Nghiên cứu phân loại các loài dơi thuộc giống myotis và pipistrellus (chirotera vespertilionidae) ở một số tỉnh thuộc miền bắc việt nam

190 44 0
  • Loading ...
    Loading ...
    Loading ...

Tài liệu hạn chế xem trước, để xem đầy đủ mời bạn chọn Tải xuống

Tài liệu liên quan

Thông tin tài liệu

Ngày đăng: 08/05/2019, 20:14

BỘ GIÁO DỤC VÀ ĐÀO TẠO VIỆN HÀN LÂM KHOA HỌC VÀ CÔNG NGHỆ VIỆT NAM VIỆN SINH THÁI VÀ TÀI NGUYÊN SINH VẬT - - NGUYỄN VĂN VIẾT NGHIÊN CỨU PHÂN LOẠI CÁC LOÀI DƠI THUỘC GIỐNG MYOTIS VÀ GIỐNG PIPISTRELLUS (CHIROPTERA: VESPERTILIONIDAE) Ở MỘT SỐ TỈNH MIỀN BẮC VIỆT NAM DỰA TRÊN ĐẶC ĐIỂM HÌNH THÁI, TIẾNG KÊU SIÊU ÂM VÀ DI TRUYỀN PHÂN TỬ LUẬN ÁN TIẾN SĨ SINH HỌC Hà Nội - 2019 BỘ GIÁO DỤC VÀ ĐÀO TẠO VIỆN HÀN LÂM KHOA HỌC VÀ CÔNG NGHỆ VIỆT NAM VIỆN SINH THÁI VÀ TÀI NGUYÊN SINH VẬT - - NGUYỄN VĂN VIẾT NGHIÊN CỨU PHÂN LOẠI CÁC LOÀI DƠI THUỘC GIỐNG MYOTIS VÀ GIỐNG PIPISTRELLUS (CHIROPTERA: VESPERTILIONIDAE) Ở MỘT SỐ TỈNH MIỀN BẮC VIỆT NAM DỰA TRÊN ĐẶC ĐIỂM HÌNH THÁI, TIẾNG KÊU SIÊU ÂM VÀ DI TRUYỀN PHÂN TỬ Chuyên ngành: Động vật học Mã số: 42 01 03 LUẬN ÁN TIẾN SĨ SINH HỌC Ngƣời hƣớng dẫn khoa học : GS.TS Lê Vũ Khôi Ngƣời hƣớng dẫn khoa học 2: PGS.TS Vũ Đình Thống Hà Nội - 2019 LỜI CAM ĐOAN Tôi xin cam đoan cơng trình nghiên cứu tơi Các kết trình bày luận án trung thực, chưa sử dụng luận văn luận án khác Tác giả Nguyễn Văn Viết LỜI CẢM ƠN Tôi xin bày tỏ lòng biết ơn sâu sắc tới GS.TS Lê Vũ Khơi PGS.TS Vũ Đình Thống, ngƣời thầy tận tình hƣớng dẫn tơi suốt q trình nghiên cứu hồn thành luận án Tơi xin gửi lời cảm ơn chân thành sâu sắc tới PGS TS Vũ Đình Thống, TS Nguyễn Trƣờng Sơn, Viện Sinh thái Tài nguyên sinh vật, Viện Hàn lâm Khoa học Công nghệ Việt Nam; ThS Đào Nhân Lợi, khoa Nông Lâm, Trƣờng Đại học Tây Bắc chia sẻ mẫu cho nghiên cứu Tôi xin chân thành cảm ơn tới Ban Giám hiệu, cán phòng Đào tạo đồng nghiệp Trƣờng Cao đẳng Hải Dƣơng; Ban lãnh đạo Viện Sinh thái Tài nguyên Sinh vật; cán Phòng Bảo tàng Động vật, Phòng Động vật có xƣơng sống, Phòng Động vật đất, Phòng Hành - Tổng hợp, phận Đào tạo thuộc Viện Sinh thái Tài nguyên sinh vật, Viện Hàn lâm Khoa học Công nghệ Việt Nam tạo điều kiện giúp đỡ thời gian nghiên cứu Tôi xin cảm ơn lãnh đạo cán phòng Hệ thống phân tử Di truyền bảo tồn, Viện Sinh thái Tài nguyên sinh vật; Tổ Hệ gen học miễn dịch thuộc phòng Hệ gen học ngƣời thuộc Viện nghiên cứu Hệ gen, Viện Hàn lâm Khoa học Cơng nghệ Việt Nam; Phòng thí nghiệm Di truyền học Phòng Sinh học phân tử-Tế bào, Khoa Sinh học Bảo tàng Sinh học, Trƣờng Đại học Khoa học Tự nhiên, Đại học Quốc Gia Hà Nội việc giải trình tự ADN chia sẻ mẫu nghiên cứu Tôi xin cảm ơn lãnh đạo cán chi cục Kiểm lâm Tỉnh Hải Dƣơng, Hải Phòng, Quảng Ninh, Bắc Giang, Sơn La, Lai Châu, Điện Biên, Hà Giang, Tuyên Quang, Bắc Cạn, Lạng Sơn, Phú Thọ, Hòa Bình, Ninh Bình tạo điều kiện q trình điều tra thực địa Cuối cùng, tơi xin gửi lời cảm ơn đến gia đình: Bố, mẹ, vợ, con, anh chị em… ủng hộ, động viên, giúp đỡ tơi suốt q trình thực luận án MỤC LỤC MỞ ĐẦU Lý chọn đề tài Mục tiêu đề tài luận