2 yêu cầu về các chỉ tiêu kỹ thuật của bê tông nhựa polime

How to make your classroom more dynamic

... of Professional ELT Development British Council, Thailand For VTTN Conference 8th – 9th December 20 06 What is this? Destroy the order! Increasing interaction • Ask five people… – How long they...

35
365
0

Contributions of Various Noncovalent Bonds to the Interaction between an Amide and S-Containing Molecules

Danh mục:

... 0. 62 4.57 3f 4. 52 CHbãããO CHaãããpCO p*COãããS CHãããpCO 0.96 0.80 0.55 2. 26 3g 4.50 2. 75 2. 35 1.49 1.00 0.98 2. 82 2.19 1.67 1.86 1 .27 1.87 3.59 3.44 3.80 3.59 3.98 8.73 1.05 1.05 0.91 7.37 2. 17 ... Phys 20 11, 13, 14076 14091 [11] S J Grabowski, J Phys Chem A 20 11, 115, 127 89 127 99 [ 12] A Karpfen, A J Thakkar, J Chem Phys 20 06, 124 , 22 4313 [13] N G Mirkin, S Krimm, J Phys Chem B 20 08, 1 12, ... Soc 20 02, 124 , 24 97 25 05 [26 ] T K Pal, R Sankararamakrishnan, J Phys Chem B 20 10, 114, 1038 1049 [27 ] C E Jakobsche, A Choudhary, S J Miller, R T Raines, J Am Chem Soc 20 10, 1 32, 6651 6653 [28 ]...

7
450
0

Conceptualizing the interaction of class and gender

Danh mục: TOEFL - IELTS - TOEIC

... different sorts of gender locations, and class may in¯uence where people end up in such relations 122 Class counts the labor force have very different occupational and class distributions, and most ... represented in the following equation: Consciousness = a + B1(Class) + B2(Gender) + B3(Class6Gender) The coef®cients B1, B2, and B3 indicate something about the magnitude of the effects of each ... on plant growth; the effects are entirely a function of the amount of the 124 Class counts ``interaction'' compound, H2O If class and gender behaved this way then perhaps it would be useful to...

10
394
0

Tài liệu Module 1: Setup Changes pdf

Danh mục: Quản trị mạng

... Saved: 7 /24 /20 03 1:55 AM Last Printed: 7 /24 /20 03 12: 55 PM Module 1: Setup Changes 35 property sheets on Exchange 20 03 servers Last Saved: 7 /24 /20 03 1:55 AM Last Printed: 7 /24 /20 03 12: 55 PM 36 ... halt the deployment Last Saved: 7 /24 /20 03 1:55 AM Last Printed: 7 /24 /20 03 12: 55 PM 30 Module 1: Setup Changes Last Saved: 7 /24 /20 03 1:55 AM Last Printed: 7 /24 /20 03 12: 55 PM Module 1: Setup Changes ... {1E51 928 5-D987-42C8-BE358DC57F85F270} Convert the GUIDs from string to Hex format In the above example, {1E51 928 5-D987-42C8-BE35-8DC57F85F270} becomes \85\ 92\ 51\1E\87\D9\C8\ 42\ BE\35\8D\C5\7F\85\F2\70...

78
379
0

Tài liệu Module 1: Setup Changes pptx

Danh mục: Quản trị mạng

... Saved: 7 /24 /20 03 1:55 AM Last Printed: 7 /24 /20 03 12: 55 PM Module 1: Setup Changes 35 property sheets on Exchange 20 03 servers Last Saved: 7 /24 /20 03 1:55 AM Last Printed: 7 /24 /20 03 12: 55 PM 36 ... halt the deployment Last Saved: 7 /24 /20 03 1:55 AM Last Printed: 7 /24 /20 03 12: 55 PM 30 Module 1: Setup Changes Last Saved: 7 /24 /20 03 1:55 AM Last Printed: 7 /24 /20 03 12: 55 PM Module 1: Setup Changes ... {1E51 928 5-D987-42C8-BE358DC57F85F270} Convert the GUIDs from string to Hex format In the above example, {1E51 928 5-D987-42C8-BE35-8DC57F85F270} becomes \85\ 92\ 51\1E\87\D9\C8\ 42\ BE\35\8D\C5\7F\85\F2\70...

