2 definition of a muscle relaxant

Towards a definition of a business performance measurement system đo lường kết quả hoạt động kinh doanh

Towards a definition of a business performance measurement system đo lường kết quả hoạt động kinh doanh

Ngày tải lên : 17/04/2016, 12:25
... that this type of analysis has a random duplication effect This means that the citation of a paper in one database can be found in the other two databases; thus, the summary of citations per paper ... performance metrics – defining evaluation criteria and corresponding measures that will operate as leading indicators of performance against strategic goals and initiatives (2) Management process alignment ... setting; (2) “collection and manipulation of data” this category includes the processes of data capture and data analysis; (3) “information management” this category encompasses the processes of information...
  • 19
  • 631
  • 0
wordsearch 2 parts of a car

wordsearch 2 parts of a car

Ngày tải lên : 25/08/2016, 17:02
... English Banana.com Test Your Spelling Skills Wordsearch – Parts of a Car Answers: D S T H G I L D A E R G E A N N O R B H C H S U B E A R V I E W M I T L E B T A E S G A O T U L C I N ... N O S R A E G E O A P A S S E N G E R S E A T D L E E H W G N I R E E T S R For more fun tests, quizzes and games log onto www.englishbanana.com now! This worksheet can be photocopied and used ... games log onto www.englishbanana.com now! This worksheet can be photocopied and used without charge ...
  • 2
  • 127
  • 0
báo cáo hóa học:" Establishment of an animal model of a pasteurized bone graft, with a preliminary analysis of muscle coverage or FGF-2 administration to the graft" potx

báo cáo hóa học:" Establishment of an animal model of a pasteurized bone graft, with a preliminary analysis of muscle coverage or FGF-2 administration to the graft" potx

Ngày tải lên : 20/06/2014, 04:20
... Relat Res 1998 :24 2 -24 8 Page of 10 (page number not for citation purposes) Journal of Orthopaedic Surgery and Research 20 09, 4:31 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 Ahmed AR, Manabe ... Kawaguchi N, Matsumoto S, Matsushita Y: Radiographic analysis of pasteurized autologous bone graft Skeletal Radiol 20 03, 32: 454-461 Rong Y, Sato K, Sugiura H, Ito T, Sakano S, Iwata H, Kimata ... nodules of bone formation (1) and bridging or lamellar bone formation (2) An assessment of these results was made and agreed upon by AS, TY and NT Tartrate-resistant acid phosphatase (TRAP) staining...
  • 10
  • 478
  • 0
Lab 6.2.9 Firmware Upgrade of a Catalyst 2900 Series Switch

Lab 6.2.9 Firmware Upgrade of a Catalyst 2900 Series Switch

Ngày tải lên : 16/10/2013, 21:15
... path enter dir flash: or show flash to display the contents as follows: ALSwitch#dir flash: Directory of flash:/ -rwx 1674 921 Mar 01 1993 01 :28 :10 c2950-c3h2s-mz. 120 -5.3.WC.1.bin -rwx 26 9 Jan ... Directory of flash:/ -rwx 1674 921 Mar 01 1993 01 :28 :10 c2950-c3h2s-mz. 120 -5.3.WC.1.old -rwx 26 9 Jan 01 1970 00:00:57 env_vars 2- 4 CCNA 3: Switching Basics and Intermediate Routing v 3.0 - Lab 6 .2. 9 Copyright ... server ALSwitch#rename flash: c2950-c3h2s-mz. 120 -5.3.WC.1.bin flash: c2950c3h2s-mz. 120 -5.3.WC.1.old b Enter the following to verify that the renaming was successful: ALSwitch#dir flash: Directory of...
  • 4
  • 337
  • 0
Tài liệu Lab 6.2.9 Firmware Upgrade of a Catalyst 2900 Series Switch doc

Tài liệu Lab 6.2.9 Firmware Upgrade of a Catalyst 2900 Series Switch doc

Ngày tải lên : 24/01/2014, 19:20
... contents as follows: ALSwitch#dir flash: Directory of flash:/ -rwx 1674 921 Mar 01 1993 01 :28 :10 c2950-c3h2s-mz. 120 -5.3.WC.1.bin -rwx 26 9 Jan 01 1970 00:00:57 env_vars drwx 1 024 0 Mar 01 1993 00 :21 :13 ... - Lab 6 .2. 9 Copyright  20 03, Cisco Systems, Inc Erasing and Reloading the Switch For the majority of the labs in CCNA and CCNA it is necessary to start with an unconfigured switch Use of a switch ... startup configuration from NVRAM #delete nvram This command resets the switch with factory defaults All system parameters will revert to their default factory settings All static and dynamic addresses...
  • 5
  • 335
  • 0
Tài liệu Báo cáo khoa học: Structural and biochemical characterization of a human adenovirus 2/12 penton base chimera pptx

