3 2 estimates of the weight of air required for selected fuels and excess air levels

Báo cáo khoa học: Limited proteolysis of Escherichia coli cytidine 5¢-triphosphate synthase. Identiﬁcation of residues required for CTP formation and GTP-dependent activation of glutamine hydrolysis potx

Ngày tải lên : 23/03/2014, 17:22

... Parasitol 78, 24 925 7 14 Verschuur, A.C., Van Gennip, A.H., Leen, R., Voute, P.A., Brinkman, J & Van Kuilenburg, A.B (20 02) Cyclopentenyl 21 22 23 24 25 26 27 28 29 30 31 32 cytosine increases the phosphorylation ... CTPS in the absence of nucleotides and in the presence of ATP and UTP were 1 23 and 25 1 kDa, respectively These values are similar to the predicted values of 122 and 24 5 kDa, based on the amino ... cleavage of R 429 A at Lys187 was suppressed and only the 10- and 53 kDa fragments were formed because of slow cleavage at Lys 4 32 (Fig 3C) Limited proteolysis of the double mutant (R 429 A/K 4 32 A) in the...

12
370
0

IDENTIFICATION OF NOVEL SMALL MOLECULE INHIBITORS OF PROTEINS REQUIRED FOR GENOMIC MAINTENANCE AND STABILITY

Ngày tải lên : 24/08/2014, 11:28

... 34 2. 2 Materials and methods 35 2. 2.1 Materials 35 2. 2 .2 Chemicals 36 2. 2 .3 DNA Substrates 36 2. 2.4 RPA Purification 37 2. 2.5 High-Throughput ... 79 3. 2. 2 In Silico Docking 79 3. 2 .3 Purification of the AB Region of RPA 80 3. 2. 4 XPA Purification 81 3. 2. 5 EMSA Analysis of AB Region of RPA p70 82 3. 2. 6 Preparation ... Preparation of 1 ,2 Cisplatin Damaged DNA 82 3. 2. 7 EMSA Analysis of W361A and WT RPA Binding to DNA 83 3 .2. 8 EMSA Analysis of WT and W361A RPA with TDRL-505 84 3. 2. 9 ELISA Analysis of RPA-XPA...

147
286
0

Báo cáo y học: "Human T-cell leukemia virus type 2 post-transcriptional control protein p28 is required for viral infectivity and persistence in vivo" ppt

Ngày tải lên : 13/08/2014, 05:20

... http://www.retrovirology.com/content/5/1 /38 Table 1: Detection of HTLV -2 sequences in PBMCs from inoculated rabbitsa Weeks Post Inoculation Inoculum and Rabbit 729 .HTLV -2 R27 R28 R29 R30 R31 R 32 729 .HTLV -2 p28 R20 R21 R 22 R 23 R24 R25 ... Nature 1985, 31 8:571-574 Page 10 of 11 (page number not for citation purposes) Retrovirology 20 08, 5 :38 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 Felber BK, Paskalis H, Kleinman-Ewing ... Clone 100 Clone 20 0 Clone 30 0 Clone p19 (pg/ml) 700 729 B 729 729 HTLV -2 729 HTLV -2 729 .HTLV -2 Tax -2 -actin 1.7E+0 6.5E +3 2. 1E +3 } Copies p28 mRNA Figure permanent of p19 Gag and Expression transfectants...

11
277
0

Tài liệu A junk-free childhood 2012 - The 2012 report of the StanMark project on standards for marketing food and beverages to children in Europe pptx

Ngày tải lên : 18/02/2014, 21:20

... reported 20 05 Q1 1, 031 58 111 1,618 26 4 4 62 23 20 11 Q1 6 73 32 1 53 1,018 199 434 29 3, 567 2, 538 Change - 35 % - 45 % + 38 % - 37 % - 25 % -6% + 26 % - 29 % 45 EU Pledge 20 11 Monitoring Report Online ... Yes 33 Yes34 Yes34 Yes34 Yes34 Yes34 Yes34 Yes Yes 42 Yes34 Yes34 Yes34 Yes34 Yes Yes Yes Yes Yes Yes44 No Yes44 Yes34 32 See http://www.conar.org.br/html/livro/REF49NESTLE %20 - %20 EU %20 Pledge %20 Nestle %20 Commitment.pdf ... 30 Based on Fererro’s nutrition criteria for energy content 31 Yoplait in Europe is distributed by Yoplait France, a subsidiary of General Mills 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 ...

