Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2320-3471 (Online) ISSN: 2321-5674 (Print) Editor B.Pragati Kumar, M.Pharm, Assistant Professor, Nimra College of Pharmacy Consulting editor Dr S Duraivel, M.Pharm, Ph.D., Principal, Nimra College of Pharmacy Associate Editors Mr Debjit Bowmick, M.Pharm., (Ph.D) Assistant Professor, Nimra College of Pharmacy Mr Harish Gopinath, M.Pharm., (Ph.D) Assistant Professor, Nimra College of Pharmacy Dr M Janardhan, M.Pharm., Ph.D Professor, Nimra College of Pharmacy Dr A Ravi Kumar, M.Pharm., Ph D Professor, Bapatla College of Pharmacy Editorial Advisory Board Dr.Y.Narasimaha Reddy, M Pharm., Ph D Principal, University college of Pharmaceutical Sciences, Kakatiya University, Warangal Dr.V.Gopal, M Pharm., Ph D Dr Biresh Kumar Sarkar, Asstt.Director (Pharmacy), Kerala Dr M.Umadevi, M.Sc (Agri), Phd Principal, Mother Theresa Post Graduate & Research Institute of Health Sciences,Pondicherry-6 Research Associate, Tamil Nadu Agricultural University, Coimbatore Dr J.Balasubramanium, M Pharm., Ph D Dr V.Prabhakar Reddy, M Pharm., Ph D General Manager, FR&D R A Chem Pharma Ltd., Hyderabad Principal, Chaitanya College of Pharmacy Education & Research, Warangal Dr.P.Ram Reddy, M Pharm., Ph D Dr S.D.Rajendran, M Pharm., Ph D Director, Pharmacovigilance, Medical Affairs, Sristek Consultancy Pvt Ltd, Hyderabad General Manager, Formulation, Dr.Reddy’s Laboratory, Hyderabad IJRPB 1(6) www.ijrpb.com November-December 2013 INDIAN JOURNAL OF RESEARCH IN PHARMACY AND BIOTECHNOLOGY Instructions to Authors Manuscripts will be subjected to peer review process to determine their suitability for publication provided they fulfill the requirements of the journal as laid out in the instructions to authors After the review, manuscripts will be returned for revision along with reviewer’s and/or editor’s comments Don’t copy and paste the article content from internet or other sources like e-books etc Authors are the sole responsible persons for the article, article content; results of the research conducted and copy right issues if any The editor and the editorial board are not entitled to change the article content, results and diagrammatic representations which are given by authors The article will be published only after getting the approved galley proof from the authors Kindly follow the below guidelines for preparing the manuscript: Prepare the manuscript in Times New Roman font using a font size of 12 There shall not be any decorative borders anywhere in the text including the title page Don’t leave any space between the paragraphs Divide the research article into a Abstract Visit us at b Introduction www.ijrpb.com c Materials and Methods Contact us/ send your articles to: d Results Email: ijrpb@yahoo.com e Discussion Phone no: 9490717845; 9704660406 f conclusion g References References should include the following in the same order given below a) Author name followed by initials b) Title of the book/ if the reference is an article then title of the article c) Edition of the book/ if the reference is an article then Journal name d) Volume followed by issue of the journal e) Year of publication followed by page numbers Download the author declaration form from the web site www.ijrpb.com, fill it and submit it after signing by corresponding and co-authors to IJRPB You can send the filled in form by post or scanned attachment to ijrpb@yahoo.com Keep in touch with the editor through mail or through phone for further clarifications as well as for timely publication of your article Indian Journal of Research in Pharmacy and Biotechnology is a bimonthly journal, developed and published in collaboration with Nimra College of Pharmacy, Ibrahimpatnam, Vijayawada, Krishna District, Andhra Pradesh, India-521456 Printed at: F No: 501, Parameswari Towers, Ibrahimpatnam, Vijayawada, India -521456 IJRPB 1(6) www.ijrpb.com November-December 2013 Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2320-3471 (Online) ISSN: 2321-5674 (Print) S.No 10 11 12 13 14 15 16 17 18 19 Contents Authentication of traditional crop Kalongi (Nigella sativa L.) by LAMP marker Showkat Hussain Ganie, Deepak Yadav, Altaf Ahmad, Anis Chadhry, Mohd Asif Page No 765-771 Comparative in-vitro dissolution study of five brands of Diclofenac sodium delayed release tablets in QbD environment V Malleswari Bai, M Prasada Rao, M Chandana, K Naga Harini, B Naga Deepthi, K Thirumala Devi1, P Lakashmana Rao, Vinay U rao and J Naga raja Development and validation of a stability indicating HPLC method for analysis of Altretamine in bulk drug and pharmaceutical formulations M Karimulla Santhosh, A Sreedevi, L Kalyani, A Lakshmana Rao A review of various analytical methods on Atrovastatin N.Delhiraj, P.Ashok,U.Ravikiran,P.Abhinandhana 772-777 A review on the use of Bleomycin-Cisplatin-Vinblastine combinations in therapy of testicular cancer Praveen D, Ranadheer Chowdary P Method development and validation for the simultaneous estimation of Ofloxacin and Tinidazole in bulk and pharmaceutical dosage form by reverse phase HPLC method Y.Bhargav, K Haritha Pavani, S Amareswari Evaluation of nephro protective activity of methanolic extract of seeds of Vitis vinifera against Rifampicin and carbon tetra chloride induced nephro toxicity in wistar rats Kalluru Bhargavi, N Deepa Ramani, Janarthan M, Duraivel S Method development and validation for the simultaneous estimation of Atazanavir and Ritonavir in tablet dosage form by RP-HPLC Nuli Vasavi, Afroz Patan Evaluation of anti arthritic activity of aqueous extract of Hibiscus Platinifolius in albino rats Marri Praveen, M.Janarthan Some H.R methodology/ techniques for costs reduction in companies to improve profit M Sarkar, B K Sarkar, M D Gora, S C Verma 793-796 Analytical method development and validation of Artesunate and Amodiaquine hydrochloride in tablet dosage form by RP-HPLC P RajaRao, Nanda Kishore Agarwal Analytical method development and validation for the simultaneous estimation of Rabeprazole sodium and Itopride hydrochloride in bulk and pharmaceutical dosage forms by RP-HPLC Syed Shaheda, Nanda Kishore Agarwal Formulation and evaluation of herbal anti-dandruff shampoo Anusha Potluri*, Harish G, B Pragathi Kumar, Dr Durraivel 822-827 Analytical method development and validation for the simultaneous estimation of Paracetamol and Tapentadol by RP-HPLC in bulk and pharmaceutical dosage forms V.Praveen Kumar Reddy, Aneesha, D.Sindhura, M.Sravani, Thandava Krishna Reddy Protective role of methanolic extract of Polygonum glabrum willd against Cisplatin and Gentamycin induced nephrotoxicity in Albino rats Radha.B, Janarthan M, Durraivel S Analytical method development and validation for the simultaneous estimation of Rosuvastatin and Finofibate in tablet dosage form by reverse phase high performance liquid chromatography M Sumalatha, K.Haritha Pavani A new development and validated RP-HPLC method for the assay and related substances of Itraconazole in capsule dosage form Sarvani Paruchuri, Haritha Pavani K Evalution of anti urolithiatic activity of aqueous extract of stem core of Musa paradisiaca againest ethylene glycol and ammonium chloride induced urolithiasis on wistar rats Thirumala K, Janarthan M, Firasat Ali M Preparation and characterization of bioadhesive vaginal gel of Propranolol hydrochloride Hardeep Singh Dhaliwal, Dhruba Sankar Goswami 840-845 Volume Issue www.ijrpb.com 778-785 786-792 797-802 803-807 808-814 815-818 819-821 828-834 835-839 846-849 850-856 857-865 866-868 869-874 November-December 2013 20 21 22 23 24 25 26 27 28 Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2320-3471 (Online) ISSN: 2321-5674 (Print) Topical herbal analgesic and anti arthritic (max-relief) versus Diclofenac in symptomatic treatment of osteoarthritis of the knee: a randomized controlled trial Md Q Azam, Abdallah A Al-Othman, Mir Sadat-Ali, Ahmed A Tantawy Analytical method development and validation for the estimation of Olmesartan medoxomil by RP-UPLC in bulk and pharmaceutical dosage forms Farhana Pattan, Haritha Pavani, Chandana N, Karimulla M Modern hygienic industrial canteen amenity: A change factor for healthy physical work environment of the work force in Indian industrial units TN Murty, GV Chalam, Md Aasif Siddique Ahmed Khan, T Abhinov and T Abhilash Design and development of Metformin hydrochloride Trilayered sustained release tablets Venkateswara Rao T, Bhadramma N, Raghukiran CVS and Madubabu K Amlodipine: the upcoming threat to Periodontist Sivaranjani, Vineet Kashyap, S.P.K.Kennedy Babu, Ajish Paul K, Study of the influence of Hydrophillic polymers and Citric acid on Bi-layered floating tablets of Diltiazem hydrochloride Venkateswara Rao T, Bhadramma N, Raghukiran CVS2 and Madubabu K3 Development and optimization of Diltiazem hydrochloride loaded microspheres by using different Eudragit polymers V Kamalakkannan, K.S.G.Arul Kumaran Formulation, characterization and optimization of Methotrexate loaded sodium alginate chitosan Nanoparticles using 32 factorial design S.Daisy Chella Kumari, C.B.Tharani , N.Narayanan , C.Senthil Kumar Strategies in Dendritic architecture for drug delivery – An over review Pandurangan Dinesh Kumar, Palanirajan Vijayaraj Kumar, Govindaraj Saravanan Volume Issue www.ijrpb.com 875-880 881-885 886-892 893-897 898-900 901-907 908-914 915-921 922-934 November-December 2013 Mohd Asif et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online) Authentication of traditional crop Kalongi (Nigella sativa L.) by LAMP marker Showkat Hussain Ganie1, Deepak Yadav1, Altaf Ahmad2, Anis Chadhry1, Mohd Asif1* Department of Ilmul-Advia, Faculty of Medicine, Jamia Hamdard, New Delhi-110062 India Department of Botany, Faculty of Science, Jamia Hamdard, New Delhi-110062 *Corresponding author: Email: profasif2012@gmail.com, Phone: 8860142069 ABSTRACT Nigella sativa, commonly known as kalongi is an important drug of traditional system of medicine, commonly used against cough, fever, abdominal disorders, skin infections, paralysis and jaundice Because of increased demand and high price, there are chances that the herb could be adulterated in the trade by other related species Therefore, a reliable authentication method is needed to facilitate identification of this genuine material from its adulterants To carry out the work, the market samples were procured from the crude-drug markets of different geographical regions of India The RAPD derived LAMP technique was employed for the characterization of different accessions of Kalongi 19 primers were used of which one unique band, common in all accessions were eluted, cloned and sequenced LAMP primers were designed and LAMP product formation was detected at 60°C.Out of 25 primers, 19 primers amplified a total of 524 reproducible, clear and scorable bands One monomorphic RAPD fragment present in all the accessions, amplified by OPAA-09 primer, was developed into LAMP marker for identification of N Sativa The primers successfully amplified the genome of kalongi while as in negative control (Catharanthus roseus) there was no amplification The LAMP markers developed in this study may provide guidance for the authentication of plant materials traded as Kalongi Key words: Adulteration; Authentication; loop mediated isothermal amplification (LAMP); Molecular markers; kalongi; RAPD INTRODUCTION The traditional knowledge of herbal medicine is widespread- ranging from tribal folklore use to age-old practices and closely guarded recipes handed down from generation to generation, to highly evolved systems of medicine like Ayurveda, Unani and Siddha These systems have served the humanity through the centuries and it is certain that they will continue to be in use for times to come However, in the process of urbanization the contact with nature was cut off and, consequently, the knowledge about the identification of medicinal plants deteriorated to a great extent Additionally, the crude drugs sold in the market are adulterated, sophisticated or substituted by quite unrelated plant materials The adulteration of market samples is one of the greatest drawbacks in promotion of herbal products (Dubey, 2004) Plant samples in the market are stored under undesirable conditions over the years and often