Tài liệu Báo cáo khoa học: Structural and biochemical characterization of a human adenovirus 2/12 penton base chimera pptx

Ngày tải lên : 19/02/2014, 06:20
... chain and hides a large amount of the hydrophobic surface area Surface area calculations for the pentamer give a total surface ˚ ˚ area of $ 81 000 A2 with 30% ($ 24 000 A2 ) as contact area Thus, ... 5¢-CTTTATTTTCAGGGCGCCATGAAGCGCG CAAGACCGTCTGAA-3¢ and a reverse oligomer 5¢-AGCT CGAATTCG GATCCGGTACCTCAGAAGGTAGACAG CAGAACC-3¢ For derivitization with TMR, a Gly-Gly-Cys sequence was introduced at the ... alignments of the hAd2 ⁄ 12pb chimera with the hAd2pb 4340 Fig Comparison of the hAd2, hAd2 ⁄ 12 and hAd2–fiber peptide complex structures (A) Stereo overlay of hAd2 penton base (yellow), hAd2 ⁄ 12 (blue)...
  • 10
  • 647
  • 0
Tài liệu Báo cáo khoa học: Thermal unfolding of smooth muscle and nonmuscle tropomyosin a-homodimers with alternatively spliced exons docx

Tài liệu Báo cáo khoa học: Thermal unfolding of smooth muscle and nonmuscle tropomyosin a-homodimers with alternatively spliced exons docx

Ngày tải lên : 19/02/2014, 07:20
... lack of N-terminal acetylation The sequence for the N-terminal 5¢ forward primer was 5¢-GGAATTCCATATGGCGAGC ATGGACGCCATCAAGAAGAAGATGC-3¢ As smTm uses the same C-terminal exon 9d as Tm 5a and Tm5b, ... final concentration of F-actin was 46 lm F-actin was stabilized by the addition of a 1.5-fold molar excess of phalloidin (Sigma) to obtain a better separation of the thermal transitions of actin-bound ... The replacement of muscle exons 1a and 2a in smTm by nonmuscle exon 1b in Tm 5a (and Tm5b) dramatically decreases the total measurable calorimetric enthalpy of the thermal unfolding of Tm, although...
  • 13
  • 532
  • 0
Tài liệu Báo cáo khoa học: Specific targeting of a DNA-alkylating reagent to mitochondria Synthesis and characterization of [4-((11aS)-7-methoxy-1,2,3,11a-tetrahydro-5H-pyrrolo[2,1-c][1,4]benzodiazepin-5-on-8-oxy)butyl]-triphenylphosphonium iodide doc

Tài liệu Báo cáo khoa học: Specific targeting of a DNA-alkylating reagent to mitochondria Synthesis and characterization of [4-((11aS)-7-methoxy-1,2,3,11a-tetrahydro-5H-pyrrolo[2,1-c][1,4]benzodiazepin-5-on-8-oxy)butyl]-triphenylphosphonium iodide doc

Ngày tải lên : 20/02/2014, 11:20
... [1 ,25 ] This DNAalkylating reagent binds to the minor groove of doublestranded DNA and then alkylates guanines at position N2 [26 ], favouring guanines flanked by purines [27 29 ] The covalent attachment ... detection of q° clones was not due to recovery and expansion of a residual population of nonalkylated mtDNA on removal 28 34 A M James et al (Eur J Biochem 27 0) of mitoDC-81 as a bulk culture of 143B ... alkylation leading to a depletion of mtDNA in intact cells (Fig 1) Here we report the synthesis and characterization of a novel mitochondria-targeted alkylating reagent and show that it alkylates...
  • 10
  • 638
  • 0
Tài liệu Báo cáo khoa học: Molecular characterization and allergenic activity of Lyc e 2 (b-fructofuranosidase), a glycosylated allergen of tomato pdf

Tài liệu Báo cáo khoa học: Molecular characterization and allergenic activity of Lyc e 2 (b-fructofuranosidase), a glycosylated allergen of tomato pdf