78
364
0

Tài liệu Báo cáo khoa học: Characterization of the interaction between the plasma membrane H+-ATPase of Arabidopsis thaliana and a novel interactor (PPI1) doc

Danh mục: Báo cáo khoa học

... independent interaction in addition to the phosphorylation-dependent C-terminal end J Biol Chem 27 8, 422 66– 422 72 12 Jahn T, Fuglsang AT, Olsson A, Bruntrup IM, Collinge DB, Volkmann D, Sommarin M, Palmgren ... (20 05) 5864–5871 ª 20 05 FEBS C Viotti et al 22 23 24 25 26 of its mechanistic role in auxin effect on plant plasma membrane H+-ATPase J Biol Chem 27 6, 10730– 10736 Morandini P, Valera M, Albumi ... membrane H+-ATPase J Biol Chem 26 6, 20 470 20 475 28 Inoue H, Nojima H & Okayama H (1990) High efﬁciency transformation of Escherichia coli with plasmids Gene 96, 23 28 29 Markwell MAK, Haas SM, Bieber...

8
629
0

Tài liệu Báo cáo khoa học: Delineation of exoenzyme S residues that mediate the interaction with 14-3-3 and its biological activity ppt

Danh mục: Báo cáo khoa học

... GST-ExoS(LDL 426 – 428 AAA) GST-ExoS(DALDL 424 – 428 AAAAA) GST-ExoS(D 424 A; D 427 A) GST-ExoS(S419I) GST-ExoS(Q 420 A) 10 GST-ExoS(G 421 A) 11 GST-ExoS(L 422 A) 12 GST-ExoS(L 423 A) 13 GST-ExoS(D 424 A) 14 GST-ExoS(A 425 K) ... pGEXExoS(Q 420 A), pGEX-ExoS(G 421 A), pGEX-ExoS(L 422 A), pGEX-ExoS(L 423 A), pGEX-ExoS(D 424 A), pGEX-ExoS(A 425 K), pGEX-ExoS(L 426 A), pGEX-ExoS(D 427 A), pGEX-ExoS(L 428 A), pGEX-ExoS(D 424 A:D 427 A), pGEXExoS(LD 426 – 427 AA), ... GST-ExoS(L 426 A) 16 GST-ExoS(D 427 A) 17 GST-ExoS(L 428 A) 18 GST-ExoS(LD 426 – 427 AA) Amersham S419QGLLDALDL 428 M419AAAA 428 S419QGLLDAAAA 428 S419QGLLAAAAA 428 S419QGLLAALAL 428 I419QGLLDALDL 428 S419AGLLDALDL 428 ...

9
525
0

Tài liệu Báo cáo khoa học: Insights into the interaction of human arginase II with substrate and manganese ions by site-directed mutagenesis and kinetic studies Alteration of substrate speciﬁcity by replacement of Asn149 with Asp docx

Danh mục: Báo cáo khoa học

... 107–1 32 FEBS Journal 27 2 (20 05) 4540–4548 ª 20 05 FEBS ´ V Lopez et al Iyer RK, Kim HK, Tsoa RW, Grody WW & Cederbaum SD (20 02) Cloning and characterization of human agmatinase Genet Metab 75, 20 9 21 8 ... arginase II Moreover, the D2 32 (Od1)-Mn2+B FEBS Journal 27 2 (20 05) 4540–4548 ª 20 05 FEBS Interaction of arginase II with substrate and manganese ions ˚ separation of 2. 6 A was considered to be ... Biochim Biophys Acta 13 82, 23 27 20 Ouzounis CA & Kyrpides NC (1994) On the evolution of arginases and related enzymes J Mol Evol 39, 101–104 FEBS Journal 27 2 (20 05) 4540–4548 ª 20 05 FEBS Interaction...

9
651
0

Tài liệu Báo cáo Y học: Role of electrostatics in the interaction between plastocyanin and photosystem I of the cyanobacterium Phormidium laminosum ppt