32
896
0

Báo cáo khoa học: Amino acids at the N- and C-termini of human glutamate carboxypeptidase II are required for enzymatic activity and proper folding pptx

Ngày tải lên : 07/03/2014, 15:20

... and conditioned media, and the results are summarized in Fig and Table 2, respectively Of the 13 variants, only 27 4/587 (the putative catalytic domain) and 27 4/750 (the polypeptide spanning the ... NaCl and 20 lL of the GCPII sample, were preincubated for 15 at 37 °C in a ﬁnal volume of 22 5 lL A 25 lL mixture of 950 nM ÔcoldÕ NAAG (Sigma) and 50 nM H-labelled NAAG (51.9 CiÆmmol)1; New England ... of the residues identiﬁed are situated within the segment spanning Arg2 12 to Arg 538 , i.e the putative catalytic domain (domain E) and the D domain of rat GCPII The contribution of domains C and...

9
414
0

The 2000-2005 World Outlook for Program Administration and Net Cost of Private Health Insurance pdf

Ngày tải lên : 16/03/2014, 00:20

... 19 20 20 21 21 22 22 23 23 24 24 25 25 26 26 27 27 28 28 29 29 30 30 31 31 32 32 20 02 Icon Group Ltd Contents 2 .36 2 .37 2 .38 2 .39 2. 40 2. 41 2. 42 2. 43 2. 44 2. 45 2. 46 2. 47 2. 48 2. 49 2. 50 2. 51 2. 52 ... AND NET COST OF PRIVATE HEALTH INSURANCE 14 2. 1 2. 2 2 .3 2. 4 2. 5 2. 6 2. 7 2. 8 2. 9 2. 10 2. 11 2. 12 2. 13 2. 14 2. 15 2. 16 2. 17 2. 18 2. 19 2. 20 2. 21 2. 22 2. 23 2. 24 2. 25 2. 26 2. 27 2. 28 2. 29 2 .30 2 .31 2 . 32 ... Globe 1995 1996 1997 1998 1999 20 00 20 01 20 02 20 03 20 04 20 05 1 43 139 133 135 1 42 148 154 160 166 1 72 178 2 .36 % 2 .33 % 2 .31 % 2. 28% 2. 25% 2. 23 % 2. 25% 2. 28% 2 .30 % 2 .33 % 2 .35 % 0.00% 0.00% 0.00% 0.00%...

127
316
0

Báo cáo khoa học: Crystal structure of the parasite inhibitor chagasin in complex with papain allows identiﬁcation of structural requirements for broad reactivity and speciﬁcity determinants for target proteases pptx

Ngày tải lên : 16/03/2014, 04:20

... area Angle of approach s 798 122 1 7 .2 137 3 2 .3 9 72 11 .3 922 5.8 0 .38 (99) 0 .37 (1 02) c 1.15 (29 4) e 1 .30 (1 93) ch 0 .37 (101) c 1.19 (2 93) e 1 .35 (190) ch 0. 52 (107) [24 .1%] c 1.19 (30 0) e 1.00 ... code X 13, EMBL Hamburg 0.8086 100 I 422 a = 99.1, c = 159.5 60.0–1.86 (1. 93 1.86)a 35 0 034 33 2 63 98.4 (88.8) 10.5 (6.8) 22 .2 (2. 1) 0.090 (0.557) 0. 028 (0.191) 31 568 ⁄ 1694 16.4 ⁄ 20 .8 25 61 ⁄ 29 8 ... (191) [35 .8%] 1.10 (1 92) [37 .7%] 0.55 (101) 0.54 (105) 0.48 (100) 0. 52 (1 03) c 1.16 (34 8) e 0.54 ( 23 3 ) ch 0.46 (100) 1 .38 (198) Form II c 1 .25 (30 1) e 1 .28 (198) ch 0. 43 (1 02) c 1.55 (30 0) e 1 .31 ...

14
517
0

Báo cáo khoa học: The sulfur atoms of the substrate CoA and the catalytic cysteine are required for a productive mode of substrate binding in bacterial biosynthetic thiolase, a thioester-dependent enzyme doc