Ngày tải lên : 21/02/2014, 00:20
... sequence of the coding region: 5¢TTAC AAGGACAAATTAATTGTGCCAG For amplification of the long isoform the same 5¢ primers were used, the 3¢ specific primer was FF3B: 5¢TTACAAGTCTTGCAA AGGGAAGGAT For amplification ... (Mana1–6(Xylb1 2) Manb1–4GlcNAcb1–4(Fuca1–3)GlcNAc) MMX (Mana1–6(Mana1–3)(Xylb1 2) Manb1–4GlcNAcb1–4GlcNAc) MMXF3 (Mana1–6(Mana1–3)(Xylb1 2) Manb1–4GlcNAcb1–4(Fuca1–3)GlcNAc) GnMXF3 (GlcNAcb1–2Mana1–6(GlcNAcb1–2Mana1–3)(Xylb1 2) Manb1–4GlcNAcb1–4(Fuca1–3)GlcNAc) ... (GlcNAcb1–2Mana1–6(GlcNAcb1–2Mana1–3)(Xylb1 2) Manb1–4GlcNAcb1–4(Fuca1–3)GlcNAc) GnGnMXF3 (GlcNAcb1–2Mana1–6(Mana1–3)(Xylb1 2) Manb1–4GlcNAcb1–4(Fuca1–3)GlcNAc) well as tomato extract, BSA-conjugated pineapple stem...
  • 11
  • 533
  • 0
Báo cáo khoa học: Cardiac ankyrin repeat protein is a marker of skeletal muscle pathological remodelling pot

Báo cáo khoa học: Cardiac ankyrin repeat protein is a marker of skeletal muscle pathological remodelling pot

Ngày tải lên : 07/03/2014, 03:20
... M1941p65.R: TCAGAGTTCCCTACCGAAGCAG MH181PO.F: CTCCAAGCAGATGCAGCAGA M 225 PO.P: CCGTGGTGCTGATGGGCAAGAA M267PO.R: ACCATGATGCGCAAGGCCAT 1584p21.F: GTACAAGGAGCCAGGCCAAG 1 629 p21.P: TCACAGGACACTGAGCAATGGCTGATC ... CGCACTGTAAGACCCCAACA 6mC9.F: TCTGCACCCTCACCGTCTTC 58mC9.P: TCTCGAAGATATGACTCCAGGACCACAATATTTTCT 135mC9.R: GGCTTCCATGGCATACTCCA 616mCARP.F: CTTGAATCCACAGCCATCCA 641mCARP.P: CATGTCGTGGAGGAAACGCAGATGTC ... TGGAGGAGCTGCTTACCACG 423 mMLCfast.P: ACCGATTTTCCCAGGAGGAGATCAAGAA 500mMLCfast.R: TCTTGTAGTCCACGTTGCCG 381mMLC-2V.F: GAAGGCTGACTATGTCCGGG 403mMLC-2V.P: ATGCTGACCACACAAGCAGAGAGGTTCTC 461mMLC-2V.R: GCTGCGAACATCTGGTCGAT...
  • 16
  • 428
  • 0
Báo cáo khoa học: Pulchellin, a highly toxic type 2 ribosome-inactivating protein from Abrus pulchellus Cloning, heterologous expression of A-chain and structural studies ppt

Báo cáo khoa học: Pulchellin, a highly toxic type 2 ribosome-inactivating protein from Abrus pulchellus Cloning, heterologous expression of A-chain and structural studies ppt

Ngày tải lên : 07/03/2014, 16:20
... ending A pair of degenerate primers (abrin 1: 5Â-ACTGAAGGTGCC ACTTCACAAAGCTAYAARCARTT-3Â; abrin 3: 5Â-GGT TAAACACTTCCCGTTGGACCTDATNGT-3Â) was chosen to represent the possible coding sequences of ... buffer (Amersham-Pharmacia Biotech); 2. 5 U Taq DNA polymerase (Amersham-Pharmacia Biotech) in a total volume of 50 lL PCR was performed for: cycle at 94 C FEBS Journal 27 2 (20 05) 120 1 121 0 ê 20 05 ... far-UV CD spectra of rPAC, rPBC, rPAB and native pulchellin CD analyses for the rPAC sample showed a protein prole with predominance of a- helical elements [37]: two negative bands at 22 2 and 20 8...
  • 10
  • 390
  • 0
Guidance on the teaching of writing skills INSET opportunities for teachers of a subjects across the curriculum at Key Stages 2 and 3 docx

Guidance on the teaching of writing skills INSET opportunities for teachers of a subjects across the curriculum at Key Stages 2 and 3 docx