Danh mục: Báo cáo khoa học

... ( 42. 7– 52. 5) (44.4–48.0) (47.9– 52. 9) (0.3– 42. 5) (7.3 28 .8) (2. 5–39.8) (22 .9–56.4) (30.5– 42. 9) ( 32. 4–49.6) a Buﬀer used contained 10 mM MgCl2 b Buﬀer contained no MgCl2; ionic strength was adjusted ... R93A R93Q R93E 7.1 12. 1 7.8 3.3 4.1 1.3 10.6 10.9 12. 4 5.9 7.0 8.5 10.0 11.7 12. 3 7.6 6.7 3.4 34.06 32. 66 33.74 36.00 35.45 38.37 40 .2 37.9 39.8 47.5 46 .2 50.4 20 .8 17.9 20 .7 39 .2 36.6 40.9 ± ± ± ... 0.5 0.5 0.1 0 .2 0.1 0.1 ± ± ± ± ± ± 0.5 2. 1 0.7 0.5 0.6 3.4 ± ± ± ± ± ± 0.7 0 .2 1.0 1.3 0.5 0.6 ± ± ± ± ± ± 0.08 0.06 0.08 0. 12 0.11 0. 12 (34 .2 46.5) (34.8–41.1) (34.5–45.4) ( 42. 7– 52. 5) (44.4–48.0)...

10
673
0

Báo cáo khoa học: Deﬁnition of the residues required for the interaction between glycine-extended gastrin and transferrin in vitro pptx

Danh mục: Báo cáo khoa học

... 22 0 20 0 180 160 140 120 100 80 60 40 20 – 12. 0 –6.0 22 0 20 0 180 160 140 120 100 80 60 40 20 – 12. 0 –6.0 22 0 20 0 180 160 140 120 100 80 60 40 20 – 12. 0 –6.0 Apo-transferrin –5.5 –5.0 –4.5 –4.0 Ggly ... 140 120 100 80 60 40 20 WT Ggly no N Ggly no C Ggly + Mo Mo C+ N+ WT no no Mo Mo Relative density (%) B Relative density (%) C Relative density (%) D 22 0 20 0 180 160 140 120 100 80 60 40 20 – 12. 0 ... observed using surface FEBS Journal 27 6 (20 09) 4866–4874 ª 20 09 The Authors Journal compilation ª 20 09 FEBS 4867 B 80 ApoTf 60 Gamide Ggly 40 20 20 –100 100 20 0 300 Time (s) 400 500 C D ApoTf...

9
543
0

Báo cáo khóa học: Disruption of the interaction between the Rieske iron–sulfur protein and cytochrome b in the yeast bc1 complex owing to a human disease-associated mutation within cytochrome b potx

Danh mục: Báo cáo khoa học

... aﬀects the mobility of the [2Fe2S] domain Biochemistry 40, 327 –335 Darrouzet, E., Valkova-Valchanova, M., Moser, C.C., Dutton, P.L & Daldal, F (20 00) Uncovering the [2Fe2S] domain movement in cytochrome ... site was fully occupied by quinone and that the environment of the Ó FEBS 20 04 129 8 N Fisher et al (Eur J Biochem 27 1) [2Fe)2S] cluster was not affected This argued in favour of an effect of the ... loading solution of 62. 5 mM Tris/HCl (pH 6.8), 0.01% (w/v) bromophenol blue, 25 % (v/v) glycerol, 2% (w/v) SDS, 5% (v/v) 2- mercaptoethanol, was added to each sample (1 : 2, v/v) The samples were...

7
498
0

Báo cáo khoa học: Structural and functional analysis of the interaction of the AAA-peroxins Pex1p and Pex6p pptx

Danh mục: Báo cáo khoa học

... CTCGTACGCTGCAGGTCGAC KU5 32 KU616 KU617 KU718 KU719 KU 123 3 KU 123 4 KU 123 5 KU 123 6 KU 123 7 KU1009 KU1010 KU1011 KU10 12 KU1130 KU1131 KU11 32 KU1133 fragments of pIB1 ⁄ (construct of PEX1 in pET21d) to plasmid ... SJ & Valle D (20 00) Peroxisome biogenesis disorders: genetics and cell biology Trends Genet 16, 340–345 FEBS Journal 27 2 (20 05) 47–58 ª 20 04 FEBS I Birschmann et al 12 Lazarow PB (20 03) Peroxisome ... WH & Tabak HF (20 03) Pex15p of Saccharomyces cerevisiae provides a molecular basis for recruitment of the AAA peroxin Pex6p to peroxisomal membranes Mol Biol Cell 14, 22 26 22 36 28 Erdmann R.,...