contain a mixture of other plant species (Khatoon, 1993), thus, adversely affecting their bio efficacy The efficacy of many of the drugs has become suspect because of the adulterated, dried raw materials profusely available in the indigenous market (Anonymous, 1996) Very often the identity of market drugs is taken for granted without subjecting the plant material to stringent methods of botanical identification This result in the loss of therapeutic potential of the preparations if the plant used is adulterated or substituted It results in the production of misleading or overlapping data on IJRPB 1(6) www.ijrpb.com phytochemical, pharmacological, pharmacognostical and clinical aspects Nigella sativa (Family: Ranunculaceae) is considered one of the most important medicinal herb used in various Indigenous System of Medicine The plant cultivated almost all over India, is an annual herb with linear- lance late leaves Pale blue flowers are solitary, fruit is capsule; seeds are black, flattened, angular and funnel shaped Seeds of the herb are mostly used in medicine Many formulations containing Kalongi as a single drug or in combination with other drugs are available in Indian market The important Unani formulations using the drug are “Anquriya Kabir, Habe-e-Halteet, Roghan Kalan, Qairuti Arad Karsana, Mujun Nankhaw” Traditionally the drug is used against cough, fever, abdominal disorders, skin infections, paralysis and jaundice (Paarakh, 2010) Seed oil is used as a local anaesthetic (Paarakh, 2010) As far as its pharmacological activities are concerned, the drug is hypoglycaemic, hypocholestermic (Bamosaet, 2002) and antioxidant (Kanter, 2003) Thymoquinone (constituent of seed oil extract) is antitumor, found to kill the pancreatic cancer cells and its derivatives are used in blood, skin and breast cancers (Paarakh, 2010) The aqueous decoction of kalonji revealed significant antibacterial potential against Staphylococcus aureus, Micrococcus roseus, Streptococcus mutans, Streptococcus morbillorium, Streptococcus sanguis, Streptococcus intermedius, November – December 2013 Page 765 Mohd Asif et.al Indian Journal of Research in Pharmacy and Biotechnology Klebsiella ozaenae, Aeromonas hydrophila, and Streptococcus salivarius (Chaudhry and Tariq, 2008) Considering the medicinal importance of Kalongi, the authentication of this herb is highly mandatory DNA fingerprinting techniques are very useful for correct identification of taxa Among various DNA markers, loop-mediated isothermal amplification (LAMP) is convenient because the reaction could be conducted under isothermal conditions, thereby facilitating amplification and the results could be achieved in less than hr To the best of our knowledge, no attempt has been made to characterize this herb using molecular biology To fill this gap, we employed LAMP markers to authenticate the said drug For this, samples were collected from the crude drug dealers of North and West India MATERIALS ANDMETHODS 2.1 Plant material: The samples of N Sativa were collected from crude drug dealers of Delhi, Kolkatta, Uttarakhand and Uttar Pradesh Voucher specimens of these samples were prepared and kept in the Herbarium, Department of Botany, Hamdard University, New Delhi, 110062 The seeds are stored in seed bank, Department of Botany, Hamdard University, New Delhi, 110062 The identified specimens were compared with authenticated voucher specimens preserved in the herbarium of National Institute of Science and Information Resources (NISCAIR) The seeds were used for DNA isolation 2.2 DNA Isolation: The modified CTAB protocol of Doyle and Doyle (1990) and purification kit (HiPurA, India) were used to extract DNA from the overnight soaked seeds 2.2.1 Reagents and Solutions: CTAB extraction buffer (2M Sodium Chloride, 100mM TrisHCl (pH 8), 20 mM EDTA) 0.2% β-mercaptoethanol, Chloroform:Isoamylalcohol (24:1), absolute alcohol, 3M Potassium acetate, Isoamyl alcohol All the chemicals chemical were of analytic grade Enzymes (Taq polymerase, Bst polymerase and RNAase A), Taq buffer, MgCl2 and dNTPs were purchased from Bangalore Genei (Bangalore, India) 2.2.2 Protocol: In order to avoid surface contamination, the seeds were washed with 0.2% Cetrimide for min, followed by treatment with 0.5% streptomycin sulphate and 0.5% bavistine for each After these treatments the seeds were rinsed with 70% alcohol for andfinally washed with sterile double distilled water and kept overnight 1g seeds were pulverized to fine powder by liquid nitrogen in a chilled mortar and pestle followed by the addition of 100 mg of poly vinyl pyrollidone (PVP, insoluble) and 10 ml pre-heated IJRPB 1(6) www.ijrpb.com ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online) CTAB buffer (containing 0.2 % β-mercaptoethanol) The slurry was transferred into autoclaved 50 ml centrifuge tube and incubated at 60oC for hr 10 ml of Chloroform, Isoamyl alcohol (CHCl3: IAA, 24:1) was added to the centrifuge tubes and mixed carefully for 15 The content was centrifuged at 8000 rpm for 15 at 15oC The upper phase was transferred into new autoclaved centrifuge tubes 10µl of RNAase was added and the tubes were incubated at 37oC for 30 10 ml of CHCl3: IAA (24:1) was added carefully and the tubes were centrifuged at 8000 rpm for 15min at 15oC The upper phase was transferred again into autoclaved centrifuge tube and 0.5 vol of 3M Potassium acetate (pH 5.2) was added For DNA precipitation equal volume of chilled isopropanol (chilled absolute ethanol was also used) was used and the tubes were kept at -20oC for hrs It was recentrifuged at 8000 rpm for 15 at 4oC The supernatant was discarded and the pellet was washed with 70% ethanol, air dried and dissolved in 250 µl of sterile water The DNA thus obtained was purified by DNA purification (HiPurA, India) kit according to manufacturer’s instructions 2.3 Polymerase Chain Reaction (PCR) Amplification: The PCR was carried out in 20 µl reaction volume containing 50ng DNA, 0.5 u/µl Taq DNA polymerase, 1.66 mM MgCl2, 30 pmol 10-mer primers, 200 µM of each dNTPs, 2x Taq polymerase buffer with minor changes as described by Shaik et al (2006) The final volume was made-up with sterile MilliQ water The amplifications were carried out in DNA thermal cycler (Eppendorf, Germany) The PCR amplification conditions for RAPD consisted of initial step of denaturation at 94°C for min, 35 cycles of denaturation at 94°C for min, annealing at 35°C for min, extension at 72°C for min, followed by final extension at 72°C for 10 The amplified DNA was loaded on 1.2% agarose gel in 0.5x TBE buffer containing 10 µl of EtBr (10mg/ml) and photographed using gel documentation system (UVP, Germany) Twenty 10-mer RAPD primer series OPAA, purchased from Qiagen, USA and five (BG series) from Bangalore Genei (India) were screened 2.4 Gel purification, Cloning and sequencing of RAPD amplified product: RAPD fragment was excised from the gel with a sharp and sterile scalpel to avoid any contamination Elution of DNA from agarose gel was carried out using MiniElute® kit from Qiagen (USA) following manufacturer’s instructions and the product was run on 1.2% gel along with the Gene Rular DNA ladder, to check the presence of the desired product The eluted DNA was ligated into pGEM®-T easy vector (Promega, November – December 2013 Page 766 Mohd Asif et.al Indian Journal of Research in Pharmacy and Biotechnology USA) Ligation reaction was carried out in 10μl reaction containing 10x ligase buffer (5.0 μl), pGEM®-T easy vector (0.5 μl), T4 DNA Ligase (1.0 μl) and PCR product 3.0 μl) and the final volume was set up with autoclaved Milli Q water Competent cells of E coli DH5α were prepared by CaCl2 method (Sambrook et al 2001) and 5μl of the ligation mixture was mixed with an aliquot of 100 μl competent cells The transformed cells were plated on LB-X-gal/Amp plates and the recombinant colonies were selected through blue-white screening The plasmid was isolated from the positive bacterial colonies using plasmid isolation kit (Qiagen, Germany) The cloned fragments were sequenced using T7 primers through the centre for Genomic Application, New Delhi, India 2.5 Design of LAMP Oligonucleotides: A total set of four LAMP primers were designed using Primer Explorer V3 (http://primerexplorer.jp/elamp3.0.0/index.html) for the specific detection of PCR product The primer set consisted of two outer (F3 and B3), and two inner (FIP and BIP); the inner primers cover two distinct sequences of the target (F1c/B1c and F2c/B2c) Sequences of the LAMP primers are given in table 2.6 LAMP reaction: The LAMP reaction was carried out in a 25 µl reaction volume containing 60pmol each of the primers FIP and BIP, 10 pmol each of the outer primers F3 and B3, 8mM MgSO4, 1.4mM dNTPs, 0.8M betaine, 10 units of the Bst DNA polymerase and µl of DNA template The optimum temperature for the LAMP reaction was 60°C 1μlSYBR Green-Ι dye was added at the end of the reaction Visual inspection for amplifications was performed through observation of colour change following addition of 1μl of SYBR Green I (fluorescent dsDNA intercalating dye) to the tube ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online) RESULTS RAPD reaction was performed in order to find out unique specie specific monomorphic bands present in all the samples, meant for LAMP analysis Twenty five 10-mer RAPD primers were used of which six did not amplify the DNA Each RAPD reaction was repeated thrice and only reproducible bands were taken in to account A total of 524RAPD bands (table 2) were obtained and to develop the LAMP marker, we analyzed the nucleotide sequences of species-specific RAPD amplicons, consisting of DNA fragments for N saitva From the resulting nucleotide sequences, one unique RAPD amplicon from primer OPAA-9 has been registered in the NCBI Gene Bank dbGSS, and used to develop RAPD derived LAMP marker (Fig 1) The specific amplicon of 600bp (fig.2) RAPD fragment, specific for all the accessions of N sativa, was used for designing primers of LAMP reaction The reaction was carried out using genomic DNA as a template to determine the optimal temperature and reaction time and to evaluate the use of primers LAMP product formation was detected at a temperature range of 60−64°C and consequently, 60°C was considered to be the optimal reaction temperature for the LAMP assay The tube containing the amplified products were visualised in the presence of fluorescent intercalating dye SYBR Green I under UV transilluminator In case of positive amplification, the original colour of the dye was changed into green that was judged under natural light as well as under UV light (302 nm) with the help of UV transilluminator In case of negative control (Catharanthus roseus) there was no amplification, the original orange colour of the dye was retained (Figure.3) Figure.1 RAPD profile of Kalonji (N sativa) representing specific band present in all accessions amplified with OPAA-09 primer.Lane M, molecular marker 200-1700 bp, Lanes K1–K5 corresponds to the accessions (K1Kolkatta, k2- Govindpuri- New Delhi, K3- KhariBaowli- Delhi, K4- Aligarh- Uttar Pradesh, K5- DehradunUttarakhand) IJRPB 1(6) www.ijrpb.com November – December 2013 Page 767 Mohd Asif et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online) gctgcaccacctctgtggctgggacctctggtactgcttccacctgtgtctggcccatttgccccgacggcgccggcagcggggcga ggacaccctgctctacgatgccttcgtggtctttgacaaggcgcagagtgcagtggccgactgggtgtacaacgagctccgcgtgca gctggaggagcgccgcgggcgccgggcgctccgcctctgcctggaggagcgagactggctccctggcaagacgctcttcgagaa cctgtgggcctcggtctacagcagccgcaagaccatgttcgtgctggaccacacggaccgggtcagcggcctcctgcgcgccagct tcctgctggcccagcagcgcctgttggaggaccgcaaggacgtcgtggtgctggtgatcctgcgccccgccgcctaccggtcccgct acgtgcggctgcgccagcgcctctgccgccagagcgtcctcctctggccgcaccagcccagtggccagggtagcttctgggccaac ctgggcatggccctgaccagggacaaccgccacttctataaccggaacttctgccggggccccacgacagccgaatagcac Figure.2.Nucleotide sequence of RAPD amplicon (600 bp) of N sativa used for development LAMP marker Figure.3.Analysis of LAMP under UV light (A) and natural light (B) 1-5 accessions of Nigella sativa.