1 83 the hand exerts a force f on the handle of a bottle opener shown in figure p1 83 assume the average shear strength of the

Báo cáo khoa học: The C-terminal region of the proprotein convertase 1⁄ 3 (PC1⁄ 3) exerts a bimodal regulation of the enzyme activity in vitro pdf

Báo cáo khoa học: The C-terminal region of the proprotein convertase 1⁄ 3 (PC1⁄ 3) exerts a bimodal regulation of the enzyme activity in vitro pdf

Ngày tải lên : 30/03/2014, 08:20
... mPC1 ⁄ 3, the presence of the 87 kDa form in excess of the 66 ⁄ 71 kDa facilitates isolation of the enzyme and helps in maintaining the enzymatic activity at a proper level The observed activation ... enzyme In the case of proPC1 ⁄ 3, removal of the various structural and functional domains is a sequential and coordinated event culminating in removal of the CT-peptide to release the fully active ... responsible for membrane tethering, thus insuring cell-surface anchoring [37] In other cases, the CT-peptide contains integral transmembrane motifs affecting the sorting and recycling of furin and PC5...
  • 10
  • 305
  • 0
A STUDY ON THE RELIABILITY OF THE FINAL ACHIEVEMENT COMPUTER-BASED MCQS TEST 1 FOR THE 4TH SEMESTER NON - ENGLISH MAJORS AT HANOI UNIVERSITY OF BUSINESS AND TECHNOLOGY

A STUDY ON THE RELIABILITY OF THE FINAL ACHIEVEMENT COMPUTER-BASED MCQS TEST 1 FOR THE 4TH SEMESTER NON - ENGLISH MAJORS AT HANOI UNIVERSITY OF BUSINESS AND TECHNOLOGY

Ngày tải lên : 10/04/2013, 14:46
... TABLE OF CONTENT Chapter 1: INTRODUCTION 1. 1 Rationale for the study 1. 2 Aims and research questions 1. 3 Theoretical and practical significance of the study 1. 4 Scope of the study 1. 5 Method of ... Table 12 : Discrimination value of items in sections Table 11 proves that 95% of items in functional language section are mostly nondiscriminating Roughly half of items in vocabulary and grammar ... and testing for better instructional effectiveness Another reason for the selection of testing a matter of study lies in the fact that the current language testing at Hanoi University of Business...
  • 64
  • 1.1K
  • 1
Tài liệu TNXH 1 - BÀI 1: CƠ THỂ CHÚNG TA A. Mục tiêu: -Kiến thức : Kể tên các bộ phận chính của docx

Tài liệu TNXH 1 - BÀI 1: CƠ THỂ CHÚNG TA A. Mục tiêu: -Kiến thức : Kể tên các bộ phận chính của docx

Ngày tải lên : 21/01/2014, 10:20
... động 1: Quan sát tranh *Mục tiêu:Gọi tên phận bên thể *Cách tiến hành: -HS làm việc theo hướng dẫn GV Bước 1: HS hoạt động theo cặp -GV hướng dẫn học sinh:Hãy nói tên -Đại diện nhóm lên bảng v a phận ... bên thể? -GV theo dõi giúp đỡ HS trả lời v a nêu tên phận bên thể Bước 2:Hoạt động lớp -Gvtreo tranh gọi HS xung phong lên bảng -Động viên em thi đua nói Hoạt động 2:Quan sát tranh *Mục tiêu:Nhận ... quan sát thảo luận phận bên thể gồm ba phần chính:đầu, mình,tay chân *Cách tiến hành: Bước 1: Làm việc theo nhóm nhỏ -GV nêu: -Đại diện nhóm lên biểu diễn lại hoạt động bạn tranh HS nhắc lại Quan...
  • 5
  • 978
  • 0
Báo cáo khoa học: Post-ischemic brain damage: targeting PARP-1 within the ischemic neurovascular units as a realistic avenue to stroke treatment pptx

Báo cáo khoa học: Post-ischemic brain damage: targeting PARP-1 within the ischemic neurovascular units as a realistic avenue to stroke treatment pptx

Ngày tải lên : 07/03/2014, 03:20
... using magnetic resonance imaging as the presence of an area of hypoperfusion larger than that of altered water diffusion (the latter is an index of necrosis), the so-called ‘Perfusion ⁄ Diffusion ... proliferation and slowly developing brain damage The molecular mechanisms of cell proliferation include the generation and release of ROS from NADPH oxidase and mitochondria, sustained increase of ... Journal compilation ª 2008 FEBS F Moroni and A Chiarugi PARP -1 and the ischemic neurovascular unit Astrocyte PARP -1 Neuron Inflammatory mediators AIF PARP -1 M ina am ll asa P M PARP -1 B HM G B1...
  • 10
  • 417
  • 0
Báo cáo khoa học: The propeptide in the precursor form of carboxypeptidase Y ensures cooperative unfolding and the carbohydrate moiety exerts a protective effect against heat and pressure pot