Ngày tải lên : 16/03/2014, 04:20

... 4 .3 5 .3 3.8 3. 3 3. 5 2VTZ SPP 4.1 4.9 4 .3 3.8 3. 8 4.6 3. 4 3. 6 3. 9 4.9 5.1 2VU2 OPP 5 .2 6 .2 7.6 6.5 6 .2 7.4 6 .2 4.4 3. 2 3. 5 5.1 2VU1 CoA 3. 8 5 .2 3. 9 3. 2 3. 6 4.4 3. 7 4.1 4.5 4.9 5 .3 2VU0 CoA 4 .2 ... 148.8 90, 92. 7, 90 20 2 .30 (2. 40 2 .30 ) 15.6 (4.8) 97 .2 (86.1) 6.8 (26 .6) 3. 5 (2. 7) 30 P21 84 .2, 79.6, 148.9 90, 92. 1, 90 20 2. 07 (2. 20 2. 07) 9.5 (4.5) 93. 9 ( 83. 6) 10.0 ( 23 . 2) 2. 8 (2. 2) 25 P21 84.4, ... 79.0, 148.8 90, 93. 0, 90 23 . 1 28 .6 0.011 1 .2 1.0 ,2. 0 21 .6 24 .9 0.014 1.4 1.5,1.7 19.4 22 .9 0.018 1.6 1.4 ,2. 7 22 .2 26 .2 0.009 1.1 0.7,1 .3 16.1 21 .2 0.014 1.4 1.9 ,2. 9 2vu2 2vu1 2vu0 2vtz 1ou6

13
472
0

Báo cáo khoa học: Characterization of recombinant forms of the yeast Gas1 protein and identiﬁcation of residues essential for glucanosyltransferase activity and folding pot

Ngày tải lên : 16/03/2014, 18:20

... Production and characterization of Gas1p (Eur J Biochem 27 1) 36 37 RMGLN2 62 (5¢-TACAACCGTATTGAGAGAAGA AAAC -3 ), and a pairing of the forward primer FMGLN2 62 (5¢-GTTTTCTTCTCTCAATACGGTTG TA -3 ) and reverse ... (Stratagene) For Gas1E262Q-H, the temperature of the annealing step was 62 °C with primers XHup and RMGLN2 62, and 57 °C with primers FMGLN2 62 and His-XHdown The mutations of interest are located in the ... Wolf, D.H (20 03) New EMBO member’s review: for whom the bell tolls: protein quality control of the endoplasmic reticulum and the ubiquitin-proteasome connection EMBO J 22 , 23 0 9– 23 1 7 23 Liu, C.Y...

11
435
0

Báo cáo sinh học: " Open Access Cloning of the canine RNA polymerase I promoter and establishment of reverse genetics for influenza A and B in MDCK cells" docx

Ngày tải lên : 18/06/2014, 18:20

... TCCCTGTCCTCGCTCGCTGGAGCCTGAGCCGTCCGCCTGGGCCTGCGCGCCGGCTCTCGTGCTGGACTCCAGGTGGCCCGGGTCGCGGTGTCGCCCTCCGGTCTCCGGCACCCGAGGGAGGGCGGTGT PrimEx (21 07) canus fam EcoRI BamHI (20 65) pK9 Pol I EB (20 72) Consensus (21 07) 21 07 21 20 2 130 21 40 21 50 21 60 21 70 21 80 21 90 22 00 22 10 22 20 2 23 4 GGGCAGGTGGCGGTGGGTCTTTTACCCCCGTGCGCTCCATGCCGTGGGCACCCGGCCGTTGGCCGTGACAACCCCTGTCTCGCAAGGCTCCGTGCCGCGTGTCAGGCGTCCCCCGCTGTGTCTGGGGT ... A/Wisconsin/67 /20 05 (H3N2), A/California/7 /20 04 (H3N2), A/Panama /20 07/1999 (H3N2), A/Hong Kong /2 13/ 20 03 (H5N1), A/Hong Kong/1997(491 H5/486 N1), A/Vietnam/ 12 03/ 20 04 (H5N1), A/Teal/HK/W3 12/ 1997 (H6N1), ... isolates of the H6N1, H7N3 and H9N2 subtypes (Table 2) The wt virus which was the source of the HA and NA for the H6N1 reassortant was isolated from teal and contains seven segments (NA, PB1, PB2,...

12
567
0

Báo cáo hóa học: " Cloning of the canine RNA polymerase I promoter and establishment of reverse genetics for influenza A and B in MDCK cells" pdf