(1- Kolkatta, 2- Govindpuri- New Delhi, 3- KhariBaowli- Delhi, 4- Aligarh- Uttar Pradesh, 5- Dehradun- Uttarakhand, CNegative control (Catharanthus roseus) Name F3 B3 FIP (F1c+F2) BIP (B1+B2c) Table 1.Primer Sequences used in this study sequence (5′ → 3′) catttgccccgacggc cggctgctgtagaccga tcggccactgcactctgcgcgaggacaccctgctct tccgcctctgcctggaggaccacaggttctcgaagagc Bases 16 17 36 38 Table 2.Number of amplified products generated by 20 arbitrary primers in accessions of Kalonji (Nigella sativa) Primer code sequence (5′ → 3′) No of amplification products Fragment size (kb) OPAA -01 AGACGGCTCC 37 0.45-1.20 OPAA -02 GAGACCAGAC 31 0.3-1.15 OPAA -03 TTAGCGCCCC 29 0.3-1.20 OPAA -04 AGGACTGCTC 0 OPAA -05 GGCTTTAGCC 20 0.3-1.00 OPAA -06 TCAAGCTAAC 11 0.5-1.10 OPAA -07 CTACGCTCAC 24 0.2-1.20 OPAA -08 TCCGCAGTAG 29 0.4-1.40 OPAA -09 AGATGGGCAG 35 0.5-1.20 OPAA -10 TGGTCGGGTG 34 0.3-1.15 OPAA -11 ACCCGACCTG 32 0.35-1.10 OPAA -12 GGACCTCTTG 40 0.35-1.20 OPAA -13 GAGCGTCGCT 26 0.35-1.10 OPAA -14 AACGGGCCAA 14 0.5-1.00 OPAA -15 ACGGAAGCCC 14 0.3-1.20 OPAA -16 GGAACCCACA 33 0.3-1.20 OPAA -17 GAGCCCGACT 23 0.3-1.10 OPAA -18 TGGTCCAGCC 39 0.4-1.15 OPAA -19 TGAGGCGTGT 28 0.3-1.20 OPAA-20 TTGCCTTCGG 32 0.4-1.20 Total 524 IJRPB 1(6) www.ijrpb.com November – December 2013 Page 768 Mohd Asif et.al Indian Journal of Research in Pharmacy and Biotechnology DISCUSSION Correct identification of plants forming the drug is a prerequisite and fundamental to whole realm of medicine and science Most of the regularity guidelines and pharmacopoeia recommend macro- and microscopic evaluation and chemical analysis of botanical material for quality and quantity control and standardization (Anonymous, 1996) Morphological or macroscopic identification of plant materials is based on parameters like shape, size, texture, colour, surface feature, odour, taste and other organoleptic characters that are compared to standard reference materials Though this method is simple and direct, its accuracy and authenticity which are sometimes subjective, depends on examiners Histological or microscopic examinations are done to study comparative microscopic inspection of broken as well as powdered, crude, botanical materials to reveal the characteristics of tissue structure and arrangement of cells in different organs and tissues Chemical authentication establishes a chemical composition of plant, which is used for differentiation The variation of chemical composition may hinder the authentication, and in some cases, may be misleading if the samples are adulterated Moreover, it is difficult to distinguish closely related species due to similar chemical compounds Molecular or DNA-based markers are now becoming a popular means for the identification of medicinal plants (Yip, 2007) Molecular markers have the advantage over chemical markers as the genetic composition is unique for each individual and is least affected by age (Kumble, 2003), environmental factors and physiological conditions (Macbeath and Schreiber, 2000), harvest, storage and processing of the samples (Schweitzer, 2003) Molecular markers are not stage and tissue specific and thus can be detected at any stage of development Ours is the first attempt to characterize Kalongi using LAMP markers Although in earlier reports RAPDs were used for the authentication purpose (Rivera-Arce, 2007; Shinde, 2007; Hammad and Qari 2010; Ganie, 2012), however, these markers are very sensitive and the big blow to these markers are IJRPB 1(6) www.ijrpb.com ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online) reproducibility problem Therefore, in the present study RAPDs were converted into LAMP markers These markers are very specific and highly reproducible because these markers could amplify a specific gene from the whole genome discriminating a single nucleotide difference (Parida, 2008) As the reaction is carried out under optimal and isothermal conditions, therefore, there are negligible chances of inhibition reaction at the later stage of amplification compared with the PCR The results can be easily monitored by checking the turbidity obtained from the precipitate and most importantly the detection of the desired gene could be completed in a single step by incubating mixture of gene sample, primers, DNA polymerase with strand displacement activity and substrates at constant temperature (Parida, 2008) In our study, the amplification was not detected when the concentration of the template was 0.3 ng, however when the template concentration was in the range of 0.8-1.5 ng, amplifications occurred; therefore, it was thought that DNA concentration of 0.8 ng is the detection limit in N sativa Such type of results was also observed in the studies of P Ginseng (Sasaki, 2008) in which 0.5 ng of template was the detection limit The optimized reaction parameters that showed positive results were 10 ng template DNA, 10pmol of outer primers (F3 and B3), 60pmol of each of forward internal and backward outer primers (FIP and BIP), 20 mM reaction buffer, 10 mmMgSO4, 0.8 M betaine and 10 units of Bst DNA polymerase The optimum temperature for the reaction was set at 60°C, which is considered optimum for the activity of Bst DNA polymerase The use of LAMP markers for the authentication of medicinal plants, although is rare; however, there are some recent reports in which the technique has been successfully applied for the identification purposes and some of which include Curcuma longa (Sasaki and Nagumo; 2007), Panex ginseng (Sasaki, 2008), Catharanthus roseus (Choudhry, 2011) We have developed LAMP, a rapid, highly sensitive, and specific method for the authentication of N sativa The present study November – December 2013 Page 769 Mohd Asif et.al Indian Journal of Research in Pharmacy and Biotechnology could be applicable to identify N Sativa to differentiate the herb from the spurious and adulterated drugs sold in the market in the name of geniuine drugs Efforts are in progress to develop LAMP markers to medicinal plants in order to provide accurate method for authenticating the medicinal plants CONCLUSION ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online) based on RAPD analysis Genet Mol Res 9, 2010, 2412-2420 Kanter, M., Meral, I.,Dede, S., Effects of Nigella sativa L and Urticadioica L on lipid peroxidation, antioxidant enzyme systems and some liver enzymes in CCl4-treated rats J Vet Med Physiol Pathol Clin Med 50, 2003, 264268 LAMP technology could be efficiently used to characterize the medicinal plants like of N sativa By analysing the genetic profiling it is possible to identify the said drug; this information could be employed for identification of authenticN sativa devising from the spurious and adulterated drugs Khatoon, S., Mehrotra, S., Shome, U., Mehrotra, B.N., Analysis of commercial Ratanjot; by TLC fluorescence fingerprinting Int J Pharmacol 31, 1993, 269-277 ACKNOWLEDGMENTS MacBeath, G., Schreiber, S.L., Printing proteins as microarrays for high-throughput function determination Sci., 289, 2000, 1760-1763 This work was financed by the CCRUM, AYUSH, Ministry of Health and Family Welfare, Government of India REFERENCES Anonymous, The Useful Plants of India PID, CSIR, 1996, New Delhi Bamosa A.O, Ali B.A, Al-Hawsawi Z.A, The effects of thymoquinone on blood lipids on rats, Indian J Physio Pharmacol, 46, 2002, 195201 Chaudhary A.A, Hemant, Mohsin M, Ahmad A, Application of loop-mediated isothermal amplification (LAMP)-based technology for authentication of Catharanthus roseus (L.) G Don Protoplasma, 249, 2012, 417-422 Chaudhry N.M.A, Tariq P, In-vitro anti bacterial activities of Kalonji, Cumin and Poppy Seed Pak J Bot, 40, 2008, 461-467 Doyle J.J, Doyle J.J, Isolation of plant DNA from fresh tissue, Focus, 12, 1990, 13-15 Dubey N.K, Kumar R, Tripathi P, Global promotion of herbal medicine: India’s opportunity Curr Sci 86, 2004, 37-41 Ganie S.H, Srivastava P.S, Narula A, Ali Z, Sharma M.P., Authentication of shankhpushpi by RAPD markers Eurasia J Biosci, 6, 2012, 39-46 Hammad I, Qari S.H, Genetic diversity among Zygophyllum (Zygophyllaceae) populations IJRPB 1(6) www.ijrpb.com Kumble, K.D., Protien microarrays, new tools for pharmaceutical development Analyt Bio Chem 377, 2003, 812-819 Paarakh, P.M., Nigella sativa Linn.- A Comprehensive Review Ind J Nat Prod Resour 1, 2010, 409-429 Parida, M., Sannarangaiah, S., Dash, P.K., Rao, P.V.L., Morita, K., Loop mediated isothermal amplification (LAMP): a new generation of innovative gene amplification technique; perspectives in clinical diagnosis of infectious diseases Rev Med Virol 18, 2008, 407-421 Rivera-Arce, E., Gattuso, M., Alvarado, R., Zarate, E., Aguero, J., Feria, I., Lozoya, X., Pharmacognostical studies of the plant drug Mimosa tenuifloraecortex J Ethnopharmaco 113, 2007, 400-408 Sasaki, Y., Komatsu, K., Nagumo, S., Rapid detection of Panax ginseng by loop-mediated isothermal amplification and its application to authentication of Ginseng Biol Pharm Bull, 31, 2008, 1806-1808 Sasaki, Y., Nagumo, S., Rapid identification of Curcuma longa and C aromatic by LAMP Biol Pharm Bull, 30, 2007, 2229-2230 Schweitzer, B., Predki, P., Synder, M., Microarrays to characterize protein interactions on a whole-protoeme scale Proteomics 3, 2003, 190-199 Shaik Y.B, Castellani M.L, Perrella A, Conti F, Salini V, Tete S, Madhappan B, Vecchiet J, De Lutiis M.A, Caraffa A, Cerulli G, Role of quercetin (a natural herbal compound) in allergy November – December 2013 Page 770 Daisy Chella et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online) Fig : X-ray diffraction pattern of A) Pure Methotrexate B) Blank nanoparticle C) MTX-NaAlg-CS nanoparticle Fig 7a: Zero order release of MTX-NaAlg-CS nanoparticle Fig 7b : Korsmeyer-Peppas drug release kinetics of MTX-NaAlg-CS nanoparticle IJRPB 1(6) www.ijrpb.com November – December 2013 Page 920 Daisy Chella et.al Indian Journal of Research in Pharmacy and Biotechnology CONCLUSION Methotrexate loaded nanoparticles were prepared by the ionotropic pregelation method The FTIR, DSC, XRD pattern study did not detect any crystalline drug material in the freshly prepared freeze dried nanoparticles The application of factorial design gave a statistically systematic approach for the formulation of nanoparticles with desired particle size, high entrapment efficiency and % drug release Concentration of Drug , Polymers were found to influence the particle size, Entrapment efficiency and % drug release of MTX loaded NaAlg-CS nanoparticles The release was found to follow with non-Fickian diffusion mechanism for optimized batch These results indicate that MTX loaded NaAlg-CS nanoparticles could be effective in controlled drug release for a prolonged period would serve the purpose for long term treatment of Rheumatoid Arthritis ACKNOWLEDGEMENT The authors are thankful to Aptuit Pvt.Ltd, Hyderabad for providing gift sample of Methotrexate and India sea food , Cochin for Chitosan REFERENCES Adamo F, Cristina C, Giancarlo C, Antonio MR, Bimodal release of Olanzapine from lipid Microspheres, J Pharm Sci 99, 2010, 4251-4260 Barichello JM, Morishita M, Takayama K, Nagai T, Encapsulation of hydrophilic and lipophilic drugs in PLGA nanoparticle by the nano-precipitation method, Drug Dev Ind Pharm, 25,1999, 471 Bunjes H, Lipid nanoparticles for the delivery of poorly water soluble drugs, J Pharm Pharmacol, 62, 1996, 1637– 1645 Chellat F, Tabrizian M , Dumitriu S , Chornet E, Magny P, Rivard CH, et al In vitro and in vivo biocompatibility of chitosan–xanthan polyionic complex, J Biomed Mat Res, 51,2000,107–113 Chouhan, R., Bajpai, A.K, An in vitro release study of 5fluoro-uracil from swellable poly-(2-hydroxyethyl methacrylate) (PHEMA) nanoparticles, J Mater Sci Mater Med 20, 2009b, 1103–1114 Dervieux T, Furst D, Lein DO, Polyglutamation of methotrexate with common polymorphisms in reduced folate carrier, aminoimidazole carboxamide ribonucleotide transformylase, and thymidylate synthase are associated with methotrexate effects in rheumatoid arthritis, Arthritis Rheum ,50(9), 2004, 2766–2774 IJRPB 1(6) www.ijrpb.com ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online) Douglas KL,Tabrizian M, Effect of experimental parameters on the formation of alginate–chitosan nanoparticles and evaluation of their potential application as DNA carrier, J Biomat Sci, Polymer Edition, 1, 2005, 43–56 Fundueanu G, Nastruzzi C, Carpov A, Desbrieres J, Rinaudo M, Physico-chemical characterization of