Báo cáo khoa học: The propeptide in the precursor form of carboxypeptidase Y ensures cooperative unfolding and the carbohydrate moiety exerts a protective effect against heat and pressure pot

Ngày tải lên : 07/03/2014, 21:20
... respectively) and the peak was deconvoluted into two peaks with Tm1 of 57.0 and Tm2 of 62 .1 °C, as shown by the dashed lines of Fig 1B This strongly suggests that the thermal unfolding of CPY involves a ... multistate transition: a first transition in the 0 .1 15 0 MPa range, a second from 15 0 to 450 MPa, and a third at pressures above 500 MPa (Fig 3B) The first transition was small with a half transition, ... and pressure-induced unfoldings The values of the unfolding reaction were fitted against temperature in the frame of simple two-state transitions between the native and denatured states, according...
  • 7
  • 439
  • 0
Báo cáo khoa học: Complexes of Thermoactinomyces vulgaris R-47 a-amylase 1 and pullulan model oligossacharides provide new insight into the mechanism for recognizing substrates with a-(1,6) glycosidic linkages docx

Báo cáo khoa học: Complexes of Thermoactinomyces vulgaris R-47 a-amylase 1 and pullulan model oligossacharides provide new insight into the mechanism for recognizing substrates with a-(1,6) glycosidic linkages docx

Ngày tải lên : 16/03/2014, 14:20
... minor catalytic reaction of TVAI, and the role of domain N as a pullulan-binding domain In future study, we will elucidate the complete pullulan binding mode of TVAI in the major catalytic reaction ... b-barrel domain (domain N), in addition to three conserved domains (domains A, B and C) in a- amylase (Fig 2) [4] Among members of GH13, several enzymes having an additional N-terminal domain have been ... are linked by a- (1, 4), a- (1, 4), a- (1, 6), and a- (1, 4) glycosidic linkages Although the conformation of P2 is almost equivalent to that of G13, the mode of binding of P5 is unique When binding with...
  • 9
  • 342
  • 0
Báo cáo hóa học: " The product of the Herpes simplex virus 1 UL7 gene interacts with a mitochondrial protein, adenine nucleotide translocator 2" pot

Báo cáo hóa học: " The product of the Herpes simplex virus 1 UL7 gene interacts with a mitochondrial protein, adenine nucleotide translocator 2" pot

Ngày tải lên : 20/06/2014, 01:20
... 5'-AGGGCGGGGGCATCGGGCACCGGGATGGCCGCCGCGACGGCCGACGATG AGAAGTTCCTATTCTCTAGAAAGTATAGGAACTTCGACAGCAAGCGAACCGGAAT-3' GAAGTTCCTATACTTTCTAGAGAATAGGAACTTCCGGAAATGTTGAATACTCA TACTCTTCCTTTTTC-3' The linear PCR-generated fragments were electroporated ... (5'gatttcgcgcaggtgatgag-3') for UL8; and 18 S rRNA -f (5'-actcaacacgggaaacctca-3') and 18 S rRNA-r (5'-aaccagacaaatcgctccac-3') for 18 S rRNA Reactions were performed using SYBER Premix Ex Taq II (Takara) with the Thermal ... of DNA fragments generated by cleavage of DNA The fragment designations shown here are identical to those described in the text and in Fig 1B Line 4, location of the DNA fragment used as a radiolabeled...
  • 13
  • 463
  • 0
Muller A History of Thermodynamics The Doctrine of Energy and Entropy phần 1 pot

Muller A History of Thermodynamics The Doctrine of Energy and Entropy phần 1 pot

Ngày tải lên : 23/07/2014, 16:21
... The flash of insight, a kind of ecstatic vision, came to Mayer when his ship rode at anchor off Surabaja taking on board a consignment of sugar Henceforth he was a changed man, a fanatic in the ... create 1 heat for a fall of 817 feet height; and the temperature of the Niagara will therefore be raised 1/ 5 of a degree by the fall of 16 0 feet Asimov33 writes that Joule in fact made that ... of Bavaria, and a factory for military uniforms staffed by the beggars from the streets of Munich The grateful elector made him a count: Graf von Rumford, see Fig 2 .1 Rumford was a town in Massachusetts,...
  • 32
  • 429
  • 0
Báo cáo lâm nghiệp: "Effects of the clear-cutting of a Douglas-fir plantation (Pseudotsuga menziesii F.) on the chemical composition of soil solutions and on the leaching of DOC and ions in drainage waters" pps

Báo cáo lâm nghiệp: "Effects of the clear-cutting of a Douglas-fir plantation (Pseudotsuga menziesii F.) on the chemical composition of soil solutions and on the leaching of DOC and ions in drainage waters" pps