Ngày tải lên : 10/03/2014, 05:20
... 76.3 Key Stage results by subject and attainment target, 20 00 20 09 – percentage of pupils attaining Level Year 20 00 20 01 20 02 2003 20 04 20 05 20 06 20 07 20 08 20 09 62. 6 63 .2 64.1 67 .2 Subject English ... well as information gained from Estyn’s inspection of schools Look also at national data on Sheet 1 .2, updated as necessary There is a wealth of data available but this is only useful if it is passed ... strategies are relevant to writers of all abilities and should form part of every teacher’s repertoire of teaching approaches They can easily be adapted to suit all learners across Key Stages and and...
  • 174
  • 616
  • 0
Báo cáo khoa học: Odorant binding protein has the biochemical properties of a scavenger for 4-hydroxy-2-nonenal in mammalian nasal mucosa doc

Báo cáo khoa học: Odorant binding protein has the biochemical properties of a scavenger for 4-hydroxy-2-nonenal in mammalian nasal mucosa doc

Ngày tải lên : 23/03/2014, 10:20
... (e 223 ¼ 13750 m)1Æcm)1) after dilution in water AMA was from Sigma Aldrich (Milan, Italy) All other reagents, purchased from different companies, were of analytical grade Rabbit serum raised against ... are inactivated Hence, this mechanism might be considered as an extracellular counterpart of the chemical inactivation of HNE that occurs intracellularly via GST and other enzymes that 5138 are ... the lachrymal and lingual salivary glands, and has been found to be expressed by several other secretory tissues such as prostate, mucosal glands of the tracheobronchial tree, nasal mucosa and...
  • 12
  • 386
  • 0
SITUATION MODELS AND LEVELS OF COHERENCE: Toward a Definition of Comprehension potx

SITUATION MODELS AND LEVELS OF COHERENCE: Toward a Definition of Comprehension potx

Ngày tải lên : 24/03/2014, 02:20
... of Causality 5.1 Establishing Local and Global Coherence: The Main Hypotheses 119 5 .2 The Causal Network Model as Representative of Readers’ Naive Theories of Causality 123 The Reader’s Mental ... resources available to so, and one crucial question that arose was what elements are activated at a particular point in the reading These two constraints, related to inference making (or the lack of ... that are on the causal chain are better recalled than those that are located at dead-ends (i.e., assumed to be outside the causal chain) In the second theoretical approach (see Kintsch & van...
  • 252
  • 447
  • 0
The Confessions of a Caricaturist, Vol 2 pptx

The Confessions of a Caricaturist, Vol 2 pptx

Ngày tải lên : 29/03/2014, 22:20
... branch of art the art of advertising the artists, by a special number of a magazine devoted to the work of an Academician The special numbers, generally published at Christmas, are familiar and ... 24 3 A Distinguished "Lyon" 24 3 Headpiece and Initial "S" 24 5 A Sound Money Dinner 24 9 A Sketch of Boulanger 25 1 Address of Boulanger's Retreat 25 2 A Note on My Menu 25 3 Remarkable and much-talked -of ... of the broad Atlantic, and are generally just as troubled and combatant as the fiery political elements on the little island; but so far we have had a perfect passage, and the beautiful bay of...
  • 142
  • 341
  • 0
Báo cáo khoa học: Myocyte enhancer factor 2 (MEF2) is a key modulator of the expression of the prothoracicotropic hormone gene in the silkworm, Bombyx mori ppt

Báo cáo khoa học: Myocyte enhancer factor 2 (MEF2) is a key modulator of the expression of the prothoracicotropic hormone gene in the silkworm, Bombyx mori ppt

Ngày tải lên : 30/03/2014, 20:20
... japonica qMEF2D (qMEF2D; AJ0 022 38), Rattus norvegicus MEF2D (rMEF2D; AJ005 425 ), Halocynthia roretzi MEF2 (As-MEF2; D49970), and Drosophila melanogaster D-MEF2 (D-MEF2; U07 422 ) (B) Identical amino ... (cMef 2a; AJ0100 72) , Danio rerio mef 2a (zMef 2a; BC044337), Cyprinus carpio MEF 2A (CcMEF 2A; AB0 128 84), Caenorhabditis elegans mef -2 (Cemef -2; U36199), Podocoryne carnea Mef2 (PcMef2; AJ 428 495), ... Black BL, Martin JF & Olson EN (1996) Mutational analysis of the DNA binding, dimerization, and transcriptional activation domains of MEF2C Mol Cell Biol 16, 26 27 26 36 Roller L, Tanaka Y & Tanaka...
  • 10
  • 437
  • 0
Báo cáo Y học: Barley a-amylase Met53 situated at the high-affinity subsite )2 belongs to a substrate binding motif in the bfia loop 2 of the catalytic (b/a)8-barrel and is critical for activity and substrate specificity pot

Báo cáo Y học: Barley a-amylase Met53 situated at the high-affinity subsite )2 belongs to a substrate binding motif in the bfia loop 2 of the catalytic (b/a)8-barrel and is critical for activity and substrate specificity pot