Caalginate microparticles produced with different methods Biomaterials, 20,1999, 1427 Gupta Jitendra, Prabakaran L, Gupta Reena, Govind Mohan, Nanoparticle formulation using counter-ion induced gellification Technique: In-vitro Chloramphenicol release, Int J Pharm Pharm Sci , (3), 2011, 66-70 Madan T, Munshi N, De TK, Maitra A, Sarma PU, Aggarwal SS, Biodegradable nanoparticles as a sustained release system for the antigens/allergens of Aspergillus fumigates, Preparation and characterization, Int J Pharm, 159, 1997,135 Mansouri S, Lavigne P, Corsi K , Benderdour M, Beaumont E , Fernandes JC ,Chitosan–DNA nanoparticles as non-viral vectors in gene therapy: Strategies to improve transfection efficacy, Eur J Phar Biopharm, 57,2004, 12 Mi FL , Sung W, Shyu SS, Drug release from chitosan– alginate complex beads reinforced by a naturally occurring cross-linking agent, Carbohydr Polym, 48, 2002, 61 Rajaonarivony M, Vouthier C, Couarrze G, Puisieux F, Couvreur P, Development of a new drug carrier made from alginate, J Pharm Sci, 82, 1993, 912‐917 Rama B, Shantha A, Optimization of Methotrexate Transdermal Patches: Effect of variables on In-Vitro, Ex Vivo permeation and Flux, Int J Pharm Sci Lett ,2 (2),2012, 53-59 Renu Singh Dhanikula, Patrice Hildgen, Influence of molecular architecture of polyether-co- Polyester dendrimers on the encapsulation and release of Methotrexate, Biomaterials, 28, 2007, 3140-3152 Suarez-Almazor ME, Belseck E, Shea B, Wells G, Tugwell P Methotrexate for rheumatoid arthritis, Cochrane Database Syst Rev, 2, 2000, CD000957 Varatharajan N, Lim IG, Ananda coomarasamy A, Methotrexate: long-term safety and efficacy in an Australian consultant rheumatology practice, Intern Med J, 39(4), 2009, 228–236 Yan XL , Khor E, Lim LY, Chitosan–alginate films prepared with chitosans of different molecular weights J Biomed Mat Res, 58, 2001, 358 November – December 2013 Page 921 Dinesh et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online) Strategies in Dendritic architecture for drug delivery – An over review Pandurangan Dinesh Kumar*1, Palanirajan Vijayaraj Kumar2, Govindaraj Saravanan3 1.Department of Biotechnology, Acharya Nagarjuna University, Guntur - 522510, Andhra Pradesh, India Faculty of Pharmaceutical Sciences, UCSI (University College Sadaya International) University, Jalan Menara Gading, 56000-Cheras, Kuala Lumpur, Malaysia 3.Bapatla College of Pharmacy, Bapatla - 522 101, Guntur (Dt), Andhra Pradesh, India E-mail: dineshclbaid@yahoo.co.in, dineshclbaid@gmail.com, Mobile: 99666 39425 ABSTRACT Dendrimers represent a novel class of structurally controlled macromolecules derived from a braches upon branches structural motif These consist of highly branched moieties that radiate from a central core and synthesizes through a stepwise repetitive reaction sequence In the field of pharmaceutical nanotechnology and medicinal chemistry dendrimers play a vital role based on the structural advantage such as size, shape, surface and interior chemistry flexibility and topology Dendrimers have emerged as highly gifted drug delivery molecule because of their exceptional structure and properties Solubility enhancement is an important aspect of dendrimers and this is a synergy with site specific drug delivery Solubilisations of hydrophobic drug molecule are easily achieved by the dendrimers because they were entrapped in hydrophobic channels Extracellular matrix of tissue particularly vascular tissue it contains a high concentration of negatively charged glycosaminoglycans which are involved in regulation of cell motility cell proliferation in the regulation of enzyme activity Extra cellular matrix can be used as a substrate for binding and retention of drug delivered intra vascularly Recently dendrimers have caused an explosion in biomedical science and created interest in the discovery of the drugs by virtue of their therapeutic value The dendrimer polymer suggest that they are promising drugs wound healing ,bone mineralization cartilage formation, tissue repairing topical treatment for AIDS to prevent HIV transmission It also acts as an anti prion, anti Alzheimer, anti coagulants, anti dots, anti inflammatory and anti cancer agents Key Words: Dendrimer, Nano-composites, Dendrimer conjugation, Dendrimer applications INTRODUCTION Dendrimer the name comes from the Greek “ɗevɗpov”/dendron meaning “tree” synonymous terms are arborols and cascade molecule (Buhleirier et al., 1978) Dendrimers are repeatedly branched molecules that are characterized by structural perfection This is based on the evolution of both symmetry and polydispersity the field of dendritic molecule can roughly be divided into Low molecular weight Molecular weight species The first category includes dendrimers and dendrons and the second includes dendronized polymers hyper branched polymers and brush polymers (called as bottle brushes) tailored forms and function ever realized outside of nature Structurally dendrimers posses distinct parts A core Branching units Branches It is usually produced in an interactive sequence of reaction steps, in each added lerative lead to a higher generation material The size of dendrimer can be described as a function of generation (Gn where n is 0, 0.5, 1.0, and 1.5) G is number of repetition cycles The molecular weight of the dendrimer nearly doubles with each additional generation (Tomalia et al., 2005) Furthermore, terminal groups can be modified to obtain both IJRPB 1(6) www.ijrpb.com hydrophilic or lipophilic function for the desired biological and drug delivery application (Bai et al., 2006) Following properties of dendrimer made them ideal molecule for drug delivery applications (Tomalia et al., 2007): a Nanoscale sizes that have similar dimensions to significant bio-building blocks, b Numbers of terminal surface groups (Z) appropriate for bioconjugation of drugs, signalling groups, targeting moieties or biocompatibility groups c Functional groups on the surfaces were designed to augment or resist trans-cellular, epithelial cell or vascular permeability d An interior void space was used to encapsulate drug molecule, metals, or imaging moieties and also reduces the drug toxicity and facilitates controlled release e Positive biocompatibility patterns that are coupled with lower generation anionic or neutral polar terminal surface groups f Low-immunogenicity with modified dendrimer surfaces by small functional groups or polyethylene glycol (PEG) Dendrimers a nano particle based drug delivery system have numerous applications in many fields such as supramolecular chemistry or host–guest chemistry (Elemans et al., 2002 and AlJamal et al., 2005), electrochemistry (Credi et al., November – December 2013 Page 922 Dinesh et.al Indian Journal of Research in Pharmacy and Biotechnology 2004), and photochemistry (Momotake et al., 2004), nanoparticle synthesis (Wu et al., 2006, Love et al., 2006 and Yan et al., 2006), pollution management (Xu et al., 2005, Diallo et al., 2005 and Arkas et al., 2006), dye decolorization (Cheng et al., 2005 and Cheng et al., 2005), preparation of monomolecular membranes (Karthaus et al., 1996, Sayed-Sweet et al., 1997 and Vladimir, 1998), curing of epoxy resins (Cheng et al., 2007), catalysis (Lee et al., 1994, Fujita et al., 1995, Bhyrappa et al., 1996 and Mak et al., 19970, drug delivery (Patri et al., 2002, Aulenta et al., 2003, D’Emanuele et al., 2004, Svenson et al., 2005 and Florence et al., 2005), and gene transfection (Dufes et al., 2005, Kim et al., 2006 and Bayele et al., 2006) In recent, dendrimers usage in drug delivery had attain great development and different types of dendritic macromolecules have been synthesized and investigated as a carrier for drug delivery (Patri et al., 2002), gene delivery (Schatzlein et al., 2005), targeting (Patri et al., 2005), solubilization (Gupta et al., 2006), diagnosis (Wiener et al., 1994), chemical catalysis (Wu et al., 2006) and as multivalent ligand for interesting biological applications (Heldt et al., 2004 and Svenson and Tomalia, 2005).This review article intends to provide the reader with a glimpse into the synthesis, types and important applications of dendrimers SYNTHESIS OF DENDRIMERS The first synthetic procedure towards well defined branched structures was reported by Vogel’s in 1978, who named this procedure a “cascade synthesis” In the early 1980’s, Denkewalter patented the synthesis of L-lysrine-based dendrimers (Denkewalter et al., 1981) The first dendritic structures that were exhaustively investigated and that received widespread attention were Tomalia’s PAMAM (polyamidoamine) dendrimers (Tomalia et al., 1990) and newkome’s “arborol” systems (Newkome et al., 1985) In the synthesis of dendrimers, monomers lead to a mono disperse polymer, tree like generational structure There are methods of dendrimer synthesis they are, Divergent synthesis Convergent synthesis Divergent synthesis: The dendrimer is prepared from the core as the starting point and built up generation by generation In the divergent reaction because of the incomplete reaction by end group will create structural defects which further prevent formation of next generation Divergent name is derived from the manner in which dendrimer grows outward from the core The higher generations of divergently constructed dendrimers always contain certain structural defects To prevent side reaction IJRPB 1(6) www.ijrpb.com ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online) and to force reactions to completion a large excess of reagent is required Convergent synthesis: The convergent synthesis starts from the surface and ends up at the core, where the dendrimer segments (dendron) are coupled together Two of these end tips are attached to a branched monomer to form a dendron and the process is repeated until a desired size is reached To the core molecule the interconnected branches are attached To synthesize dendrimers is difficult because a repeated reaction which consists of many steps is needed to protect the active site even in both methods That why these are obstacles to the synthesis of large quantities of dendrimers (Hawker et al., 1990) Other alternative preparation methods have been developed that aim to reduce the number of synthetic and purification steps and increase yields, such as the double-stage convergent growth approach (Labbe et al., 1996 and Ihre et al., 1998), double-exponential dendrimer growth approach (Kawaguchi et al., 1995), and orthogonal coupling (Zeng et al., 1996) TYPES OF DENDRIMERS Now days, dendrimers with different designed functionalities have become objects of particular academic and practical interest because of their unique superbranched structural, symmetrical shapes, good monodispersity and peripheral functionalities, Here, some of the dendrimers having different functionalities are briefly described PAMAM dendrimer: The PAMAM (polyamidoamine) dendrimers are synthesized up to generation 10 (G10) by the divergent method starting from ammonia or ethylene diamine initiation cone reagents (fig 1) They are constructed using a reiterative sequence consisting of a double Michael addition of methyl acrylate to a primary amino group followed by amidation of the resulting carbomethoxy intermediate with a large excess of ethylene diamine Many surface modified PAMAM dendrimers are non-immunogenic, high water solubility and modified terminal-arms amine functional groups for binding various targeting or guest molecules PAMAM dendrimers generally display concentration-dependent toxicity and haemolysis PAMAM dendrimers with their amide backbones undergo hydrolytically degradation at physiological temperatures only on harsh conditions (Lee et al., 2005) The internal cavities of PAMAM dendrimers with tertiary amines and amide linkages can host metals or guest molecules to produce a unique functional architecture PAMAM dendrimers are the most extensively reported moiety for almost all existing applications of dendrimers November – December 2013 Page 923 Dinesh et.al Indian Journal of Research in Pharmacy and Biotechnology Fig 1: PAMAM dendrimers PPI dendrimers: PPI (polypropyleneimines) dendrimers (fig 2) were created by Meijer at DSM of the Netherlands (DeBrabander-vandenBerg et al., 1993) PPI