12
584
0

Báo cáo Y học: Inhibition of the SERCA Ca21 pumps by curcumin Curcumin putatively stabilizes the interaction between the nucleotide-binding and phosphorylation domains in the absence of ATP pot

Danh mục: Báo cáo khoa học

... 13.6 (13.4–14 .2) 10 3.0 (1.9–3.6) 2. 3 (1.3 2. 5) 0.40 (0 .24 –0. 42) 12. 1 (11.9– 12. 2) 25 7.0 (4.9–8.0) 2. 2 (1.8 2. 4) 0.40 (0 .23 –0.41) 5.1 (4.7–5 .2) q FEBS 20 01 Inhibition of the Ca2þ-ATPase by curcumin ... curcumin q FEBS 20 01 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 Inhibition of the Ca2þ-ATPase by curcumin (Eur J Biochem 26 8) 6 327 on protein kinase C activity induced by 12- O-tetradecanoylphorbol-13-acetate ... 6 322 J G Bilmen et al (Eur J Biochem 26 8) q FEBS 20 01 Fig The effects of Ca21 and ATP dependence of Ca21 ATPase activity by curcumin (A) Ca2þ-ATPase activity was measured as a function of [Ca2þ]free...

10
594
0

Báo cáo " Study on wave setup with the storm surge in Hai Phong coastal and estuarine region " pot

Danh mục: Báo cáo khoa học

... Sciences 26 (20 10) 82- 89 Table Significant wave height Time Hs(m) 7h, 24 /09 /20 05 13h, 24 /09 /20 05 19h, 24 /09 /20 05 7h, 25 /09 /20 05 13h, 25 /09 /20 05 19h, 25 /09 /20 05 7h, 26 /09 /20 05 13h, 26 /09 /20 05 19h, 26 /09 /20 05 ... areas Calculate Hs(m) 1.13 0.83 0.73 0.68 1.77 2. 48 3.18 4.11 4.53 3 .20 2. 29 1.18 Dir(0) 177 1 82 191 20 0 20 4 20 6 22 8 23 2 22 6 29 47 53 Tp(s) 5 11 9 3 .2 Results of wave-setup Table shows the results ... setup (cm) Hanslow & Nielsen 36 ,29 36,98 37 ,23 37,68 Gourlay 28 ,49 29 ,35 29 ,67 30 ,24 Raubenh-eimer 24 , 12 25,04 25 ,38 26 ,16 Hien et al (20 09), and between 16 and 24 percent of total surge in storm...

8
435
0

Experimental studies of the interaction

Danh mục: Môi trường

...

14
236
0

EUROPEAN COMPETITION LAW ANNUAL 2005: The Interaction between Competition Law and Intellectual Property Law doc

Danh mục: Cao đẳng - Đại học

... Experience under the European Merger Regulation 23 7 23 9 23 9 25 4 25 4 27 1 27 3 29 5 305 329 343 361 371 399 419 421 421 439 439 461 463 475 (A) Ehlermann 06 Prelims 2/ 3/07 09:38 Page xi Contents III IV V ... 110/88, 24 1/88 and 24 2/88, [1989] ECR 28 11 lii, 25 760, 26 2, 26 9, 359, 367, 374 82, 407, 649 G Basset v SACEM, Case 4 02/ 85, [1987] ECR 1747 lii, 25 9, 374, 381 GEMA v Commission Case 125 /78 [1979] ... cases/decisions/377 92/ en.pdf liii, 4, 6, 8, 17, 22 , 25 , 29 , 54, 59, 735, 81, 839, 111, 1 32, 135, 4403, 448, 451, 453, 456, 4589, 595, 616, 621 , 629 30, 6345, 64 02, 644, 6 52 MMS/DASA/Astrium, OJ C 28 5 [20 03]...

768
844
1

Báo cáo khoa học: Concerted mutation of Phe residues belonging to the b-dystroglycan ectodomain strongly inhibits the interaction with a-dystroglycan in vitro pot

Danh mục: Báo cáo khoa học

... Biol 1 42, 1461–1471 22 Zhu Z-Y & Blundell TL (1996) The use of amino acid patterns of classiﬁed helices and strands in secondary structure prediction J Mol Biol 26 0, 26 1 27 6 FEBS Journal 27 3 (20 06) ... After being washed with NaCl ⁄ Pi buffer (2. 5 mm KCl, mm KH2PO4, mm Na2HPO4, 140 mm NaCl, pH 7.4) containing 0.05% (v ⁄ v) Tween -20 , 1 .25 mm CaCl2 and mm MgCl2, wells were incubated with decreasing ... sx ⁄ ⁄ 50 ⁄ 25 FEBS Journal 27 3 (20 06) 4 929 –4943 ª 20 06 The Authors Journal compilation ª 20 06 FEBS 4933 Mutagenesis at the a–b dystroglycan interface M Bozzi et al Transfection of 29 3-Ebna cells...