Ngày tải lên : 07/08/2014, 16:20
... conclusion was that it is appropriate to work on mean values for solution concentrations 3.2 Concentration of solutions 3.2 .1 Rainfall The mean value for the sum of concentration of cations was 14 2 ... temporal variability mainly consisted in seasonal cycles and in the eect of clear-cutting (decrease in concentrations and disappearance of seasonal cycles) The example of Mg2+ is presented in Figure ... with an excess of 318 àmolc L1 over anions Again, the decit of the ionic balance can be explained by organic anions (DOC of 3.2.4 .1 Gravitational solutions Before the clear-cutting, the total cationic...
  • 18
  • 416
  • 0
báo cáo khoa học: " FCR (Fludarabine, Cyclophosphamide, Rituximab) regimen followed by 90yttrium ibritumomab tiuxetan consolidation for the treatment of relapsed grades 1 and 2 follicular lymphoma: a report of 9 cases" pot

báo cáo khoa học: " FCR (Fludarabine, Cyclophosphamide, Rituximab) regimen followed by 90yttrium ibritumomab tiuxetan consolidation for the treatment of relapsed grades 1 and 2 follicular lymphoma: a report of 9 cases" pot

Ngày tải lên : 10/08/2014, 10:21
... zoster infection after months following valacyclovir discontinuation; another patient developed fungal infection Both infections disappeared after specific treatment After a median observation period ... zoster infection after months following valacyclovir discontinuation that disappeared after retreatment, and a case of fungal infection by conidiobolus, developed 10 months after 90 Y-RIT and disappeared ... evaluations, and physical examinations OS was calculated from the date of FCR treatment to the date of death from any cause; OS was analyzed by using the Kaplan-Meier method Results Patients characteristics...
  • 5
  • 287
  • 0
Báo cáo y học: "Gender-based reciprocal expression of transforming growth factor-β1 and the inducible nitric oxide synthase in a rat model of cyclophosphamide-induced cystitis" ppsx

Báo cáo y học: "Gender-based reciprocal expression of transforming growth factor-β1 and the inducible nitric oxide synthase in a rat model of cyclophosphamide-induced cystitis" ppsx

Ngày tải lên : 11/08/2014, 08:22
... untreated male rats), suggesting that there is an elevation in the expression of total TGF- 1 and that a constant fraction of total TGF- 1 is active in urine regardless of whether or not the animals ... emerging impression of reciprocal expression of iNOS and TGF- 1 in the setting of CYP-induced bladder inflammation could be con- Page of 13 (page number not for citation purposes) Journal of Inflammation ... that levels of NO reaction products not remain constant throughout the day, but are maximal at the beginning of day and then stabilize for the remainder of the day Values at baseline in female...
  • 13
  • 244
  • 0
Báo cáo y học: " Penetrating injury of the hand with a door handle: a case report" ppt

Báo cáo y học: " Penetrating injury of the hand with a door handle: a case report" ppt

Ngày tải lên : 11/08/2014, 19:21
... Journal of Medical Case Reports 2008, 2:377 http://www.jmedicalcasereports.com/content/2 /1/ 377 Figure Clinical photograph of hand Clinical photograph of hand Figure Lateral radiograph of hand Lateral ... radiograph of hand Sinha M: An unusual foreign body in the hand J Hand Surg Eur Vol 2007, 32(2):2 31- 232 Chaudhry IA, Al-Sharif AM, Shamsi FA, Elzaridi E, Al-Rashed W: Severe ocular injuries from ... from the patient for publication of this case report and accompanying images A copy of the written consent is available for review by the Editor -in- Chief of this journal Competing interests The authors...
  • 3
  • 266
  • 0
Báo cáo y học: " Involvement of TORC2, a CREB co-activator, in the in vivo-specific transcriptional control of HTLV-1" doc

Báo cáo y học: " Involvement of TORC2, a CREB co-activator, in the in vivo-specific transcriptional control of HTLV-1" doc

Ngày tải lên : 12/08/2014, 23:21
... RK, Carling D, Hardie DG: Characterization of the AMP-activated protein kinase kinase from rat liver and identification of threonine 17 2 as the major site at which it phosphorylates AMP-activated ... 5'-TCTGGTTGGAATGGTGACAACATGC-3' and 5'-CCAGGAAGAGCTTCACTCAAAGCTT-3'; for GAPDH, 5'ACCACAGTCCATGCCATCAC-3' and 5'-TCCACCACCCTGTTGCTGTA-3'; for β-actin: 5'-GAGATCTGCCGATCCGCCGCCCG-3', and 5'GCTCGAGGTGTGCACTTTTATTCAACTGG-3'; ... and examined by confocal microscopy The right panel shows a magnified image of a single cell indicated by an arrow in the adjacent panel B Statistical analysis of subcellular localization of TORC2...
  • 16
  • 346
  • 0
A LATERAL ROOT DEFECT IN THE WAG1-1;WAG2-1 DOUBLE MUTANT OF ARABIDOPSIS