dendrimers up to generation are synthesized by the divergent method starting from 1, diamino butane They grow by a reiterative sequence consisting of (A) a double Michael addition of acryloritrile to the primary amino groups followed by (B) Hydrogenation under pressure in the presence of Raney cobalt Today, these PPI dendrimers are synthesized in large quantities by DSM and are commercially available DSM uses its own designation to describe its dendrimers, where the core is diaminobutane, dendrindictes the interior dendritic branch cell; and n is the number of end groups Liquid crystalline dendrimers: These are mesogenic (liquid crystalline) monomers e.g mesogen functionalized carbosilane dendrimers Functionalization of end group of carbosilane dendrimers with 36 mesogenic units, attached through a C-5 spacer, leads to liquid crystalline dendrimers that form broad smetic A phase in the temperature range of 17–130C (Lorenz et al., 1996) Boiko et al., had synthesized first photosensitive liquid crystalline dendrimer with terminal cinnamoyl groups (Boiko et al., 1996) They have confirmed the structure and purity of this LC dendrimer by 1H NMR and GPC methods Dendrimers under UV irradiation, can undergo E-Z isomerisation of the cinnamoyl groups and [2 + 2] photocycloaddition leading to the formation of a three-dimensional network Tecto dendrimers: Tecto-dendrimers are composed of a core dendrimer, which may or may not contain the therapeutic agent, surrounded by dendrimers of www.ijrpb.com different types, each type designed to perform a function necessary to a smart therapeutic nanodevice (Betley et al., 2002) The Michigan Nanotechnology Institute for Medicine and Biological Sciences (MNIMBS) are developing a tecto dendrimers which are used to perform the functions like diseased cell recognition, drug delivery, diagnosis of disease state, reporting location and outcome of therapy The future planning was to produce a smart therapeutic nanodevice for the diseased cell like a cancer cell or a cell infected with a virus Chiral dendrimers: In chiral dendrimers the construction of core was based on different constitution but with similar chemical branches Asymmetric catalysis and chiral molecular recognition are the main applications of chiral, nonracemic dendrimers (Ritzén and Frejd, 1999) PAMAMOS dendrimers: PAMAMOS (poly amidoamine-organosilicon) are radially layered, inverted unimolecular micelles that consist of hydrophilic, nucleophilic polyamidoamine (PAMAM) interiors and hydrophobic organosilicon (OS) exteriors These are exclusively useful for the preparation of honeycomb like networks with nanoscopic PAMAM and OS domains (Dvornic et al., 2000) Hybrid dendrimers: Hybrid dendrimers are combination of dendritic and linear polymers in hybrid block or graft copolymer forms The small dendrimer segment coupled to multiple reactive chain ends provides an opportunity to use them as surface active agents, compatibilizers or adhesives, e.g hybrid dendritic linear polymers (Jain and Khopade, 2001) Fig 2: PPI dendrimers IJRPB 1(6) ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online) Peptide dendrimers: Peptide dendrimers are defined as dendrimer containing peptides on the surface of the dendrimer frame work with amino acids as a branching (or) core unit Peptide dendrimers with their peptide molecule had excellent compatibility in biological and therapeutical levels make them a potential candidate for various drug delivery systems The main applications of the peptide dendrimers includes cancer, antimicrobials, antiviral, central nervous system, analgesia, asthma, allergy, Ca+2 metabolism, magnetic resonance imaging (MRI), magnetic resonance angiography (MRA), fluorogenic imaging and serodiagnosis (Bruckdorfer et al., 2004 and Crespo et al., 2005) Glycodendrimers: Dendrimers that incorporate carbohydrates into their structures are termed as glycodendrimers Glycodendrimers are three types (i) carbohydrate-coated; (ii) carbohydrate centered; and (iii) fully carbohydrate-based Glycodendrimers have been used to study the protein–carbohydrate November – December 2013 Page 924 Dinesh et.al Indian Journal of Research in Pharmacy and Biotechnology interactions that are in many intercellular recognition events The main applications of glycodendrimers are study of protein–carbohydrate interactions, incorporation into analytical devices, gel formulation, MRI contrast agents, and gene delivery systems (Colinger, 2002 and Turnbull and Stoddart, 2002) APPLICATIONS OF DENDRIMERS Dendrimers have attracted the most attention as potential drug delivery scaffolds due to their unique characteristics Dendrimers have narrow polydispersity; nanometer size range of dendrimers can allow easier passage across biological barriers Dendrimers can be used to deliver drugs either by encapsulating the drug in the dendrimer interior void spaces or by conjugation to surface functionalities All these properties make dendrimers as suitable carrier for drug delivery Dendrimers in transdermal drug delivery: Now day’s dendrimers had key role for the improvement transdermal drug delivery system In transdermal dosages drug delivery is difficult because of the hydrophobic nature and inefficient cell entry Highly water soluble dendrimer are designed which improve the drug solubility, plasma circulation, and entry to cells make efficiently delivery drug from transdermal formulation Non-steroidal anti-inflammatory drug (NSAIDs) used for acute and chronic rheumatoid and osteoarthritis are limited there clinical usage by adverse events such as dyspepsia, gastrointestinal bleeding and renal side effects when give orally Transdermal formulation will overcome adverse events and also provide good therapeutic blood level maintains for longer time But poor rate of transcutaneous delivery pulls down transdermal delivery system Drug permeation through the skin was enhanced by PAMAM dendrimer complex with NSAIDs (Ketoprofen, Diflunisal) as skin penetration enhancers Permeation studies on rat skin were carried out for ketoprofen and diflunisal drug High permeation was achieved by drug dendrimer complex (ketoprofen 3.4times and diflunisal 3.2times) when compared to drug Antinociception effect of ketoprofen shows that dendrimer complex reduced writhing for period 1-8hr but drug reduced writhing up to 4-6hr In another study indomethacin and PAMAM dendrimer investigated (Chauhan et al., 2003) In-vitro and in-vivo studies were carried out IJRPB 1(6) www.ijrpb.com ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online) for PAMAM dendrimer complex In-vivo pharmacokinetic and pharmacodynamic studies in Wistar rats showed that significant higher concentration and effective concentration could be maintain for 24h in blood by G4 dendrimer indomethacin transdermal formulation Various transdermal penetration enhancers based on chemical and physical approach were carried out chemical penetration enhancers such as sulfoxide, oxazolidionesis, fatty acids essential oil, pyrrllidoions, terpenes and terpenoirds were used Inotophoresis, electrophoresis, ultrasound, gel and patch are physical penetrates which used to exchange absorption of drug (Pathan and Setty, 2009, Santander-Ortega et al., 2010 and Shembale et al., 2012) Recently Zhao et al., conjugated PEGylated PAMAM dendrimers for transdermal delivery of bioactive molecules delivery of bioactive by pretreatment or co treatment technique using different vehicle lime water, chloroform isopropyal myristal chloroform water mixture and octanal water mixture emulsion Further he reviewed the three different mechanisms which use to deliver the bioactives (Sun et al., 2012) In another study Welowie et al., used that PAMAM dendrimers to conjugate 8-methoy psiralae (a photo sentizier for puva therapy) Here solubility of 8-methoxypsiralane PAMAM conjugate increased Moreover in another study solubility of riboflavin was enhanced with increase in generation of PAMAM dendrimers Moreover diffusion of riboflavin in pig ear skin was enhancing with increase in generation (Borowska et al., 2010) Moghmin et al., show that furful permeation enhances through rat skin model using pamam dendrimers (G5) in water vehicle by pretreatment (Moghimi et al., 2010) Yang et al., reported that smaller G2 pamam dendrimers penetrate the skin layers more efficiently than the larger ones (G4) Increased skin absorption and retention were produced by G2 dendrimeric olic acid conjugates because of their increase in partition coefficient Here permeation across skin layers is directly based on the size, surface charge and hydrophobicity of PAMAM dendrimers (Yang et al., 2012) November – December 2013 Page 925 Dinesh et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online) Fig 3: Schematic representation of the internalization mode of PAMAM dendrimers with different surface attachments (Yang et al., 2012) In transdermal applications nanoparticles (polysacchird and dendrimers) are used to increase the potential of transdermal drug delivery system Permal and co had extensive research work on dendrimer application in transdermal system they reveal that physico chemical properties of dendrimers play a vital role in delivery of drug by increase the penetration (Venuganti et al., 2009) Therefore data suggested that dendrimer drug complex make transdermal delivery system was effective and might be a safe and efficacy method for treating different diseases (Cheng et al., 2007) Dendrimers in oral drug delivery: Traditional Oral drug-delivery system has been the dominant route for many years because of its significant advantages A major challenge for drugs is the possibility of oral delivery, but main drawback was the limited drug transport across the intestitinal epithelium due to their large size relative to the tight epithelial barrier of the gastrointestinal tract Duncan’s and his research group showed that macromolecules of 3nm diameters could penetrate through the rat’s intestinal membranes, which allows G2.5-G3.5-PAMAM dendrimers to transport across the intestine (Duncan and Izzo, 2005) Moreover the acidic nature of the GI-tract enzymes and stomach can affect the drug and the nanocarrier D’Emanuele group investigated effect of dendrimer generation and conjugation on the cytotoxicity, permeation and transport mechanism of surfacemodified cationic G3-PAMAM propranolol dendrimer conjugation across Caco-2 cell monolayers (D’Emanuele et al., 2004) They suggested that the route of propranolol transport was initially transcellular, while the conjugate was able to bypass the P-gp efflux transporter, and they arrived as the same inference as above concerning the penetration pathway of the intestinal membrane Najlah investigated transepithelial permeability of IJRPB 1(6) www.ijrpb.com naproxen, a low solubility drug (Najlah et al., 2007) Stability studies of G0 PAMAM conjugates in 50% liver homogenate was compared to that in 80% human plasma showed the lactate ester linker gave prodrug of elevated stability in plasma with sluggish hydrolysis in liver homogenate So, these conjugations exhibit potential nanocarriers for the enrichment of oral bioavailability The Cheng and Xu group, reviewed that a PAMAM dendrimer complex of the anti-inflammatory drug ketoprofen sustained antinoninceptive activity (inhibit rate > 50%) until h of oral administration to Kunming mice, whereas this activity was absent with the free drug after h (Na et al., 2006) Increase in permeability and cellular uptake was produced by G4- PAMAM 7-ethyl-10-hydroxycamphtothecin complexation with respect to free 7-ethyl-10hydroxycamphtothecin They reported that complex has the potential to improve the oral bioavailability of drug Lin et al., carried out study on effects of PAMAM dendrimer in intestinal absorption of poorly absorble drug such as 5(6)- carboxyfluorsin isothicynate dextran, calctitonin and insulin in rat (Lin et al., 2011) Drug carboxylorescin and calcitonin showed increase in absorption in rats small intestine for 0.5%w/v G2 PAMAM dendrimer complex But fluorescine isothiocynate dextran and insulin had not produced any desirable effects Moreover absorption in small intestine is mainly base on molecular weight of drug ie the molecular weight of drug increase