án Nội dung nghiên cứu đề tài luận án Ý nghĩa khoa học thực tiễn đề tài luận án Những đóng góp đề tài luận án CHƢƠNG TỔNG QUAN VẤN ĐỀ NGHIÊN CỨU 1.1 Khái quát nghiên cứu phân loại dơi giới 1.1.1 Phân loại Dơi (Chiroptera) 1.1.2 Phân loại giống Myotis giống Pipistrellus 12 1.2 Khái quát nghiên cứu dơi Việt Nam 20 1.2.1 Lƣợc sử nghiên cứu 20 1.2.2 Tình hình nghiên cứu tiếng kêu siêu âm di truyền phân tử loài dơi Việt Nam 23 1.2.3 Nghiên cứu phân loại giống Myotis 25 1.2.4 Nghiên cứu phân loại giống Pipistrellus 29 CHƢƠNG II ĐỊA ĐIỂM, VẬT LIỆU VÀ PHƢƠNG PHÁP NGHIÊN CỨU 32 2.1 Địa điểm thời gian nghiên cứu 32 2.2 Dụng cụ, hóa chất vật liệu nghiên cứu 33 2.3 Phƣơng pháp nghiên cứu 34 2.3.1 Phƣơng pháp thu mẫu 34 2.3.2 Phƣơng pháp xử lí mẫu 35 2.3.3 Phƣơng pháp ghi phân tích tiếng kêu siêu âm 39 2.3.4 Phƣơng pháp phân tích ADN 40 CHƢƠNG III KẾT QUẢ VÀ BÀN LUẬN 41 3.1 Thành phần loài dơi thuộc giống Myotis giống Pipistrellus khu vực nghiên cứu 41 3.2 Những loài dơi ghi nhận cho khu vực nghiên cứu Việt Nam 42 3.2.1 Loài Myotis altarium Thomas, 1911 42 3.2.2 Dạng loài Myotis cf montivagus 47 3.2.3 Dạng loài Myotis cf laniger 54 3.3 Đặc điểm hình thái nhận dạng loài thuộc giống Myotis giống Pipistrellus thuộc vùng nghiên cứu 59 3.3.1 Đặc điểm hình thái ngồi 59 3.3.2 Đặc điểm hình thái sọ 68 3.3.3 Đặc điểm sụn ngọc hành 77 3.4 Đặc điểm tiếng kêu siêu âm số loài thuộc giống Myotis giống Pipistrellus ghi nhận đƣợc trình nghiên cứu 79 3.4.1 Giống Myotis 79 3.4.2 Giống Pipistrellus 81 3.5 Đặc điểm di truyền phân tử 83 3.6 Đặc điểm nhận dạng loài dơi thuộc giống Myotis giống Pipistrellus số tỉnh miền Bắc Việt Nam 85 3.6.1 Myotis chinensis Tomes, 1857 85 3.6.2 Myotis pilosus Peters, 1869 88 3.6.3 Myotis montivagus Dobson, 1874 91 3.6.4 Myotis indochinensis Nguyen et al, 2013 94 3.6.5 Myotis annectans Dobson, 1871 96 3.6.6 Myotis muricola Gray, 1846 99 3.6.7 Myotis siligorensis Horsfield, 1855 102 3.6.8 Myotis laniger Peters, 1870 105 3.6.9 Myotis annamiticus Kruskop, Tsytsulina, 2001 107 3.6.10 Myotis horsfieldii Temminck, 1840 109 3.6.11 Myotis hasseltii Temminck, 1840 111 3.6.12 Pipistrellus paterculus Thomas, 1915 113 3.6.13 Pipistrellus abramus Temminck, 1840 115 3.6.14 Pipistrellus tenuis Temminck, 1840 118 3.6.15 Pipistrellus coromandra Gray, 1838 120 3.6.16 Pipistrellus javanicus Gray, 1838 122 3.7 Khóa định loại lồi thuộc giống Myotis giống Pipistrellus miền Bắc Việt Nam 125 3.7.1 Giống Myotis 125 3.7.2 Giống Pipistrellus 127 KẾT LUẬN 128 KIẾN NGHỊ 129 TÀI LIỆU THAM KHẢO 130 DANH MỤC BẢNG Bảng 1.1 Số loài dơi ghi nhận Việt Nam số nghiên cứu trƣớc 22 Bảng 1.2 Các loài dơi khu hệ dơi Việt Nam đƣợc ghi nhận từ năm 2006 đến 23 Bảng 1.3 Thành phần loài dơi thuộc giống Myotis Việt Nam số nghiên cứu trƣớc 26 Bảng 1.4 Thông số tiếng kêu siêu âm số loài thuộc giống Myotis Việt Nam số nghiên cứu trƣớc 28 Bảng 1.5 Thành phần loài dơi thuộc giống Pipistrellus Việt Nam số nghiên cứu trƣớc 30 Bảng 1.6 Thông số tiếng kêu siêu âm số loài thuộc giống Pipistrellus Việt Nam số nghiên cứu