A LATERAL ROOT DEFECT IN THE WAG1-1;WAG2-1 DOUBLE MUTANT OF ARABIDOPSIS

Ngày tải lên : 24/08/2014, 11:38
... level of LR but had no significant effect on wild-type Genetic analysis of the wag1;wag2 LR pathway revealed that WAG1 and WAG2 are acting in the same pathway as AUX1, AXR1and PGM1 pgm 11 was not ... the suppression of PIN1 and PIN2 action Therefore, in jdl1/asa1 -1 mutants, there was decreased auxin synthesis along with the suppression of PIN1 and PIN2 mediated auxin transport resulting in ... catalytic domains (Fig 3) The wag1 -1 (wag1) and wag2 -1 (wag2) single mutants contain T-DNA insertions within their coding regions, and are loss -of- function mutations (52) Both wag1 and wag2 appear...
  • 94
  • 131
  • 0
homomorphisms of the fundamental group of a surface into psu(1,1), and the action of the mapping class group

homomorphisms of the fundamental group of a surface into psu(1,1), and the action of the mapping class group

Ngày tải lên : 13/11/2014, 09:14
... certify that we have read the dissertation prepared by Panagiota Savva Konstantinou entitled Homomorphisms of the Fundamental Group of a Surface into PSU (1, 1) , and the Action of the Mapping Class ... mother Andreani, my father Savvas, my brothers Michael-Zenios and Charalambos Finally I thank the Department of Mathematics at the University of Arizona 5 DEDICATION To my parents, Andreani and Savvas ... A .1 Fundamental domain for the three-holed sphere 82 ABSTRACT In this paper we consider the action of the mapping class group of a surface on the space of homomorphisms from the fundamental...
  • 88
  • 324
  • 0
Characteristics of flow in the wake region of a bluff vertical cylinder in the presence of waves,currents and combined wave current flows 1

Characteristics of flow in the wake region of a bluff vertical cylinder in the presence of waves,currents and combined wave current flows 1

Ngày tải lên : 10/09/2015, 15:54
... Data Monitoring on CFD Runs 10 7 Chapter 6 .1 Results of Numerical Modelling Wave Elevations at Locations in the Wave Tank 11 0 11 0 6.2 Flow Field in the Wake of the Bluff Cylinder 11 7 6.3 Forces on ... of Re = x 10 4 and Re = 1. 8 x 10 4 respectively The variations of CD and CM are presented in Figure 14 15 Drag Coefficients CD Figure 14 Inertial Coefficients CM Variation of inline force coefficients ... number of Re = x 10 4 By varying the ratio of Uc / Uw, from to 1, it was ascertained that: a The forces on the in- line direction of the cylinder varies in a same manner as the flow velocity, for the...
  • 195
  • 474
  • 0
Functional analysis of the nuage, a unique germline organelle, in drosophila melanogaster 1

Functional analysis of the nuage, a unique germline organelle, in drosophila melanogaster 1

Ngày tải lên : 14/09/2015, 08:25
... organs in the body by maintaining a fine balance between pluripotency (self-renewal capability) and differentiation (formation of gametes) (Saffman and Lasko, 19 99) Hence, the understanding of germ ... 3.3 .12 HeT -A is de-repressed in dcp1 and ski3 mutants 10 1  Figure 3.3 .13 piRNA production is unaffected in the mRNA degradation mutants 10 2  Figure 3.3 .14 Nuage localisation is unaffected in ... (Saffman and Lasko, 19 99) 1. 2 The nuage The conservation of the nuage and its striking similiarities with the pole plasm in many animal germlines has stirred interests in understanding the functions...
  • 49
  • 221
  • 0
Survey of cellular factors modulating the HIV 1 integration complex activity using a unique protein screening system in vitro

Survey of cellular factors modulating the HIV 1 integration complex activity using a unique protein screening system in vitro

Ngày tải lên : 01/10/2015, 17:27
... 11 1 /11 2 LISTS OF FIGURES Figure 1. 1 An overview of the HIV -1 replication cycle Figure 1. 2 Structural domain of HIV -1 IN Figure 1. 3 Illustration of the biochemical steps in HIV -1 integration Figure ... reduction in HIV -1 integration efficiency as a whole A summary on the effects and method of identification of the abovementioned host factors that interact with IN in the early phase of the HIV -1 replication ... An additional PCR was performed using a common set of forward (5’GGGGACAAGTTTGTACAAAAAAGCAGGCTgcgaattcatcgatagatctgat-3) and reverse (5’GGGGACCACTTTGTACAAGAAAGCTGGGTCctacttgtcatcgtcatccttg-3’)...
  • 125
  • 395
  • 0