absorption of drug decreases Recently Kolhatkar et al., explored oral delivery of SN – 38 (a potent topisomers –I inhibtor) and active metabolize of irinotecan hydrochloride (cpt-11) was improved by conjugation with G4 PAMAM dendrimer.10 fold increase in caco3 cell monolayer and 100 fold increase in cellular uptake November – December 2013 Page 926 Dinesh et.al Indian Journal of Research in Pharmacy and Biotechnology by SN-38 and G4 PAMAM dendrimer than plain drug (Kolhatkar et al., 2008) Dendrimers in targeted drug delivery: Targeted drug delivery system had fetched great importance in the pharmaceutical field mainly because it create wide scope in utilization of existing drug and reduced in draw backs In treatment of cancer and tumour existing drug molecules are ineffective because of the cytotoxicity nature The main reason for cytotoxicity is low molecule weight and high pharmacokinetic volume of distribution, quick elimination, so high dose of drug is required for the desired therapeutic effect which ultimately leads to high toxicity and unwanted harmful effects, moreover when these drug administered alone will develop high resistance and lack of specification will produce toxicity effect on the other healthy cells Further these chemopathetic drugs had poor solubility and low bioavailability Moreover these drug formulations are formulated with toxic solvents to produce effect dosage forms Above mentioned problems are overcome by the usage dendrimers as a carrier for delivery the drug in targeted manner Dendrimers are able to produced specific targeting of drug to cells and thereby improving efficacy minimising side effects Various research works are carried to prove that dendrimers can able to deliver the drug to the targeted tissue in controlled manner Cisplatine was conjugate with pamam dendrimer by Malik et al (Malik et al., 2000) The conjugate shows increased solubility, reduced toxicity and EPR properties It was observed that this formulation showed superior activity over cisplatin when injected into mice bearing B16F10 tumor cells Doxorubicin is complexed with 2-3-bis (hydro methyl) proxamic acid dendrimers and characterise for in-vitro and in-vivo studies The complexation of drug with dendrimer mainly by covalently bond through hydrazone linkage to high molecule weight 3-arm polyethylene oxide, exhibits reduced cytotoxicity in-vitro But in-vivo studied shows minimum accumulation in vital organs and increase half life for conjugate drug compared to free drug Jesus and group had concluded that dendrimer formulation increase half life of the drug and there reduced the amount of drug administered (De Jesus et al., 2002) The in-vivo characterize in the mice of dendrimer conjugate should increased solubility, reduced toxicity and EPR properties when compared with free drug Dendrimer conjugate of Cisplatine produced superior activity in targeted manner when compared with free drug Poly amide amine dendrimers was conjugated with 1-bromoacetyl-5flurouracil to produce dendrimer 5Fu-conjugates IJRPB 1(6) www.ijrpb.com ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online) Zhou et.al demonstrated that release of the drug from the dendrimer was base on generation and further indicates that dendrimer are promising drug for targeted drug delivery (Zhuo et al., 1999) Dendrimer conjugates showed good elimination compared with drug in in-vitro studies carried out in the mice by Lee group Doxurubin model drug was conjugated with polyester based dendrimer Dendrimer-PEO-doxorubine conjugate inhibit the growth of C-26 tumor which was implanted subcutaneously in mice (Lee et al., 2006) Anti-cancer drugs 5-Flurouracil was conjugated with pamam dendrimer to measure its activity through blood level studies in the mice Dendrimer formulation had increase drug loading capacity and stability with reduction hemolytic toxicity (Bhadre et.al 2003) In another study by Asthan in 2005 had confirmed that pamam dendrimer had increase residence time, good stability and increase the half life of drug They perform in-vivo studies in rat with flurbiprofan loaded pamam dendrimer conjugates which reveals that drug release from dendrimer is rapid in initial and slow release in latter stage (Asthana et al., 2005) In the same year imaging and targeting of tumor cells by using pamam dendrimer was carried out by the choi groups They formulated pamam dendrimer conjugated with folic acid as targeted drug fluorescein isothiocyanate as imaging agent by oligonucleotides linkage They conform that dendrimers can be used as imagine and drug targeting simultaneously (Choi et al., 2005) The galactose linked PPI dendrimer was conjugated with primaquine phosphate and subjected for in-vivo testing to find out accumulation in the rat liver Galactose linked PPI dendrimer with primaque phosphate showed less accumulation in the liver which compared the free drug and uncoated PPI dendrimer These results had showed that coating of PPI dendrimer can improve the effective delivery of drug and reduced toxicity there by increasing the stability (Bhadra et al., 2005) Kukowska-Lattalo et al synthesis the dendrimers conjugated with folic acid and methotrexate An in-vivo study in mice was carried out to conclude that dendrimer conjugated are more effective then free drug In confocal microscopic image showed consider numbers of cells are targeted by dendrimeric conjugate and this results where further confirmed by analysis of isolated tumour cells (Kukowska-Latallo et al., 2005) Doxorubicin was taken as model drug and conjugated with 6th generation cationic poly-Llysine dendrimers The dendrimer conjugate had a increase penetration and delay in growth of prostate 3D multicellular tumor spheroids (MTS) compared November – December 2013 Page 927 Dinesh et.al Indian Journal of Research in Pharmacy and Biotechnology with free drug (Khuloud et al., 2013) Xiangyang Shi et al., had synthesis conjugate of pamam dendrimer with anti cancer drug 2-methoxyestradiol The dendrimer conjugated release drug in sustained manner and specifically targeted the cancer cells in MTT assay This study makes dendrimer as one of the novel carrier for anticancer drug (Yin et al., 2011) Umesh Gupta et al., explore potential delivery activity PPI dendrimer and folated conjugated PPI dendrimer Doxorubine was used as model drug The folate conjugated PPI shows faster drug release in acidic environment and high cell uptake in MCFT cancer cell line compared with PPI dendrimer So it had been conclude that folic acid conjugated PPI dendrimer are better carrier agents (Gupta et al., 2010) Garcia-vallejo et al., synthesis pamam dendrimer conjugated with leb The ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online) characterisation of dendrimer conjugated showed enhanced binding, optimal internalisation, increase lysosomal delivery, increase antigen presentation and cytokine response It had been conclude that dendrimer can be used for targeting peptide antigen cancer immunotherapy, auto immunity and infectious disease (García-Vallejo et al., 2013) Pamam dendrimer of generation 5th was conjugated with N-acetylgalactosamine via peptide and thiourea linkage Hepatic cell line studies showed that dendrimer conjugated had increase cellular uptake by ASGPR mediated endocytosis Moreover increase in concentration of dendrimer produced more effective cell targeting The dendrimer conjugated produced Michaelis menten kinetics It had concluded that dendrimer conjugate are effectively used as targeted carrier for hepatic targeting (Scott et al., 2011) Fig 4: A schematic drawing showing the composition of a drug-loaded G5-NAcGal conjugate binding to the ASGPR expressed on the surface of hepatic cancer cells (e.g HepG2), which triggers receptor-mediated endocytosis of these G5-NAcGal conjugates followed by endosomal escape and release of the therapeutic cargo into the cytoplasm while the ASGPR recycles back to the cell surface (Scott et al., 2011) Anupama et al., synthesized 4.0 G PAMAM dendrimer and conjugated with Gallic acid [GA] for cancer targeted drug delivery system (Anupama et al., 2011) The Cytotoxicity study in MCF-7 cell line showed dendrimer conjugates had showed increase activity on cells Dendrimers in gene delivery: Gene therapy is one novel approach to cure the chronic disease In this therapy the defective gene which is responsible for the over expression or under expression corrected The gene therapy is mainly based on vector used because it will decide the success of gene therapy Dendrimers are ideal vector in the gene delivery Dendrimer are more stable, monodispersity, generation, modification in terminal and size of the dendrimer are controlled Above mention properties made the dendrimer as one the vital carrier for the gene delivery IJRPB 1(6) www.ijrpb.com Pamam starburst dendrimers were complexed with DNA through ethidium bromide As the generation of the dendrimers increase the DNA regions also increase (Kukowska-Latallo et al., 2000) Kukowska-catallo et al synthesised G9 pamam dendrimer pCF1CAT plasmid complex Intravenous administration of dendrimer complex in rat show high level of expressions in lung tissues In another study a cyclodextrin surfaced G5 pamam dendrimer conjugate were produced by Kihara et al (Kihara et al., 2003) High level transgene expression was reported in intravenous administration in rat In the same manner Wade et al developed manner coated pamam dendrimers as new transgene vector (Wada et al., 2005) In vitro studies should that mannose coated dendrimer conjugates showed high transfection dendrimer Mamede et al., used 111In-oligo/G4100 and 111In-oligo/G4-bt- November – December 2013 Page 928 Dinesh et.al Indian Journal of Research in Pharmacy and Biotechnology Av100 as gene transfer vectors and in vivo biodistribution evaluation showed more accumulation in kidney and lung when compare to liver (Mamede et al., 2004) Furthers authors summarized that the positively charged DNA/dendrimer complexes condensed to form complexes of several nanometres and resulted in uptake by lung tissues A study by Schatzlein et al., showed surface treatment of PPI dendrimers with methylated quaternary amines improved the DNA complexation and decreased cytotoxicity (Schatzlein et al., 2005) PPI dendrimers of various generation acts as transfection agents and target gene efficiently expressed in the liver were studied by Dufes and groups (Dufes et al., 2005) They demonstrated that intravenous administration of a gene medicine and G3 PPI dendrimer complex could result in intratumoural transgene expression and regression of the established tumours in all animals Arginine peptide dendrimer of 5th and 6th generation was developed by Zhongwei group Further characterization of dendrimer conjugates showed high transfection and high biosafety compared branched polyetherimide (PEI) on all cells in breast tumor models (Kui et al., 2012) Another study by Bing and co synthesized β-cyclodextrin complexed PAMAM dendrimer with human neuroblastoma SH-SY5Y cells Dendrimer conjugates showed low cytotoxicity and high transgene activity compared with PAMAM (G 4)/pDNA complex (Bing et al., 2013) A comparative study was carried out by Ajay and co between PAMAM G4 dendrimers and the surface modified dendrimers was conducted in HEK 293T, GM7373 and NCI H157G cell lines in gene transfer (Ajay et al., 2010) Effect of excess of ornithine (100µM) on transfection efficiency of the ornithine-conjugated PAMAMG4 dendrimers was investigated in separate experiment Transfection efficiency of PAMAMG4-ORN60 dendrimer complex was slightly higher in cancer cells (NCI H157G) as compared to HEK 293T cells Transfection efficiency of the PAMAMG4-ORN60 dendrimers decreased in presence of excess of ornithine while there was no effect on the parent PAMAMG4 dendrimers Jose et al., produced conjugates of plasmid DNA and PAMAM dendrimer G5 for gene delivery (Jose et al., 2010) Further characterization of dendrimer conjugates showed high efficiency in the gene expression Kui et al., synthesis different generations of dendritic poly(L-lysine) vectors for in vitro gene transfection (Kui et al., 2011) The higher generations tended to produce the greater positive potentials, indicating a stronger