trƣớc 31 Bảng 2.1: Các cặp mồi đƣợc sử dụng phân tích ADN 40 Bảng 3.1 Thành phần loài dơi thuộc giống Myotis giống Pipistrellus ghi nhận đƣợc khu vực nghiên cứu 41 Bảng 3.2 Một số thông số loài M altarium nghiên cứu số nghiên cứu trƣớc 43 Bảng 3.3 Kết so sánh trình tự gen COI thuộc lồi M altarium nghiên cứu với trình tự số gen COI ngân hàng gen 45 Bảng 3.4 Một số số hình thái ngồi, hình thái sọ, lồi Myotis cf montivagus loài M montivagus 51 Bảng 3.5 Kết so sánh trình tự gen COI thuộc lồi M cf montivagus nghiên cứu với trình tự số gen COI ngân hàng gen 53 Bảng 3.6 Kết so sánh trình tự gen COI thuộc lồi M cf laniger nghiên cứu với trình tự số gen COI ngân hàng gen 58 Bảng 3.7 Các số FA, E, Cr HF loài thuộc giống Pipistrellus nghiên cứu 59 Bảng 3.8 Các số FA, E, Cr HF 14 loài dạng loài thuộc giống Myotis nghiên cứu 60 Bảng 3.9: Vị trí tƣơng đối chiều dài cẳng tay so với mút mõm mút tai số loài thuộc giống Myotis nghiên cứu 63 Bảng 3.10 Vị trí tƣơng đối chiều dài tai so với mút mõm số loài thuộc giống Myotis 66 Bảng 3.11 Một số số hộp sọ 14 loài dạng loài thuộc giống Myotis nghiên cứu 69 Bảng 3.12 Một số số hộp sọ loài thuộc giống Pipistrellus nghiên cứu 70 Bảng 3.13 Một số số thuộc giống Myotis nghiên cứu 74 Bảng 3.14 Một số số thuộc giống Pipistrellus nghiên cứu 75 Bảng 3.15 Tƣơng quan chiều cao thuộc hàm trên, hàm dƣới loài thuộc giống Myotis nghiên cứu 76 Bảng 3.16 Tƣơng quan chiều cao thuộc hàm trên, hàm dƣới loài thuộc giống Pipistrellus nghiên cứu 76 Bảng 3.17 Một số thông số tiếng kêu siêu âm loài M pilosus, M chinensis, M siligorensis M muricola ghi nhận đƣợc trình nghiên cứu 80 Bảng 3.18 Một số thơng số siêu âm lồi P javanicus, P abramus P coromandra ghi nhận đƣợc nghiên cứu 81 Bảng 3.19 Kết so sánh trình tự gen COI gen 16S loài thuộc giống Myotis giống Pipistrellus nghiên cứu với trình tự gen tƣơng ứng ngân hàng gen 84 Bảng 3.20 Kết so sánh trình tự gen COI thuộc loài M chinensis nghiên cứu với trình tự số gen COI ngân hàng gen 86 Bảng 3.21 Kết so sánh trình tự gen COI thuộc lồi M pilosus nghiên cứu với trình tự số gen COI ngân hàng gen 89 Bảng 3.22 Kết so sánh trình tự gen COI thuộc lồi M montivagus nghiên cứu với trình tự số gen COI ngân hàng gen 92 Bảng 3.23 Kết so sánh trình tự gen COI thuộc loài M annectans nghiên cứu với trình tự số gen COI ngân hàng gen 97 Bảng 3.24 Kết so sánh trình tự gen COI thuộc lồi M muricola nghiên cứu với trình tự số gen COI ngân hàng gen 100 Bảng 3.25 Kết so sánh trình tự gen COI thuộc loài M siligorensis nghiên cứu với trình tự số gen COI ngân hàng gen 103 Bảng 3.26 Kết so sánh trình tự gen 16S lồi P abramus nghiên cứu với trình tự số gen 16S ngân hàng gen 116 Bảng 3.27 Kết so sánh trình tự gen COI thuộc loài P tenuis nghiên cứu với số trình tự gen COI ngân hàng gen 119 Bảng 3.28 Kết so sánh trình tự gen COI lồi P javanicus nghiên cứu với trình tự số gen COI ngân hàng gen 123 DANH MỤC HÌNH Hình 1.1 Các kiểu tín hiệu siêu âm dơi (theo Hill & Smith, 1984) [107] 10 Hình 1.2 Hình thái tai bề mặt hàm hàm dƣới bên trái giống Myotis (A,C) giống Pipistrellus (B,D) (Theo Kruskop, 2013) [137] 14 Hình 2.1 Sơ đồ điểm tiến hành điều tra khảo sát thực địa thu mẫu dơi 32 Hình 2.2: Thu mẫu dơi lƣới mờ 34 Hình 2.3: Thu mẫu dơi bẫy thụ cầm 35 Hình 2.4: Cách đo số số hình thái ngồi dơi 36 Hình 2.5: Cách đo số số sọ dơi 37 Hình 3.1 Kết phân tích sai khác kích thƣớc (I), hình dạng (II) loài M altarium (x), M annectans (o), M montivagus (□), M indochinensis (∆) phƣơng pháp PCA theo số 44 Hình 3.2 Kết phân tích mức độ đóng góp số kích thƣớc (I) hình dạng (II) vào khác biệt loài M altarium, M annectans, M indochinensis M montivagus 44 Hình 3.3 Hình thái hộp sọ, (A), hình thái (C), cấu trúc tiếng kêu siêu âm (D) vùng phân bố (B) loài M altarium Việt Nam 46 Hình 3.4 Hình thái sọ, lồi M cf montivagus (A) M montivagus (B) 49 Hình 3.5 Kết phân tích sai khác kích thƣớc (I), hình dạng (II) lồi M cf montivagus (□) với loài M montivagus (∆), M muricola (o) phân tích PCA theo số FA, E, HF, Cr HB 52 Hình 3.6 Kết phân tích mức độ đóng góp số kích thƣớc (I) hình dạng (II) vào sai khác loài M cf montivagus, M montivagus M muricola.52 Hình 3.7 Hình thái hộp sọ loài M cf laniger (A) loài M laniger (B) 56 Hình 3.8 Kết phân tích khác biệt kích thƣớc (I), hình dạng (II) loài M cf laniger (□) loài M laniger (o) phân tích PCA theo số 57 Hình 3.9 Kết phân tích mức độ đóng góp vào sai khác loài M cf montivagus loài M laniger theo số kích thƣớc (I) hình dạng (II) 57 Hình 3.10 Cách đo vị trí tƣơng đối cẳng tay so với mút mõm, mút tai 62 Hình 3.11 Các kiểu hình thái tai lồi thuộc giống Myotis 64 Hình 3.12 Các kiểu hình thái mấu tai lồi thuộc giống Pipistrellus nghiên cứu 67 Hình 3.13 Các kiểu hình thái xƣơng gò má loài thuộc giống Myotis nghiên cứu 71 Hình 3.14 Các kiểu hình thái đƣờng gân hộp sọ loài thuộc giống Myotis nghiên cứu 71 Hình 3.15 Hình thái mặt hộp sọ loài thuộc giống Pipistrellus 73 Hình 3.16 Hình thái sụn ngọc hành loài P abramus (A), P paterculus (B), P javanicus (C), P tenuis P coromandra (D) 78 20 MP.11.07.2016 M P tenuis Mƣờng Phăng - Điện Biên 21 MP.14.07.2016.1 F P tenuis Mƣờng Phăng - Điện Biên 22 MP.16.07.2016.1 F P tenuis Mƣờng Phăng - Điện Biên 23 NH.19.09.2015.1 F P tenuis Nậm Nhùn - Lai Châu 24 NK.25062014.3 M P tenuis 25 NT.18.09.2015.2 F P tenuis Điện Biên - Điện Biên 26 NT.20092015.1 F P tenuis Điện Biên - Điện Biên 27 PB.18092015.1 F P tenuis Sốp Cộp - Sơn La 28 SC.02.08.2016.40 F P tenuis Sốp Cộp - Sơn La 29 SC.02.08.2016.41 F P tenuis Sốp Cộp - Sơn La 30 SC.02.08.2016.43 F P tenuis Sốp Cộp - Sơn La 31 SC.25.07.2016.4 M P tenuis Sốp Cộp - Sơn La 32 T.14022012.1 M P tenuis Cúc Phƣơng - Ninh Bình 33 T.190908.1 Mƣờng Nhé - Điện Biên P tenuis Cát Bà - Hải Phòng 34 T.230913.1 F P tenuis Cát Bà - Hải Phòng 35 T.230913.2 F P tenuis Cát Bà - Hải Phòng 36 T.251109.01 M P tenuis Tam Đảo - Vĩnh Phúc 37 T.270607.08 M P tenuis Chợ Đồn - Bắc Cạn 38 T.270607.09 M P tenuis Chợ Đồn - Bắc Cạn 39 TR.15032012.1 M P tenuis Thuận Châu - Sơn La 40 T.311017.3 M P tenuis Cát Bà - Hải Phòng 41 VS.17.08.2016.69 F P tenuis Mƣờng