15
337
0

Báo cáo khoa học: Mapping of the interaction site of CP12 with glyceraldehyde-3-phosphate dehydrogenase from Chlamydomonas reinhardtii Functional consequences for glyceraldehyde-3-phosphate dehydrogenase pot

Danh mục: Báo cáo khoa học

... 10 927 (1–100) 22 70 (1–18) 23 47 (46–68) (26 –48) 1 522 (74–87) (54–67) 991 (88–96) (68–76) 525 (97–100) (77–80) 5338 (19–69) 4060 (31–69) (11–49) 39 32 ( 32 69) ( 12 49) 29 99*, 3001 (74–100) (54–80) 24 93*, ... of GAPDH (s)1) Mass increment of CP 12 after IAA treatment (Da) Free sulfhydryl group on CP 12 238 ± 12 289 ± 21 316 ± 38 330 ± 24 390 ± 19 426 ± 28 0 114 ND 22 9 0 ND respectively However, when ... 3358–3369 ª 20 06 The Authors Journal compilation ª 20 06 FEBS 3361 Interaction site between GAPDH and CP 12 S Lebreton et al 500 1000 1500 20 00 29 99 (A74….D100) 22 70 .2 (His-tag + Ni) % Intensity 100 24 93,3...

12
330
0

Báo cáo khoa học: Calcium-induced contraction of sarcomeres changes the regulation of mitochondrial respiration in permeabilized cardiac cells doc

Danh mục: Báo cáo khoa học

... ATP4 ỵ Mg2ỵ $ MgATP2 ATPH3 ỵ Mg2ỵ $ MgATPH ADPH2 $ ADP3 ỵ Hỵ ADP3 ỵ Mg2ỵ $ MgADP ADPH2 ỵ Mg2ỵ $ MgADPH 7.68 )5.83 )3.59 7 .20 )4 .27 )2. 45 0.01 0.10 0. 12 0.01 0.10 0 .20 )1.68 5.10 2. 20 )1.37 ... including its effects on mitoFEBS Journal 27 2 (20 05) 31453161 ê 20 05 FEBS SF, 2. 0 àM Ca2+,+Cr 1,5 SF, 0.1 àM Ca2+ SF, 2. 0 àM Ca2+ 0,5 0 SF, 0.1 àM Ca2+,+Cr 2, 5 20 0 400 600 800 1000 ATP, àM Fig 11 The ... 8:74I ỵ 2: 04 Iị=1 ỵ 6: 02 Iị ặ 0:10 p p p 3:59 ỵ 4:06 I 6:36I ỵ 2: 04 Iị=1 ỵ 6: 02 Iị ặ 0: 12 p 7 :20 2: 54 I ỵ 3:84I ặ 0:04 p p p 4 :27 ỵ 4:06 I 6:36I ỵ 2: 04 Iị=1 ỵ 6: 02 Iị ặ 0:10 p p p 2: 45 ỵ 2: 03...

17
241
0

Báo cáo khoa học: Amino acid residues on the surface of soybean 4-kDa peptide involved in the interaction with its binding protein potx

Danh mục: Báo cáo khoa học

... 8. 02 7.43 9.44 D Fatty to alanine variants V12A V23A I25A L27A V29A I33A 1.13 6.03 2. 32 3.38 1.30 1.60 11.00 9.30 53.50 12. 30 129 .00 62. 70 97.30 15.40 23 1.00 36 .20 994.00 3 92. 00 11.40 1.80 27 .00 ... variants F10A F28A F31A 12. 20 0.36 1.10 3.47 12. 00 1 02. 00 2. 85 333.00 927 .00 0.333 38.90 108.00 C Polar to alanine variants N4A S8A H34A T36A 1.44 2. 01 3. 02 4.73 14.30 13.80 19 .20 38 .20 99.00 68.70 ... Chem 26 2, 120 54– 120 58 20 Mirmira, R.G., Nakagawa, S.H & Tager, H.S (1991) Importance of the character and conﬁguration of residues B24, B25, and B26 in insulin–receptor interactions J Biol Chem 26 6,...

10
420
0