potency of the IJRPB 1(6) www.ijrpb.com ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online) complexes to interact with negatively charged cell membranes Dendrimer conjugates of 5th generation showed good biocompatibility and higher efficiency transfection compared with other generation dendrimer complex Based on these results, we concluded that dendrimers were one of promising gene vectors which might be able to deliver gene into liver, spleen, lung, kidney, and even the tumor at therapeutic levels Dendrimers in pulmonary drug delivery: Bai and groups investigated Enoxaparin PAMAM dendrimers complex for pulmonary drug delivery (Bai et al., 2006) In this research enoxparinPAMAM dendrimer complex were formulated and evaluated for the drug enachment The dendrimer formulation was administered into lungs of anaesthetized rats and drug absorption was observed by measuring plasma anti-factor Xa activity, and by observing prevention efficacy of deep vein thrombosis in a rodent model Bioavailability of enoxaparin was increased to 40% in G2 and G3 PAMAM dendrimers which are positively charged They reported that positively charged dendrimers are suitable carrier for pulmonary delivery of Enoxaparin Seabrook and coworkers described the boosting effect with intranasal dendrimeric Aβ1-15 (16 copies of Aβ1-15 on a lysine tree) but not Aβ115 peptide affording immune response following a single injection of Aβ1-40/42 in heterozygous APPtg mice (Seabrook et al., 2006) Inapagolla et al., carried study on in-vivo efficacy of methylprednisolon conjugate G4 PAMAM dendrimers showed good lung anti inflammation potency (Inapagolla et al., 2010) Further methylprednisolon-G4-PAMAM dendrimers conjugate at the dose of 5mg/kg improved the airway delivery in pulmonary inflammatory model based on a 11 fold enchament of eosinophil lung accumulation following five daily inhalation exposure of sensitized mice to allergen and albumin Here allergen induced inflammation reduced by drug loaded dendrimer conjugate was mainly base on improved drug residence time in the lung Dong et al., carried out invivo pulmonary absorption on for G0-G3 PAMAM dendrimers conjugates of insulin and calction Here absorption of insulin and calction was increased by PAMAM dendrimers conjugates Moreover absorption rate was increased as generation of PAMAM increases (Dong et al., 2010) To target regional lung deposition dendrimers emerged has very powerful carries in nano size Review paper by carvalho et al., and choi November – December 2013 Page 929 Dinesh et.al Indian Journal of Research in Pharmacy and Biotechnology et al., has explained the important and influence of particle size, charge, and coating on lung deposition (Carvalho et al., 2011 and Choi et al., 2010) Dendrimers did posses characteristic to emerge as nanocarrier for delivery bioactives through inhalation route CONCLUSION The application of dendrimers to drug delivery system has experienced rapid growth Dendrimers are expected to play key role in pharmaceutical field as drug carriers Dendrimers role in the biomedical applications is widely expanded The supramolecular properties of the dendrimers made them major agent to delivery drugs and other function As per reviewed in this article dendrimers are widely used in encapsulation various drugs and to deliver the drug to the targeted site More over high level of controllable features of dendrimers such as size, shape, branching length and surface modifications make them an ideal drug carrier Further dendrimers offer generation number and terminal groups and the chance to introduce two or more functional group types at the periphery are mammoth advantages of dendrimers over polymers Few drawbacks like toxicity, localization, biodistribution and costly synthesis step pull them down In spite of above drawbacks, several dendrimers have already been commercialized, and some are in clinical trials To make dendrimers commercial successful tool for drug delivery more research work has to be done on cost effective synthesis, toxicity reduction and drug conjugation As reviewed in this article dendrimer moiety hold great promise and potential tool for drug delivery system REFERENCE Ajay K, Venkata KY, Gareth ED, Strychar KB, Srinath P, Enhanced gene transfection efficiency by polyamidoamine (PAMAM) dendrimers modified with ornithine residues, Int J Pharm, 392, 2010, 294–303 Al-Jamal KT, Ramaswamy C, Florence AT, Supramolecular structures from dendrons and dendrimers, Adv Drug Deliv Rev, 57, 2005, 2238– 2270 Anupama S, Surya PG, Arun KG, Surface modified dendrimers: Synthesis and characterization for cancer targeted drug delivery, Bioorganic & Medicinal Chemistry, 19, 2011, 3341–3346 Arkas M, Allabashi R, Tsiourvas D, Mattausch EM, Perfler R, Organic/Inorganic Hybrid Filters Based on Dendritic and Cyclodextrin ‘‘Nanosponges’’ for the Removal of Organic Pollutants from Water, Environ Sci Technol, 40, 2006, 2771– 2777 IJRPB 1(6) www.ijrpb.com ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online) Asthana A, Chauhan AS, Diwan PV, Jain NK, Poly(amidoamine) (pamam) dendritic nanostructures for controlled site specific delivery of acidic anti-inflammatory active ingredient, AAPS Pharm Sci Tech, 6, 2005, E536–E542 Aulenta F, Hayes W, Rannard S, Dendrimers: A new class of nanoscopic containers and delivery devices, Eur Polym J, 39, 2003, 1741–1771 Bai S, Thomas C, Rawat A, Ahsan F, Recent progress in dendrimer-based nanocarriers, Crit Rev Ther Drug Carrier Syst, 23, 2006, 437–495 Bai S, Thomas C, Rawat A, Ahsan F, Recent progress in dendrimer-based nanocarriers, Crit Rev Ther Drug Carrier Syst, 23, 2006, 437–495 Bayele HK, Ramaswamy C, Wilderspin AF, Srai KS, Toth I, Florence AT, Protein transduction by lipidic peptide dendrimers, J Pharm Sci, 95, 2006, 1227–1237 Betley TA, Hessler JA, Mecke A, Banaszak Holl, MM, Orr BG, Uppuluri S, Tomalia, DA, Baker JR, Tapping mode atomic force microscopy investigation of poly(amidoamine) core–shell tecto(dendrimers) using carbon nanoprobes, Langmuir, 18, 2002, 3127–3133 Bhadra D, Bhadra S, Jain S, Jain NK, A PEGylated dendritic nanoparticulate carrier of fluorouracil, Int J Pharm, 257, 2003,111–124 Bhadra D, Yadav AK, Bhadra S, Jain NK, Glycodendrimeric nanoparticulate carriers of primaquine phosphate for liver targeting, Int J Pharm, 295, 2005, 221-233 Bhyrappa P, Young JK, Moore JS, Suslick KS, Dendrimer-metalloporphyrins: Synthesis and catalysis, J Am Chem Soc, 118, 1996, 5708–5711 Bing L, Jun JD, Fang Y, Ning Y, Wei L, Jian RY, Shu Xiang Pu, Long CX, Cong G, Li MZ, Efficient gene transfection in the neurotypic cells by starshaped polymer consisting of β-cyclodextrin core and poly(amidoamine) dendron arms, Carbohydrate Polymers, 94, 2013, 185–192 Boiko N, Zhu X, Bobrovsky A, Shibaev V, First photosensitive liquid crystalline dendrimer: synthesis, phase behavior, and photochemical properties, Chem Mater, 13, 1996, 1447–1452 Borowska K, Laskowska B, Magon AM, Pyda M, Wolowiec S, PAMAM dendrimers as solubilizers and hosts for 8-methoxypsoralene enabling transdermal diffusion guest, Int J Pharm, 398, 2010, 185–189 Bruckdorfer T, Marder O, Albericio F, From production of peptides in milligram amounts for November – December 2013 Page 930 Dinesh et.al Indian Journal of Research in Pharmacy and Biotechnology research to multi-tons quantities for drugs of the future, Curr Pharm Biotechnol, 5, 2004, 29–43 Buhleirier E, Wehner W, Vogtle F, Cascade and non-skid – chain like” synthesis of molecule cavity topologies, Synthesis, 2, 1978, 155-158 Carvalho TC, Peters JI, Ill ROW, Influence of particle size on regional lung deposition — what evidence is there?, Int J Pharm, 406, 2011, 1–10 Chauhan AS, Sridevi S, Chalasani KB, Jain AK, Jain SK, Jain NK, Diwan PV, Dendrimer-mediated transdermal delivery: enhanced bioavailability of indomethacin, J Control Release, 90, 2003, 335– 343 Chen W, Turro NJ, Tomalia DA, Using ethidium bromide to probe the interactions between DNA and dendrimers, Langmuir, 16, 2000, 15-19 Cheng Y, Man N, Xu T, Fu R, Wang X, Wang X, Wen L, Transdermal delivery of nonsteroidal antiinflammatory drugs mediated by polyamidoamine (PAMAM) dendrimers, J Pharm Sci, 96, 2007, 595– 602 Cheng YY, Chen DZ, Fu RQ, He PS, Behavior of polyamidoamine dendrimers as curing agents in bisphenol a epoxy resin systems, Polym Int, 54, 2005, 495–499 Cheng YY, Xu TW, Fu RQ, Polyamidoamine dendrimers used as solubility enhancers of ketoprofen, Eur J Med Chem, 40, 2005, 1390–1393 Cheng YY, Xu TW, He PS, Polyamidoamine (PAMAM) dendrimers as curing agents: The optimum PAMAM concentration selected by dynamic torsional vibration method and thermogravimetric analyses, J Appl Polym Sci, 103, 2007, 1430– 1434 Choi HS, Ashitate Y, Lee JH, Kim SH, Matsui A, Insin N, Bawendi MG, Semmler-Behnke M, Frangioni J, Tsuda A, Rapid translocation of Nanoparticles from lung airspaces to the body, Nat Biotechnol, 28, 2010, 1300–1304 Choi Y, Thomas T, Kotlyar A, Islam MT, Baker JR, Synthesis and functional Evaluation of DNAassembled polyamidoamine dendrimer clusters for cancer cell-specific targeting, Chem Biol, 12, 2005, 35–43 Colinger M, Biological applications of dendrimers, Curr Opin Chem Biol, 6, 2002, 742–748 Credi A, Ribera BF, Venturi M, From supramolecular electrochemistry to molecular-level devices, Electrochim Acta, 49, 2004, 3865–3872 ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online) Crespo L, Sanclimens G, Pons M, Giralt E, Royo M, Albericio F, Peptide and amide bond-containing dendrimers, Chem Rev, 105, 2005, 1663–1681 D’Emanuele A, Jevprasesphant R, Penny J, Attwood D, The use of a dendrimer–propranolol prodrug to bypass efflux transporters and enhance oral bioavailability, J Control Release, 95, 2004, 447– 453 D’Emanuele A, Jevprasesphant R, Penny J, Attwood D, The use of a dendrimer–propranolol prodrug to bypass efflux transporters and enhance oral bioavailability, J Control Release, 95, 2004, 447– 453 De Jesus OLP, Ihre HR, Gagne L, Frechet JMJ, Szoka FC, Polyester dendritic systems for drug delivery applications: In vitro and in vivo evaluation, Bioconjug Chem, 13, 2002, 453–461 DeBrabander-VandenBerg EMM, Meijer EW, Poly(propyleneimine) Dendrimers: Large scale synthesis by hetereogeneously catalyzed hydrogenations Angew Chem Int Ed Engl, 32, 1993, 1308–1311 Denkewalter RG, Kolc J, Lukasavage WJ, Macromolecular highly branched homogeneous compound based on lysine units, Untied states patent, US Patent 4289872, 1981 Diallo MS, Christie S, Swaminathan P, Johnson JH, Goddard WA, Dendrimer enhanced ultrafiltration Recovery of Cu(II) from aqueous solutions using PAMAM dendrimers with ethylene diamine core and terminal NH2 groups, Environ Sci Technol, 39, 2005, 1366–1377 Dong Z, Katsumi H, Sakane T, Yamamoto A, Effects of polyamidoamine (PAMAM) dendrimers on the nasal absorption of poorly absorbable drugs in rats, Int J Pharm, 30, 2010, 244–252 Dufes C, Keith WN, Bilsland A, Proutski I, Uchegbu IF, Schatzlein AG, Synthetic anticancer gene medicine exploits intrinsic antitumor activity of cationic vector to cure established tumors, Cancer Res, 65, 2005, 8079–8084 Dufes C, Uchegbu IF, Schatzlein AG, Dendrimers in gene delivery, Adv Drug Deliv Rev, 57, 2005, 2177–2202 Duncan R, Izzo L, Dendrimer biocompatibility and toxicity, Adv Drug Deliv Rev, 57, 2005, 2215–2237 Dvornic PR, De-Leuze-Jallouli AM, Owen MJ, Perz SV, Radially layered poly(amidoamineorganosilicon) dendrimers, Macromolecules, 33, 2000, 53–66 Elemans JAAW, Boerakker MJ, Holder SJ, Rowan AE, Cho W-D, Percec V, Nolte RJM, IJRPB 1(6) www.ijrpb.com November – December 2013 Page 931 Dinesh et.al Indian Journal of Research in Pharmacy and Biotechnology Supramolecular chemistry and self-assembly special feature: Plastic- and liquid-crystalline architectures from dendritic receptor molecules, PNAS, 99, 2002, 5093–5098 Florence AT, Preface — Dendrimers: A versatile targeting platform, Adv Drug Deliv Rev, 57, 2005, 2104–2105 Fujita M, Oguro D, Miyazawa M, Oka H, Yamaguchi K, Ogura K, Self-assembly of ten molecules into nanometre-sized organic host frameworks, Nature, 378, 1995, 469–471 García-Vallejo JJ, Ambrosini A, Overbeek A, van Riel H, Bloem K, Unger WWJ, Chiodo F, Bolscher JG, Nazmi K, Kalay H, van Kooyk Y, Multivalent glycopeptide dendrimers