0
Report and Recommendations Pursuant to Section 133 of the Emergency Economic Stabilization Act of 2008: Study on Mark-To-Market Accounting doc

Report and Recommendations Pursuant to Section 133 of the Emergency Economic Stabilization Act of 2008: Study on Mark-To-Market Accounting doc

Ngày tải lên : 29/03/2014, 20:20
... Considerations 20< /b> 20< /b> 20< /b> D Background Information on < /b> Fair Value Accounting Definition of < /b> Fair Value a < /b> U.S GAAP b IFRS 22< /b> 22< /b> 22< /b> 23< /b> < /b> 24< /b> 25< /b> 25< /b> 31< /b> Application of < /b> Fair Value Accounting a < /b> How Fair Value Impacts Accounting ... quotations are not readily available 13 < /b> the Federal Reserve and < /b> the Department of < /b> Treasury, as mandated by the Act, as well as other federal banking regulators and < /b> the FASB, (3)< /b> a < /b> review of < /b> relevant ... internationally by the International Accounting Standards Board (the “IASB”), the standard-setting body for international financial reporting standards (“IFRS”), and < /b> other global market participants...
  • 259
  • 309
  • 0
Báo cáo khoa học: Inhibition of the D-alanine:D-alanyl carrier protein ligase from Bacillus subtilis increases the bacterium’s susceptibility to antibiotics that target the cell wall potx

Báo cáo khoa học: Inhibition of the D-alanine:D-alanyl carrier protein ligase from Bacillus subtilis increases the bacterium’s susceptibility to antibiotics that target the cell wall potx

Ngày tải lên : 30/03/2014, 16:20
... dLtA-P1, 5¢-ACAAATATAGACACCGAGCAAAATGG CAA; dLtA-P2, 5¢-CGAGCTCGAATTCGTAATCATGGT CATATTATAAATATATGAACCGCTATTCGCGGT -3< /b> (3< /b> kanamycin fragment underlined); dLtA-P3, 5¢-GTAT AATCTTACCTATCACCTCAAATGGTTCTCGTTTTTA ... ( 23< /b> 2< /b> nm, Fig 4) is well in the range of < /b> NRPS A-< /b> domain inhibitors [26< /b> ] and < /b> inhibitors of < /b> aaRS [ 23< /b> ,< /b> 24< /b> ] In addition, the Phe activating A-< /b> domain GrsA -A < /b> [18, 44] and < /b> the carboxy acid activating A-< /b> domain ... 5¢-GATAAGATCT TACAAGAACCTCTTCGCCAATG -3< /b> from chromosomal DNA of < /b> B subtilis ATCC2 133< /b> 2 < /b> and,< /b> after restriction digest of < /b> the amplified fragment, ligated into the NcoI and < /b> BglII sites of < /b> pQE60 (Qiagen)...
  • 11
  • 407
  • 0
Báo cáo sinh học: " Modulation of macrophage functions by sheeppox virus provides clues to understand interaction of the virus with host immune system" docx

Báo cáo sinh học: " Modulation of macrophage functions by sheeppox virus provides clues to understand interaction of the virus with host immune system" docx

Ngày tải lên : 18/06/2014, 22:20
... 170 :20< /b> 81 -20< /b> 95 Page of < /b> (page number not for citation purposes) Virology Journal 20< /b> 05, 2:< /b> 22 < /b> 15 16 17 18 19 20< /b> 21< /b> 22< /b> 23< /b> < /b> 24< /b> 25< /b> 26< /b> 27< /b> 28< /b> 29< /b> 30< /b> 31< /b> 32 /b> 33< /b> 34< /b> 35< /b> 36< /b> 37< /b> Frucht DM, Fukao T, Bogdan C, Schindler ... were bred conventionally, and < /b> received standard laboratory diet as well as water ad libitum Virus SPPV attenuated vaccine (Vaccine and < /b> Sera Production and < /b> Research Institute, Abbasia, Cairo, ... CRBC at day Serum was obtained seven days after CRBC immunization, tested for agglutinins against CRBC by the microhaemagglutination test according to [36< /b> ] Statistical analysis < /b> Analysis of < /b> variance...
  • 7
  • 353
  • 0

Xem thêm