... GAAGGAGATATACATATGGTTAGCATAAAAA GGTAAGTTTGTCATCATTGGATCCTCCTATTGTAAT TTGTCCACAGGGATCCTTTGTCATCATTTTTGT CAAGCTCTCCAACATATGGGTTATATTCCTGAA CTTGCGGCCCCATGTTATGCGGATCCTAAAAAGGTAGA CAAACAATACTAAAGGATCCGGAGTTAGCATAAAAA ... University of Delaware, Newark, DE Rajesh R Naik Materials and Manufacturing Directorate, Air Force Research Lab, Wright-Patterson Air Force Base, OH Ruth Nussinov Center for Cancer Research Nanobiology ... spiders (Araneae, Araneidea) J Arachnol 15 , 6580 12 Lombardi SL, Kaplan DL (19 90) The amino acid composition of major ampullate gland silk (dragline) of Nephila clavipes (Araneae, Tetragnathidae)...
... Figure 12 The percentage of individual group B soyasaponins in reflux (RE) and room temperature (RT) extracts (Refer to Table for mass spectral data) Bars with an asterisk (*) are significantly ... are also called protein kinases B (PKB) plays an important role in mammalian cellular signaling Ara: α-L-arabinopyranosyl B16F10: Murine melanoma cancer cell line BrdU: Bromodeoxyuridine BSA: ... structure, overlap polarities, artifacts (Zhang and Popovich 200 9) and labor intensive purification, isolation and analysis of these compounds (Kitagawa, Yoshikawa et al 19 82; Shiraiwa, Harada...
... PCR To portray rat VRL -1 in overlapping PCR fragments in F -11 cells PCR primers were designed according to the rat VRL -1 sequence (Acc No AF12 911 3) rVRL -1 34F: 5¢-CTGGAGACTTCCGATGGAGA-3¢ and rVRL -1 56 8R: ... Rat vanilloid receptor like-protein (rVRL -1) was cloned from total rat brain cDNA Reverse-transcription polymerase chain reaction (RT-PCR) was carried out with specific rVRL -1 forward and reverse ... 200 3 Fig Graphical alignment of the open reading frames of rat VRL -1 (Acc No AF12 911 3) and mouse VRL -1 (Acc No NM_ 011 706) Rat and mouse VRL -1 cDNA share a homology of 92% The ORF length of rat...
... Mueller, A Bohrer, and S Ramanadham, Biochim Biophys Acta 11 25, 280-2 91 (19 92) 11 0 R. J Konrad, Y C Jolly, C Major, and B A Wolf, Mol Cell Endocrinol 92, 13 5 -14 0 (19 93) 11 1 S Ramanadham, R Gross, and ... Wohltmann, A Bohrer, F.-F Hsu, and J Turk, J Biol Chem 276, 13 198 -1 3208 (200 1) 12 0 S Ramanadham, Z Ma, H Arita, S Zhang, and J Turk, Biochim Biophys Acta 13 90, 3 013 12 (19 98) 12 1 I Kudo, M Murakami, ... arachidonate incorporation into cellular PC, although it appears to so in murine P388D1 macrophage-like cells (11 7, 13 3) These cells, however, exhibit some atypical features of arachidonate incorporation...
... Berlin, 19 64 [5] O Cornea, G Lupton, J Oprea, and D Tanr´ , Lusternik-Schnirelmann Category, Mathematical e Surveys and Monographs, vol 10 3, American Mathematical Society, Rhode Island, 200 3 ´ ... invariants, Fundamenta Mathematicae 18 4 (200 4), 18 7 203 [10 ] , Selfcoincidences in higher codimensions, Journal f¨ r die Reine und Angewandte Matheu [11 ] matik 576 (200 4), 1 10 , Nielsen coincidence ... Poincar´ dual of the cohomological primary obstruction to deforming f1 and f2 away from one another (cf [8, 3.3]); they are related by the natural forgetful maps μ p∗ stabilize − → − → Ω# f1...
... Hospital, University of Toronto, Ontario, Canada Authors’ contributions AG analyzed and interpreted data regarding our patient’s endocrine disease and hypercalcemia HA analyzed and interpreted data ... malignant lymphoma Internal Medicine 19 92, 31: 968-972 10 Hanihara T, Takahashi T: Parathyroid hormone-related protein-associated hypercalcemia in probable intravascular lymphoma of B-cell type Am ... Hematol 19 96, 53 :14 4 -14 6 11 Ranganath L, Jamal H, Jones L, et al: Value of assessing parathyroid hormone-like activity in a case of extreme hypercalcaemia J Clin Pathol 19 98, 51: 257-258 12 Daroszerski...
... Barre A, Goffard N, DeDaruvar A: AliasServer: a web server to handle multiple aliases used to refer to proteins Bioinformatics 200 4, 20: 23 31- 2332 AliasServer [http://cbi.labri.fr/outils/alias/index.php] ... constructed for extracting annotations of genes and proteins automatically and for detecting protein-protein interactions and regulatory pathways Protein-protein interactions have attracted particular interest ... [http://search.nature.com/search/?sp _a= sp10 017 02d&sp_t=advanced &sp_x _1= ujournal&sp-p=all&sp] Staab S, Blaschke C, Nedellec C, Park J, Schatz B, Valencia A, Bernardi L, Ratsch E, Kania R, Saric J, Rojas I, Staab S:...