Ngày tải lên : 31/03/2014, 08:20
... H92AMY2, T94AMY2, A9 5AMY2, Y130AMY2, A1 45AMY2, F180AMY2, K182AMY2, W206AMY2, S208AMY2, Y211AMY2, H288AMY2, Q294AMY2, M296AMY2 and Q35TAA, H 122 TAA, R204TAA, K209TAA, H210TAA, G234TAA, D340TAA, ... catalytic acids (D179AMY2, E204AMY2, and D289AMY2 and D206TAA, E230TAA, and D297TAA) The invariant Y51AMY2 and Y82TAA are at subsite )1 as are H92AMY2 and H 122 TAA; M52AMY2 (M53AMY1) and W83TAA ... 1A) Superpositioning of AMY2 and TAA guided by the catalytic acids was excellent for Tyr51AMY2 and Tyr82TAA (Fig 1A) and mutation in Saccharomycopsis buligera a- amylase (closely related to TAA)...
  • 14
  • 557
  • 0
Báo cáo Y học: Development of a selective photoactivatable antagonist for corticotropin-releasing factor receptor, type 2 (CRF2) potx

Báo cáo Y học: Development of a selective photoactivatable antagonist for corticotropin-releasing factor receptor, type 2 (CRF2) potx

Ngày tải lên : 31/03/2014, 08:20
... astressin, (D) ATB[ 125 I-labeled His13,Ala 32] astressin, and (E) ATB-[ 125 I-labeled His 12] Svg( 12- 40) MATERIALS AND METHODS Synthesis of 4-(1-Azi -2, 2 ,2- trifluoroethyl)benzoic acid 4-(1-Azi -2, 2 ,2- trifluoroethyl)benzoic ... radioactivity Photolysis of ATB-[His 12] Svg( 12) 40), and its radioactively labeled analog 125 I-labeled ATB-[His 12] Svg( 12) 40) Photolysis was performed at a wavelength of 360 nm using a UV Stratalinker ... with aqueous 6% trichloroacetic acid (5 min, 100 °C) [21 ,22 ] The cell lysates were stored at )70 °C until assayed with a RIA (radioimmunoassay) kit (Amersham, Little Chalfont) Data analysis was achieved...
  • 7
  • 344
  • 0
Báo cáo sinh học: " Roles of adjuvant and route of vaccination in antibody response and protection engendered by a synthetic matrix protein 2-based influenza A virus vaccine in the mouse" pdf

Báo cáo sinh học: " Roles of adjuvant and route of vaccination in antibody response and protection engendered by a synthetic matrix protein 2-based influenza A virus vaccine in the mouse" pdf

Ngày tải lên : 18/06/2014, 18:20
... e-max ELISA reader and analyzed with Softmax Pro software (both Molecular Devices, Sunnyvale, CA) Statistical analyses Prism software [64] was used for plotting and statistical analysis of data ... anti-influenza virus immunity J Virol 1991, 65 :21 46 -21 48 Tamura S, Funato H, Hirabayashi Y, Kikuta K, Suzuki Y, Nagamine T, Aizawa C, Nakagawa M, Kurata T: Functional role of respiratory tract haemagglutinin-specific ... ectodomains of matrix protein Vaccine 20 03, 21 :26 16 -26 26 Slepushkin VA, Katz JM, Black RA, Gamble WC, Rota PA, Cox NJ: Protection of mice against influenza A virus challenge by vaccination with baculovirus-expressed...
  • 14
  • 515
  • 0
Báo cáo hóa học: " Development of a mathematical model for predicting electrically elicited quadriceps femoris muscle forces during isovelocity knee joint motion" potx

Báo cáo hóa học: " Development of a mathematical model for predicting electrically elicited quadriceps femoris muscle forces during isovelocity knee joint motion" potx

Ngày tải lên : 19/06/2014, 08:20
... a parabolic manner and was modeled as A( θ) = a( 40 - θ )2 + b(40 - θ) + A4 0, (11) where A4 0 is the value of A at 40° of knee flexion, and a and b are constants that need to be identified for each ... Because the correlation between V2 and 2 was greater than the correlation between V2and b, we adopted the relationship between V2 and 2 that was given by V2 = 0.00 02 * 2 + 0.0048 (20 ) The above ... conditions at 90° of knee flexion Parameters τc and R0 were kept fixed at 20 -ms and 2, respectively, and equation 20 was used to calculate the value of V2 Values of the other seven parameters were varied...
  • 20
  • 466
  • 0

Xem thêm