for the targeted delivery of antigens to dendritic cells, Mol Immunol, 53, 2013, 387-397 Gupta U, Agashe HB, Asthana A, Jain NK, Dendrimers: Novel Polymeric Nanoarchitecture for Solubility Enhancement, Bio macromolecules, 7, 2006, 649-658 ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online) poly(amidoamine) dendrimers with hydrophobic chains for improved gene delivery in mesenchymal stem cells, J Control Release, 144, 2010, 55–64 Karthaus O, Ijoro K, Shimomura M, Hellmann J, Irie M, Monomolecular layers of diarylethenecontaining dendrimers, Langmuir, 12, 1996, 6714– 6716 Kawaguchi T, Walker KL, Wilkins CL, Moore JS, Double exponential dendrimer growth, J Am Chem Soc, 117, 1995, 2159–2165 Khuloud TA, Wafa TA, Julie TW, Wang, Noelia R, Joanna B, David G, Mire Z, Kostas K, Cationic poly-L-lysine dendrimer complexes doxorubicin and delays tumor growth in vitro and in vivo, ACS Nano, 7, 2013, 1905-1917 Kihara F, Arima H, Tsutsumi T, Hirayama F, Uekama K, In vitro and in vivo gene transfer by an optimized α-cyclodextrin conjugate with polyamidoamine dendrimer, Bioconjug Chem, 14, 2003, 342–350 Gupta U, Dwivedi SK, Bid HK, Konwar R, Jain NK, Ligand anchored dendrimers based nanoconstructs for effective targeting to cancer cells, Int J Pharm, 393, 2010, 185–196 Kim J, Choi J, Nam K, Lee M, Park J, Lee J, Enhanced transfection of primary cortical cultures using arginine-grafted PAMAM dendrimer, PAMAM-Arg, J Control Release, 114, 2006, 110– 117 Hawker CJ, Fréchet JMJ, Preparation of polymers with controlled molecular architecture A new convergent approach to dendritic macromolecules, J Am Chem Soc, 112, 1990, 7638–7647 Kolhatkar RB, Swaan P, Ghandehari H, Potential oral delivery of 7-ethyl-10- hydroxy-camptothecin (SN-38) using poly(amidoamine) dendrimers, Pharm Res, 25, 2008, 1723–1729 Heldt JM, Durand NF, Salmain M, Vessieres A, Jaouen G, Prepration and charactyerization of poly(amidoamine) dendrimers functionalized with a rhenium carbonyl complex and PEG as new IR probes for carbonyl metallo immunoassay, J Organometallic chem, 689, 2004, 4775-4782 Kui L, Caixia L, Gang W, Yu N, Bin H, Yao W, Zhongwei G, Peptide dendrimers as efficient and biocompatible gene delivery vectors: Synthesis and in vitro characterization, J Control Release, 155, 2011,77–87 Ihre H, Hult A, Fréchet JMJ, Gitsov I, Double-stage convergent approach for the synthesis of functionalized dendritic aliphatic polyesters based on 2,2-bis(hydroxymethyl)propionic acid, Macromolecules, 31, 1998, 4061–4068 Inapagolla R, Guru BR, Kurtoglu YE, Gao X, LiehLai M, Bassett DJP, Kannan RM, In vivo efficacy of dendrimer-methylprednisolone conjugate formation for the treatment of lung inflammation, Int J Pharm, 339, 2010, 140–147 Jain NK, Khopade AJ, Dendrimers as potential delivery systems for bioactives in: Jain, N.K (Ed.), Advances in controlled and novel drug delivery New Delhi: CBS Publishers & Distributors; 2001, p 361–380 Jose LS, Hugo O, Deepti P, Joao R, Ana PP, Pedro LG, Helena T, Functionalization of IJRPB 1(6) www.ijrpb.com Kui L, Caixia L, Li L, Wenchuan S, Gang W, Zhongwei G, Arginine functionalized peptide dendrimers as potential gene delivery vehicles, Biomaterials, 33, 2012, 4917-4927 Kukowska-Latallo JF, Candido KA, Cao Z, Nigavekar SS, Majoros IJ, Thomas TP, Balogh LP, Khan MK, Baker JR, Nanoparticle targeting of anticancer drug improves therapeutic response in animal model of human epithelial cancer, Cancer Res, 65, 2005, 5318–5324 Kukowska-Latallo JF, Raczka E, Quintana A, Chen C, Rymaszewski M, Baker JR, Intravascular and endobronchial DNA delivery to murine lung tissue using a novel, nonviral vector, Hum Gene Ther, 11, 2000, 1385–1395 Labbe G, Forier B, Dehaen W, A fast double-stage convergent synthesis of dendritic polyethers, Chem Commun, 18, 1996, 2143–2144 November – December 2013 Page 932 Dinesh et.al Indian Journal of Research in Pharmacy and Biotechnology Lee CC, MacKay JA, Fréchet JMJ, Szoka FC, Designing dendrimers for biological applications, Nat Biotechnol, 23, 2005, 1517-1526 Lee CC, Gillies ER, Fox ME, Guillaudeu SJ, Fréchet JM, Dy EE, Szoka FC, A single dose of doxorubicin-functionalized bow-tie dendrimer cures mice bearing C-26 colon carcinomas, Proc Natl Acad Sci, 103, 2006, 16649-16654 Lee JJ, Ford WT, Reactivity of organic anions promoted by a quaternary ammonium ion dendrimer, Macromolecules, 27, 1994, 4632–4634 Lin Y, Fujimari T, Kawaguchi N, Tsujimoto Y, Nishimi M, Dong Z, Katsumi H, Sakane T, Yamamoto A, Polyamidoamine dendrimers as novel potential absorption enhancers for improving the small intestinal absorption of poorly absorbable drugs in rats, J Control Release, 149, 2011, 21–28 Lorenz K, Holter D, Stuhn B, Mulhaupt R, Frey H, Amesogen-functionized carbosilane dendrimer: A dendritic liquid crystalline polymer, Adv Mater, 8, 1996, 414–416 Love CS, Ashworth I, Brennan C, Chechik V, Smith DK, Dendron-protected Au nanoparticles — Effect of dendritic structure on chemical stability, J Colloid Interface Sci, 302, 2006, 178–186 Mak CC, Cow HF, Dendritic catalysts: Reactivity and mechanism of the dendritic bis(oxazoline) metal co1228–1230mplex catalyzed Diels- Alder reaction, Macromolecules, 30, 1997, 1228–1230 Malik N, Wiwattanapatapee R, Klopsch R, Lorenz K, Frey H, Weener JW, Meijer EW, Paulus W, Duncan R, Dendrimers: relationship between structure and biocompatibility in vitro, and preliminary studies on the biodistribution of 125Ilabelled polyamidoamine dendrimers in vivo, J Control Release, 65, 2000, 133–148 Mamede M, Saga T, Ishimori T, Higashi T, Sato N, Kobayashi H, Brechbiel MW, Konishi J, Hepatocyte targeting of 111In-labeled oligo-DNA with avidin or avidin-dendrimer complex, J Control Release, 95, 2004, 133-141 Moghimi HR, Varshochian R, Kobarfard F, Erfan M, Reduction of percutaneous absorption of toxic chemicals by dendrimers, Cutan Ocul Toxicol, 29, 2010, 34–40 Momotake A, Arai T, Photochemistry and photophysics of stilbene dendrimers and related compounds, J Photochem Photobiol C Photochem Rev, 5, 2004, 1–25 Na M, Yiyun C, Tongwen X, Yang D, Xiaomin W, Zhenwei L, et al., Dendrimers as potential drug carriers, Part II: Prolonged delivery of ketoprofen IJRPB 1(6) www.ijrpb.com ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online) by in vitro and in vivo studies, Eur J Med Chem, 41, 2006, 670–674 Najlah M, Freeman S, Attwood D, D’Emanuele A, In vitro evaluation of dendrimer prodrug for oral drug delivery, Int J Pharm, 336, 2007, 183–190 Newkome GR, Yao Z, Baker GR, Gupta VK Micelles, Part Cascade molecules: A new approach to micelles A [27]-arborol, J Org Chem, 50, 1985, 2003–2004 Pathan IB, Setty CM, Chemical penetration enhancers for transdermal drug delivery systems, Trop J Pharm Res, 8, 2009, 173–179 Patri AK, kukowska lotallo JF, Baker JR, Targeted drug delivery with dendrimers comparison of the release kinetics of covalently conjugated drug and non covalent drug inclusion complex, Adv Drug Del Rev, 57, 2005, 2203-2214 Patri AK, Majoros IJ, Baker J, Dendritic polymer macromolecular carriers for drug delivery, Curr Opin Chem Biol, 6, 2002, 466–471 Ritzén A, Frejd T, Synthesis of a chiral dendrimer based on polyfunctional amino acids, Chem Commun, 2, 1999, 207–208 Santander-Ortega MJ, Stauner T, Loretz B, OrtegaVinuesa JL, Bastos-Gonzalez D, Wenz G, Schaefer UF, Lehr CM, Nanoparticles made from novel starch derivatives for transdermal drug delivery, J Control Release, 141, 2010, 85–92 Sayed-Sweet Y, Hedstrand DM, Spinder R, Tomalia DA, Hydrophobically modified poly(amidoamine) (PAMAM) dendrimers: Their properties at the air– water interface and use as nanoscopic container molecules, J Mater Chem, 7, 1997, 1199–1205 Schatzlein AG, Zinselmeyer BH, Elouzi A, Dufes C, Chim YT, Roberts CJ, Davies MC, Munro A, Gray AI, Uchegbu IF, Preferential liver gene expression with polypropylenimine dendrimers, J Control Release, 101, 2005, 247-258 Schatzlein AG, Zinselmeyer BH, Elouzi A, Dufes C, Chim YT, Roberts CJ, Davies MC, Munro A, Gray AI, Uchegbu IF, Preferential liver gene expression with polypropylenimine dendrimers, J Control Release, 101, 2005, 247-258 Scott HM, Venkatesh T, Maxim VC, Donna SS, William DE, Mohamed EH El-Sayed, Nacetylgalactosamine-functionalized dendrimers as hepatic cancer cell-targeted carriers, Biomaterials, 32, 2011, 4118-4129 Seabrook TJ, Jiang L, Thomas K, Lemere CA, Boosting with intranasal dendrimeric Aβ1–15 but not Aβ1–15 peptide leads to an effective immune response following a single injection of Aβ1–40/42 November – December 2013 Page 933 Dinesh et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online) in APP-tg mice, J Neuroinflammation, 3, 2006, 1– 10 catalyst for the Suzuki miyaura reaction and hydrogenation, Org Lett, 3(8), 2006, 3605-3608 Shembale AI, Borole DK, Lohiya RT, Useful permeation enhancers for transdermal drug delivery: A review, Int J Pharm Res Dev, 2, 2012, 1–6 Xu Y, Zhao D, Removal of copper from contaminated soil by use of poly(amidoamine) dendrimers, Environ Sci Technol, 39, 2005, 2369– 2375 Sun M, Fan A, Wang Z, Zhao Y, Dendrimermediated drug delivery to the skin, Soft Matter, 8, 2012, 4301–4305 Svenson S, Tomalia DA, Dendrimers in biomedical applications reflection on the field, Adv Drug Deli Rev, 57, 2005, 2106 -2129 Tomalia DA, Birth of a new macromolecular architecture:dendrimers as quantized building blocks for nanoscale synthetic polymer chemistry, Prog Polym Sci, 30, 2005, 294–324 Tomalia DA, Naylor AM, Goddard III WA, Starburst Dendrimers: Molecular-level control of size, shape, surface chemistry, topology and flexibility from atoms to macroscopic matter, Angew Chem Int Ed Engl, 29, 1990, 138-175 Tomalia DA, Reyna LA, Svenson S, Dendrimers as multi-purpose nanodevices for oncology drug delivery and diagnostic imaging, Biochem Soc Trans, 35, 2007, 61–67 Turnbull WB, Stoddart JF, Design and synthesis of glycodendrimers, Rev Mol Biotechnol, 90, 2002, 231–255 Yan S, Zhou Z, Zhang F, Yang S, Yang L, Yu X, Effect of anionic PAMAM with amido groups starburst dendrimers on the crystallization of Ca10(PO4)6(OH)2 by hydrothermal method, Mater Chem Phys, 99, 2006, 164–169 Yang Y, Sunoqrot S, Stowell C, Ji J, Lee CW, Kim JW, Khan SA, Hong S, Effect of size, surface charge and hydrophobicity of poly(amidoamine) dendrimers on their skin penetration, Biomacromelecules, 13, 2012, 2154–2162 Yin W, Rui G, Xueyan C, Mingwu S, Xiangyang S, Encapsulation of 2-methoxyestradiol within multifunctional poly(amidoamine) dendrimers for targeted cancer therapy, Biomaterials, 32, 2011, 3322-3329 Zeng F, Zimmerman SC, Rapid synthesis of dendrimers by an orthogonal coupling strategy, J Am Chem Soc, 118, 1996, 5326–5327 Zhuo RX, Du B, Lu ZR, In vitro release of 5fluorouracil with cyclic core dendritic polymer, J Control Release, 57, 1999, 249-257 Venuganti VVK, Perumal OP, Poly(amidoamine) dendrimers as skin penetration enhancers: influence of charge, generation and concentration, J Pharm Sci, 98, 2009, 2345–2356 Vladimir VT, Dendritic macromolecules interfaces, Adv Mater, 10, 1998, 253–257 at Wada K, Arima H, Tsutsumi T, Hirayama F, Uekama K, Enhancing effects of galactosylated dendrimer-β-cyclodextrin conjugates on gene transfer efficiency, Biol Pharm Bull, 28, 2005, 500– 505 Wiener EC, Brechbiel MW, Brothers H, Magin RL, Gansow OA, Tomalia DA, Lauterbur PC, Dendrimer based metal chelates: A new class of magnetic resonance imaging contrast agents, Magn Reson Med, 31, 1994, 1-8 Wu H, Liu Z, Wang X, Zhao B, Zhang J, Li C, Preparation of hollow capsule-stabilized gold Nanoparticles through the encapsulation of the dendrimer, J Colloid Interface Sci, 302, 2006, 142– 148 Wu L, Li BL, Haung YY, Zhou HF, He YM, Fan QH, Phosphine dendrimer stabilized palladium Nanoparticles, a highly active and recyclable IJRPB 1(6) www.ijrpb.com November – December 2013 Page 934 ... Bhargav et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online) Table.7.Ruggedness data of Ofloxacine and Tinidazole Ofloxacin Tinidazole Area... Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online) Method development and validation for the simultaneous estimation of Ofloxacin and Tinidazole... Malleswari et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online) Comparative in- vitro dissolution study of five brands of Diclofenac sodium