Tè - Lai Châu PHỤ LỤC 2: CÁC BƢỚC CHUNG GIẢI TRÌNH TỰ GEN COI VÀ GEN 16S Hóa chất Các hóa chất dùng để tách DNA tổng số, tinh sản phẩm PCR hãng Qiagen Sigma Hóa chất dùng cho phản ứng PCR: đệm, MgCl2, dNTPs, Taq DNA polymerase hãng Fermentas Bộ hóa chất sinh chuẩn BigDye Terminator v3.1 Cycle Sequencing hãng ABI Các hóa chất khác nhƣ Nƣớc khử ion, Agarose, Ethanol, axit Axetic, EDTA, Tris HCl,… hãng Thermo, Merck, Sigma Trang thiết bị Tủ lạnh sâu -200C, -840C (Sanyo); Pipetman loại (Gilson); Cân phân tích (Mettler Toledo); Máy đo pH (Mettler); Máy ly tâm (Sorvall, Eppendorf…); Máy điện di PowerPac 300 (Bio-Rad); Máy chụp ảnh GelDoc (Amersham BioSciences); Máy GeneAmp PCR System 9700 (ABI); Các máy xác định trình tự nucleotide tự động ABI PRISM Genetic Analyzer (ABI) Phƣơng pháp 3.1 Tách chiết ADN Sử dụng kit QIAGEN đặc hiệu để tách ADN Quy trình tách chiết DNA đƣợc thực theo bƣớc nhƣ sau: - Lấy mẫu cần tách gen pha loãng vào ống eppendorf cho đạt thể tích 300 μl Bổ sung 400 μl dung dịch AL 20 μl proteinase K Sau đó, trộn máy rung pipet - Ủ mẫu 56oC 30 phút Mẫu đƣợc lắc nhẹ tay thời gian ủ, lần lắc cách 10 phút - Bổ sung 300 μl ethanol (96-100%) trộn pipet máy rung - Chuyển toàn mẫu ống eppendorf lên cột Ly tâm 10.000 vòng/phút phút - Bổ sung 500 μl Buffer AW1 (đã bổ sung ethanol) Ly tâm 10.000 vòng/phút phút - Bổ sung 500 μl Buffer AW2 (đã bổ sung ethanol) lên cột Ly tâm 10.000 vòng/phút phút Để cột sang ống Eppendorf 1,5 ml - Bổ sung 200 μl Elution Buffer ly tâm 8.000 vòng/phút phút - Sử dụng μl sản phẩm có chứa ADN sau tinh để điện di kiểm tra gel agarose 0,8% - Cất mẫu -20oC 3.2 Phương pháp điện di gel agarose * Chuẩn bị gel agarose 0,8%: Cho 0,8g agarose vào 100 ml đệm TAE 1X, đem đun lò vi sóng agarose tan hồn tồn Để nguội đến khoảng 40oC đổ dung dịch agarose vào khuôn điện di cài lƣợc sẵn Bề dày gel khoảng 50 mm thích hợp Sau 30-40 phút agarose đƣợc polyme hóa hồn tồn điện di đƣợc * Tra mẫu ADN vào giếng điện di: Mẫu ADN thu đƣợc đƣợc trộn với đệm tra mẫu, sau tra vào giếng gel Mẫu ADN đƣợc chạy điện di với marker ADN để xác định kích thƣớc phân tử ADN * Chạy điện di: Chạy điện di với chƣơng trình: Hiệu điện (U = 50-100 V), cƣờng độ dòng điện (I = 80-100 mA) Nhuộm ADN: Sau kết thúc điện di, gel đƣợc lấy nhuộm dung dịch EtBr nồng độ 0,5 µg/ml khoảng 10-15 phút Sau lấy gel rửa cách ngâm nƣớc lần, lần 5-10 phút Quan sát chụp ảnh: Bản gel đƣợc quan sát dƣới ánh sáng tử ngoại UV254 nm đƣợc chụp ảnh hệ thống chụp ảnh gel tự động 3.3 Phương pháp định lượng ADN máy quang phổ - Lấy µl dung mơi (TE pH 8,0 nƣớc khử ion vô trùng) để làm đối chứng - Sử dụng µl mẫu để xác định nồng độ DNA bƣớc sóng 260 nm 280 nm - Ghi lại kết nồng độ ADN cho mẫu nghiên cứu sau lần đo 3.4 Nhân đoạn ADN phản ứng PCR * Một chu kỳ phản ứng PCR gồm giai đoạn sau: - Giai đoạn biến tính: ADN mạch kép ban đầu tách thành hai mạch đơn nhờ nhiệt độ cao (94-95oC) thời gian ngắn - Giai đoạn gắn mồi: Ở nhiệt độ thích hợp (khoảng 50-60oC), hai mồi oligonucleotide dài từ 15-30 nucleotide bám vào hai đầu