... required to temporarily stay at home from work,” (F (1, 1 71) = 3. 515 , p < 05) Respondents who were health care workers or had family members or friends that were health care workers agreed more with ... the original categories being Caucasian, African-American, Asian, and Other, however, because the number of respondents in the categories Asian and Other were low, they were combined and placed ... nominal demographic scale measures Quarantine Preference RQ 5a asks, “What are students’ quarantine preferences?” To answer this question respondents were asked, “If there were a major outbreak of...
... Acknowledgements Sincere thanks and gratitude to Prof Raghunath, Prof Rajagopalan, Dr Ricky Lareu, Dr Andrew Thomson, Prof Jiang, Dr Dimitrios Zeugolis, and all members of the TML team, Irma ... vitro Cell Culture 89 11 .1 Rationale and Aims 89 11 .1. 1 Collagen Biosynthesis 89 11 .1. 2 Hypotheses 91 11. 2 Experimental Design, Readouts and Interpretation 92 11 .3 Materials and Methods 92 11 .4 ... Zeta-(ȗ)-potential was expressed as the mean of 10 readings and tabulated with the standard error of mean 31 8.4 Results 8.4 .1 Charged Macromolecules have Significantly Larger Hydrodynamic Radii...
... in China (~52 per age standardized 10 0,000 population) Other areas of high incidence rate are Central Africa (~ 41 per age standardized 10 0,000 population), Japan (~ 31 per age standardized 10 0,000 ... Post-transcriptional gene silencing RARS Arginyl-tRNA Synthetase Gene RdRP RNA-dependent RNA polymerase RFA Radiofrequency ablation RISC RNA-induced silencing complex RNAi RNA interference SG Stress ... that miRNA profiling might aid in cancer diagnosis and understanding of miRNA function in cancers may provide therapeutic targets Keywords: Short interfering RNA, microRNA, hepatocellular carcinoma,...
... (SRA Datasets B taurus, 2 01 4) SRA experiments (NGS data) In case of S scrofa, there are 8,848 GEO datasets (GEO Datasets S scrofa, 2 01 4) and 1, 966 SRA experiments (SRA Datasets S scrofa, 2 01 4) ... STRING (Szklarczyk et al., 2 01 1) database, gene target transcription factor information from TRANSFAC (Matys et al., 200 6) and miRNA-target information from PICTAR (Chen and Rajewsky, 200 6; Samur ... analysis The term ‘differential expression analysis’ is used to indicate a broad range of statistical approaches from standard R/ Bioconductor packages for microarray/RNA-seq expression data analysis...
... colonies recovered compared with a single temperature reaction at 14 °C It seems that rather than performing the reaction for 12 16 h, a cycling reaction for 10 0 cycles can achieve similar increased ... to recreate attB1 13 0 PCR att P1 att P2 pDONOR PCR product + Target sequence att B1 att B2 BP clonase reaction to create entry clone Target sequence att R1 att R2 pDEST Target sequence att L1 att ... EF, Maniatis T (19 81) Molecular Cloning: A Laboratory Manual (2nd edition) Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY Vogelstein B, Gillespie D (19 79) Preparative and analytical...
... specificity of Nile tilapia anserinase is broader than that of rainbow trout anserinase Molecular cloning of anserinase and CNDP-like protein Database search Initially we searched for a candidate for anserinase ... heart of rainbow trout Salmo gairdneri Comp Biochem Physiol 97B, 539–5 41 Yamada S, Tanaka Y & Furuichi M (19 95) Partial purification and characterization of histidine acetyltransferase in brain ... degenerate primers for PCR amplification (data not shown) Cloning of anserinase cDNA PCR was performed using a set of primers (A and B) and the first-strand cDNA for 3¢ rapid amplification of cDNA ends...
... Address 21. 2 Figure 21. 1 ARP operation 21. 3 Figure 21. 2 ARP packet 21. 4 Figure 21. 3 Encapsulation of ARP packet 21. 5 Figure 21. 4 Four cases using ARP 21. 6 Note An ARP request is broadcast; an ARP reply ... address allocation that can be manual or automatic 21. 12 21- 2 ICMP The IP protocol has no error-reporting or errorcorrecting mechanism The IP protocol also lacks a mechanism for host and management ... Figure 21. 9 Error-reporting messages 21. 16 Note Important points about ICMP error messages: ❏ No ICMP error message will be generated in response to a datagram carrying an ICMP error message...
... Moringa oleifera seeds African Journal of Agricultural Research, 5 (11 ): 12 56 -12 6 Raja G, Venkatesan P 2 01 0 Assessment of groundwater pollution and its impact in and around Punnam Area of Karur ... Filters-Early Water Treatment200 From (Retrieved March 20, 200 9) Home Pageof Mining and Water Pollution 2 011 From ... 40-43 Harter T 200 3 Reference: Groundwater Quality and Groundwater Pollution, University of California Division of Agriculture and Natural Resources Publication 8084 Home Pageof History of Water...