Ngày tải lên : 20/06/2014, 01:20

... TCCCTGTCCTCGCTCGCTGGAGCCTGAGCCGTCCGCCTGGGCCTGCGCGCCGGCTCTCGTGCTGGACTCCAGGTGGCCCGGGTCGCGGTGTCGCCCTCCGGTCTCCGGCACCCGAGGGAGGGCGGTGT PrimEx (21 07) canus fam EcoRI BamHI (20 65) pK9 Pol I EB (20 72) Consensus (21 07) 21 07 21 20 2 130 21 40 21 50 21 60 21 70 21 80 21 90 22 00 22 10 22 20 2 23 4 GGGCAGGTGGCGGTGGGTCTTTTACCCCCGTGCGCTCCATGCCGTGGGCACCCGGCCGTTGGCCGTGACAACCCCTGTCTCGCAAGGCTCCGTGCCGCGTGTCAGGCGTCCCCCGCTGTGTCTGGGGT ... A/Wisconsin/67 /20 05 (H3N2), A/California/7 /20 04 (H3N2), A/Panama /20 07/1999 (H3N2), A/Hong Kong /2 13/ 20 03 (H5N1), A/Hong Kong/1997(491 H5/486 N1), A/Vietnam/ 12 03/ 20 04 (H5N1), A/Teal/HK/W3 12/ 1997 (H6N1), ... isolates of the H6N1, H7N3 and H9N2 subtypes (Table 2) The wt virus which was the source of the HA and NA for the H6N1 reassortant was isolated from teal and contains seven segments (NA, PB1, PB2,...

12
627
0

Báo cáo khoa hoc:"Association of a missense mutation in the bovine leptin gene with carcass fat content and leptin mRNA levels" pps

Ngày tải lên : 09/08/2014, 18:21

... eijk is the trait measured on the individual bull, is the overall mean for the trait, is the effect of the i-th breed (i = 1, 2, 3, 4), is the effect of the j-th SNP genotype within the i-th ... exon and ve SNPs were found in exon All of these SNPs except for one located 73 bp from the start of exon 2, and another located 95 bp from the start of exon 3, were at silent codon positions and ... glyceraldehyde3-phosphate dehydrogenase complementary DNA: Polymerase chain reaction Leptin SNP correlated with fat and mRNA levels [ 12] [ 13] [14] [15] [16] [17] [18] [19] [20 ] [21 ] [22 ] [ 23 ] [24 ] [25 ] [26 ]...

12
321
0

báo cáo khoa học: "Studies on dairy production of milking ewes I. - Estimates of genetic parameters for total milk composition and yield " pptx

Ngày tải lên : 09/08/2014, 22:22

... III from the subsample of the 7 63 daughters of the 1 02 young rams The model included the effects of year x flock, month and age at lambing as fixed, and of young ram as random by In the three ... of genetic parameters for milk and fat yield for the first three lactations in British Friesian cows Anim Prod., 38 , 31 3 - 32 2 EYER M K., 1985 Genetic parameters for Livest Prod Sci., 12, 20 5 -21 9 ... a range of to 12 sires The same pattern was observed for proven rams with 33 daughters from sires on average, while 20 of them were born from some of the 27 best-represented rams in the data...

16
193
0

Code of Standard Practice for Steel Buildings and Bridges Part 2 pdf

Ngày tải lên : 10/08/2014, 11:21

... or delay the work of the Fabricator and the Erector 1.8 Means, Methods and Safety of Erection 1.8.1 The Erector shall be responsible for the means, methods and safety of erection of the Structural ... indication of the presence of a weld or welds on the side of the member opposite the weld Code of Standard Practice for Steel Buildings and Bridges, March 7, 20 00 AMERICAN INSTITUTE OF STEEL CONSTRUCTION ... absence of other design criteria, the provisions in the AISC Specification shall govern the design of the Structural Steel For bridges, in the absence of other design criteria, the provisions in the...

9
392
1

báo cáo khoa học: " The evolution of the Global Burden of Disease framework for disease, injury and risk factor quantification: developing the evidence base for national, regional and global public health action" pps

Ngày tải lên : 11/08/2014, 18:20

... 486 85 520 22 .0 9.4 20 089 8 72 4 .2 1.7 21 9 575 93 3 92 15.9 6.8 095 038 774 129 918 991 100 568 2. 2 6.0 1.5 2. 2 5.8 3. 9 0 .2 1.1 27 6 02 26 21 7 19 28 7 22 4 93 18 665 11 35 3 634 625 3. 0 2. 9 2. 1 2. 5 1.9 ... Measles Road traffic acc Congenital anom 1 128 98 99 633 9 23 1 3 50810 46699 38 5 23 38 426 36 520 34 317 32 921 8 .2 7 .2 6.7 3. 7 3. 4 2. 8 2. 8 2. 7 2. 5 2. 4 Source Murray and Lopez (10) Chronic obstructive pulmonary ... assessments in the health sector: disease burden, http://www.globalizationandhealth.com/content/1/1/5 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 expenditures and intervention...