đoạn ADN đích theo nguyên tắc bổ sung - Giai đoạn kéo dài chuỗi: Nhiệt độ hỗn hợp phản ứng đƣợc tăng lên khoảng 70-80oC nhiệt độ thích hợp để Taq DNA polymerase kéo dài chuỗi, tránh tƣợng tiếp hợp không đặc hiệu * Thành phần phản ứng PCR - Một mẫu phản ứng PCR đƣợc tiến hành tổng thể tích 25 μl gồm có thành phần sau: Thành phần H2 O Thể tích (μl) (15,8 – X) Dung dịch đệm (10x) 2,5 dNTP (2,5 mM) 2,5 MgCl2 (25 mM) 2,0 Mồi xuôi (10 pmol) 1,0 Mồi ngƣợc (10 pmol) 1,0 ADN khuôn X Pfu polymerase 0,2 * Chu trình nhiệt cho phản ứng PCR: - Chu trình nhiệt cho phản ứng PCR nhân đoạn DNA gen TLR4 với cặp mồi (TLR4_F/ TLR4_R) nhƣ sau: 3.5 Tinh sản phẩm PCR Quá trình tinh sản phẩm PCR đƣợc thực theo hƣớng dẫn Kit E.Z.N.A.® Cycle-Pure hãng Sigma: - Xác định thể tích sản phẩm PCR cần tinh - Hút tồn thể tích sản phẩm PCR sang ống eppendorf 1,5 ml Bổ sung lần thể tích dung dịch CP so với thể tích sản phẩm PCR cần tinh vào ống eppendorf 1,5 ml có sản phẩm PCR Ví dụ, 100 µl sản phẩm PCR cần bổ sung 500 µl dung dịch CP - Dung nhẹ nhàng máy rung 20 giây đặc máy - Đặt cột HiBind® DNA lên ống thu ml - Chuyển toàn phần dung dịch mẫu lên cột HiBind® DNA ly tâm với tốc độ 12000 vòng/phút thời gian phút nhiệt độ phòng - Loại bỏ phần dịch sau ly tâm đặt cột HiBind® DNA trở lại ống thu - Bổ sung 700 µl dung dịch DNA Wash ly tâm với tốc độ 12000 vòng/phút thời gian phút nhiệt độ phòng - Loại bỏ phần dịch sau ly tâm đặt cột HiBind® DNA trở lại ống thu - Bổ sung 700 µl dung dịch DNA Wash ly tâm với tốc độ 12000 vòng/phút thời gian phút nhiệt độ phòng Loại bỏ phần dịch sau ly tâm đặt cột HiBind® DNA trở lại ống thu - - Ly tâm với tốc độ 12000 vòng/phút thời gian phút nhiệt độ phòng - - Bổ sung 30-50 µl đệm TE nƣớc khử ion, để nhiệt độ phòng thời gian phút Ly tâm với tốc độ 12000 vòng/phút thời gian phút nhiệt độ phòng Sử dụng µl để điện di kiểm tra gel agarose 1% 3.6 Giải trình tự ADN * Chu trình nhiệt: Chu trình nhiệt cho phản ứng PCR máy GenAmp® PCR System 9700 nhƣ sau: 96oC – phút; (96oC – 10 giây; 50oC – giây; 60oC – phút) x 25 chu kỳ Sau giữ sản phẩm 4oC * Tinh sản phẩm PCR phƣơng pháp EtOH/EDTA Bổ sung vào sản phẩm PCR μl EDTA 125 mM, 60 μl EtOH 100% để hỗn hợp nhiệt độ phòng 15 phút Sau đó, ly tâm 12.000 vòng/phút 15 phút để tủa DNA có Loại bỏ EtOH, rửa tủa 60 μl EtOH 70% Ly tâm 10.000 vòng/phút 10 phút Làm khơ tủa bổ sung 10 μl Hi-DiTM Formamide để biến tính 95oC phút Sau bƣớc này, nguyên liệu đƣợc đƣa vào máy đọc trình tự tự động ABI PRISMTM 3100 Genetic Analyzer Các ống đƣợc điện di ống vi mao quản 80 cm x 50 μl Kết đƣợc thu nhận xử lý phần mềm ABI PRISMTM 3100 – Avant Data Collection v2.0 DNA Sequencing Analysis 5.2 PHỤ LỤC 3: KẾT QUẢ GIẢI TRÌNH TỰ GEN COI VÀ GEN 16 S Ở 12 LOÀI VÀ DẠNG LỒI TRONG Q TRÌNH NGHIÊN CỨU Myotis altarium * Gen COI mẫu MP.10102015.3 gồm 661 Nu có trình tự: GAGCCGGTATAGCGGGTACAGCACTGAGCTTACTAATTCGCGCAGAATT AGGTCAACCAGGGGCTCTACTGGGAGATGATCAAATTTATAATGTAATC GTTACCGCCCATGCTTTCGTAATAATTTTCTTCATAGTAATACCTATTAT AATTGGAGGCTTTGGGAACTGGTTAGTTCCTTTAATAATTGGAGCCCCTG ATATAGCTTTTCCCCGGATAAATAATATGAGCTTCTGACTCCTTCCTCCA TCCTTCTTATTACTATTAGCCTCATCCATAGTTGAAGCAGGAGCAGGAAC CGGTTGAACAGTATACCCTCCTTTGGCAGGAAATCTTGCCCATGCAGGA GCTTCTGTTGACCTTGCTATTTTTTCTTTACACCTAGCGGGTGTATCTTCA ATTTTAGGAGCAATTAATTTTATTACCACTATCATTAATATGAAACCCCC CGCACTTTCCCAATATCAAACACCATTGTTTGTTTGATCCGTCCTAATTA CAGCCGTACTGCTTCTTCTTTCCCTTCCAGTTCTAGCCGCCGGAATTACA ATATTATTAACAGATCGAAACTTAAACACCACTTTTTTCGATCCTGCCGG TGGGGGAGATCCAATTCTGTATCAACATTTATTTTGATTCTTCGGCCACC AAAAAAGTCTAAT Loài M cf montivagus * Gen COI mẫu T.140607.1 gồm 643 cặp Nu có trình tự: TGAGCTGGTATGGCAGGTACTGCTCTAAGTCTATTAATTCGTGCAGAACT AGGTCAGCCAGGGGCCTTGCTAGGGGATGATCAAATTTACAATGTAATC GTCACCGCCCATGCCTTTGTAATAATCTTCTTCATAGTTATGCCTATTATA ATTGGAGGCTTTGGAAATTGACTAGTACCATTAATAATTGGGGCTCCTGA TATAGCTTTTCCCCGAATAAACAATATAAGCTTCTGACTCCTTCCTCCCTC ATTTCTACTACTATTAGCCTCATCTATGGTTGAAGCAGGGGTGGGTACTG GTTGAACAGTATACCCTCCTTTAGCAGGAAATCTCGCTCACGCAGGAGCC TCTGTTGATCTTGCTATCTTCTCTCTACACCTGGCAGGTGTATCTTCAATT TTAGGAGCAATTAATTTTATTACTACTATCATTAACATAAAACCACCTGC CCTTTCTCAATATCAGACACCATTGTTTGTTTGATCCGTACTAATTACAGC TGTACTTCTTCTTCTTTCCCTCCCAGTTCTAGCTGCCGGAATTACAATGTT ACTAACAGATCGGAATCTAAATACTACTTTCTTTGATCCTGCTGGAGGAG GGGATCCAATTCTATACCAACACTTATTTTGATTCTTCGGCCACC * Gen COI mẫu T.140607.4 gồm 649 cặp Nu có trình tự: GGTACTGCTCTAAGTCTATTAATTCGTGCAGAACTAGGTCAGCCAGGGG C CTTGCTAGGGGATGATCAAATTTACAATGTAATCGTCACCGCCCATGCC TT TGTAATAATCTTCTTCATAGTTATGCCTATTATAATTGGAGGCTTTGGAA ATTGACTAGTACCATTAATAATTGGGGCTCCTGACATAGCTTTTCCCCGA ATAAACAATATAAGCTTCTGACTCCTTCCTCCCTCATTTCTACTACTATT AGCCTCATCTATGGTTGAAGCAGGGGTGGGTACTGGTTGAACAGTATAC CCTCCTTTAGCAGGAAATCTCGCTCACGCAGGAGCCTCTGTTGATCTTGC TATCTTCTCTCTACACCTGGCAGGTGTATCCTCAATTTTAGGAGCAATTA ATTTTATTACTACTATCATTAACATAAAACCACCTGCCCTTTCTCAATAT CAGACACCATTGTTTGTTTGATCCGTACTAATTACAGCTGTACTTCTTCT TCTTTCCCTCCCAGTTCTAGCTGCCGGAATTACAATGTTACTAACAGATC GGAATCTAAATACTACTTTCTTTGATCCTGCTGGAGGAGGGGATCCAAT TCTATACCAACACTTATTTTGATTCTTCGGCCACCAAAAAGTCT M cf laniger * Gen COI mẫu PL.10.09.2017.21 gồm 653 cặp Nu có trình tự: TGCTTGAGCTGGTATAGCAGGCACTGCCCTAAGTTTACTTATTCGCGCAG AATTAGGCCAGCCAGGGGCCTTATTAGGAGATGATCAGATCTATAATGT AATCGTTACTGCCCATGCTTTTGTAATAATTTTCTTCATAGTCATACCTAT TATAATCGGAGGCTTCGGAAATTGACTAGTGCCTTTAATAATTGGAGCCC CCGATATAGCTTTCCCTCGAATGAATAATATGAGTTTCTGACTTCTTCCTC CCTCTTTTTTATTACTGCTAGCTTCATCCATGGTTGAAGCAGGAGCCGGTA CCGGTTGAACAGTCTATCCACCCTTAGCAGGAAATCTTGCCCACGCAGGA GCTTCTGTTGATCTTGCTATCTTTTCTCTGCATCTGGCAGGTGTATCTTCA ATCTTGGGGGCCATTAACTTTATTACTACCATTATTAATATAAAACCACC TGCTCTCTCTCAATATCAAACACCACTGTTTGTCTGATCTGTCCTAATTAC AGCTGTATTACTTCTTCTTTCTCTTCCCGTTTTAGCTGCTGGAATTACAAT ACTATTAACAGATCGAAATTTAAATACTACCTTTTTTGACCCTGCTGGGG GAGGAGATCCAATTCTGTATCAACACCTATTTTGATTCTTCGGCCACC * Gen COI mẫu PL.10.09.2017.3 gồm 654 cặp Nu có trình tự: GCTTGAGCTGGTATAGCAGGCACTGCCCTAAGTTTACTTATTCGCGCAGA ATTAGGCCAGCCAGGGGCCTTATTAGGAGATGATCAGATCTATAATGTAA TCGTTACTGCCCATGCTTTTGTAATAATTTTCTTCATAGTCATACCTATTAT AATCGGAGGCTTCGGAAATTGACTAGTGCCTTTAATAATTGGAGCCCCCG ATATAGCTTTCCCTCGAATGAATAATATGAGTTTCTGACTTCTTCCTCCCTC TTTTTTATTACTGCTAGCTTCATCCATGGTTGAAGCAGGAGCCGGTACCGG