8
381
0

báo cáo khoa học: " The first set of EST resource for gene discovery and marker development in pigeonpea (Cajanus cajan L.)" ppsx

Ngày tải lên : 12/08/2014, 03:21

... 2, 750 (60 .3% ) 2, 865 (56 .3% ) Cowpea (Vigna unguiculata) (1 83, 757) 1, 23 0 (37 .0%) 817 ( 62. 4%) 1,988 ( 43. 6%) 2, 215 ( 43. 5%) Medicago (Medicago truncatula) (24 9, 625 ) 1 ,21 4 (36 .6%) 8 03 (61 .3% ) 1,9 63 ... 1,9 63 ( 43. 0%) 2, 1 53 ( 42 .3% ) Lotus (Lotus japonicus) (1 83, 1 53) 1,015 (30 .6%) 1 ,20 2 (36 .2% ) 1,768 ( 53. 3%) 1 72 (5.1%) 39 (1.1%) 738 (56.4%) 784 (59.9%) 1,001 (76.5%) 156 (11.9%) (0 .3% ) 1,698 (37 .2% ) ... ESTs of all model plant species 9 13 (27 .5%) 810 (24 .4%) 9 82 (29 .6%) 1,161 (35 .0%) 635 (19.1%) 667 (50.9%) 520 (39 .7%) 678 (51.8%) 7 63 (58 .3% ) 460 (35 .1%) 1, 536 (33 .7%) 1 ,29 4 (28 .3% ) 1,617 (35 .4%)...

22
365
0

Báo cáo sinh học: "A study on the minimum number of loci required for genetic evaluation using a ﬁnite locus model" pptx

Ngày tải lên : 14/08/2014, 13:22

... generations, no loops and will be referred to as the extended pedigree 4 03 Number of loci in finite locus models 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 * 32 * 33 * 34 * Figure Inbred ... The first 4 02 L.R Totir et al 10 11* 12* 13* 14* Figure Simple Pedigree Genetic evaluations were obtained for individuals marked by * 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 ... (q − p) ]2 + 2npq[a + d2 (q − p) ]2 a (9) 2 = n(2pqd1 )2 + n(2pqd2 )2 , d where n = N ; a is the genotypic effect of one of the homozygotes at the N loci; p is the frequency of one of the two alleles...

20
346
0

the identification and characterization of proteins required for endocytosis in the budding yeast saccharomyces cerevisiae

Ngày tải lên : 14/11/2014, 06:20

188
262
0

Rice Land Designation Policy in Vietnam and the Implications of Policy Reform for Food Security and Economic Welfare

Ngày tải lên : 08/08/2015, 19:23

... Dwellings 20 15 0.48 0.01 -0. 13 0.17 0 .26 0.06 0.14 20 20 0.40 0. 03 -0.06 0.18 0.11 0.06 0. 23 20 25 0 .31 0.06 -0.05 0. 13 0. 03 0.05 0. 13 2 030 0 .26 0.08 -0. 02 0. 12 0. 03 0.05 0. 03 Table Basic price of seven ... -4.7% 2. 09 1.951 -6.7% 2. 2 52 2.0 93 -7.1% 2 .38 8 2. 2 13 -7 .3% Food cover index Level in the baseline scenario Level in the policy scenario Percentage deviation (policy vs baseline) 2 . 32 9 2 . 32 9 0% 2 .37 5 ... (20 03) Land Law No 13/ 20 03/ QH11, Hanoi, 26 November 20 03 33 National Assembly (20 06) Resolution No 57 /20 06/NQ-QH11 on five-year land use plan for the period 20 06 -20 10 for the country, Hanoi, 29 ...

43
387
0

Modification of polymeric membranes for energy sustainability and CO2 capture 2

Ngày tải lên : 09/09/2015, 11:22

... diameter and critical temperature of gases Gas Kinetic diameter (Å) Critical temperature (K) H2 2. 89 33 .2 O2 3. 46 154.6 N2 3. 64 126 .2 CO2 3. 3 30 4 .2 CH4 3. 8 190.6 23 C2H6 - 30 5 .3 C3H6 4.5 36 5 .2 C3H8 ... parameters of glassy polymers 2 .3. 2. 1 Sorption…………………………………………… 18 2 .3. 2. 2 Diffusion…………………………………………… 20 2 .3. 2 .3 Permeability………………………………………… .21 2 .3. 2. 4 Selectivity………………………………………… 22 2 .3. 3 Effect of ... relationship…………………………… .25 2 .3. 5 .2 Plasticization……………………………………… 27 2 .3. 5 .3 Physical aging……………………………………… 27 2 .3. 6 Modification methods……………………………………… 28 2 .3. 6.1 Search for better materials………………………… 28 2 .3. 6 .2 Cross-linking...

157
294
0