TTGAACAGTCTATCCACCCTTAGCAGGAAATCTTGCCCACGCAGGAGCTT CTGTTGATCTTGCTATCTTTTCTCTGCATCTGGCAGGTGTATCTTCAATCTT GGGGGCCATTAACTTTATTACTACCATTATTAATATAAAACCACCTGCTCT CTCTCAATATCAAACACCACTGTTTGTCTGATCTGTCCTAATTACAGCTGT ATTACTTCTTCTTTCTCTTCCCGTTTTAGCTGCTGGAATTACAATACTATTA ACAGATCGAAATTTAAATACTACCTTTTTTGACCCTGCTGGGGGAGGAGA TCCAATTCTGTATCAACACCTATTTTGATTCTTCGGCCACCAA * Gen COI mẫu XN.10.10.2015.3 gồm 651 cặp Nu có trình tự: CTTGAGCTGGTATAGCAGGCACTGCCCTAAGTTTACTTATTCGCGCAGAA TTAGGCCAGCCAGGGGCCTTATTAGGAGACGATCAGATCTATAATGTAAT CGTTACTGCCCATGCTTTTGTAATAATTTTCTTCATAGTCATACCTATTAT AATCGGAGGCTTCGGAAATTGACTAGTGCCTTTAATAATTGGAGCCCCCG ATATAGCTTTCCCTCGAATGAATAATATGAGTTTCTGACTTCTTCCTCCCT CTTTTTTATTACTGCTAGCTTCATCCATGGTTGAAGCAGGAGCCGGTACC GGTTGAACAGTCTATCCACCCTTAGCAGGAAATCTTGCCCACGCAGGAGC TTCTGTTGATCTTGCTATCTTTTCTCTGCATCTGGCAGGTGTATCTTCAAT CTTGGGGGCCATTAACTTTATTACTACCATTATTAATATAAAACCACCTG CTCTCTCTCAATATCAAACACCACTGTTTGTCTGATCTGTCCTAATTACAG CTGTATTACTTCTTCTTTCTCTTCCCGTTTTAGCTGCTGGAATTACAATACT ATTAACAGATCGAAATTTAAATACTACCTTTTTTGACCCTGCTGGGGGAG GAGATCCAATTCTGTATCAACACCTATTTTGATTCTTCGGCCACC M chinensis * Gen COI mẫu TQL02.10.2016.16 gồm 657 cặp Nu có trình tự: ACCCTATACCTATTATTTGGTGCTTGAGCAGGTATAGCAGGTACTGCTCTA AGTCTATTAATCCGCGCAGAGCTAGGCCAACCAGGGGCTCTATTGGGAGA TGACCAAATCTACAACGTAATTGTCACTGCTCATGCTTTCGTAATAATTTT CTTTATAGTCATACCTATCATAATTGGAGGCTTTGGAAATTGACTAGTTCC ACTGATAATCGGGGCCCCTGATATAGCTTTCCCTCGAATAAACAATATAA GCTTTTGACTTCTTCCTCCTTCTTTCTTATTACTATTAGCCTCATCTATAGTT GAAGCAGGAGCTGGTACTGGCTGAACAGTCTATCCACCCTTAGCAGGAAA CCTTGCCCACGCGGGAGCTTCAGTTGATCTTGCTATTTTTTCTCTACACCTA GCGGGTGTATCTTCAATTTTAGGAGCAATTAATTTTATTACTACCATTATT AATATGAAACCTCCCGCACTTTCTCAATATCAAACACCACTATTTGTATGA TCTGTCCTAATCACAGCAGTATTACTACTCCTTTCTCTTCCAGTTTTAGCTG CCGGAATTACAATACTATTAACAGACCGAAACTTGAATACTACTTTCTTTG ATCCTGCTGGAGGAGGAGACCCAATTCTATATCAACACCTATTT * Gen COI mẫu TQL02.10.2016.15 gồm 657 cặp Nu có trình tự: ACCCTATACCTATTATTTGGTGCTTGAGCAGGTATAGCAGGTACTGCTCTA A GTCTATTAATCCGCGCAGAGCTAGGCCAACCAGGGGCTCTATTGGGAGAT GACCAAATCTACAACGTAATTGTCACTGCTCATGCTTTCGTAATAATTTTC TTTATAGTCATACCTATCATAATTGGAGGCTTTGGAAATTGACTAGTTCCA CTGATAATCGGGGCCCCTGATATAGCTTTCCCTCGAATAAACAATATAAG CTTTTGACTTCTTCCTCCTTCTTTCTTATTACTATTAGCCTCATCTATAGTTG AAGCAGGAGCTGGTACTGGCTGAACAGTCTATCCACCCTTAGCAGGAAAC CTTGCCCACGCGGGAGCTTCAGTTGATCTTGCTATTTTTTCTCTACACCTA GCGGGTGTATCTTCAATTTTAGGAGCAATTAATTTTATTACTACCATTATT AATATGAAACCTCCCGCACTTTCTCAATATCAAACACCACTATTTGTATGA TCTGTCCTAATCACAGCAGTATTACTACTCCTTTCTCTTCCAGTTTTAGCTG CCGGAATTACAATACTATTAACAGACCGAAACTTGAATACTACTTTCTTTG ATCCTGCTGGAGGAGGAGACCCAATTCTATATCAACACCTATTT M pilosus * Gen COI mẫu T.01112017.1 gồm 632 cặp Nu có trình tự: ACTTTATACCTGCTATTTGGCGCTTGAGCTGGTATAGCAGGCACCGCTTT AAGCCTGCTAATTCGTGCAGAACTGGGCCAACCCGGAGCTTTATTAGGA GATGATCAAATCTATAATGTAATTGTCACCGCCCACGCTTTCGTAATAAT TTTCTTTATAGTTATACCTATTATAATTGGGGGTTTTGGAAACTGACTAG TGCCTTTGATAATTGGAGCCCCTGATATAGCCTTTCCCCGAATAAATAAT ATAAGCTTTTGACTTTTACCCCCTTCTTTCCTACTACTATTAGCCTCATCT ATAGTGAAGCAGGAGCAGGAACTGGTTGAACAGTTTATCCTCCCTTAGC AGGAAATCTTGCCCATGCAGGAGCTTCTGTTGATCTTGCTATTTTTTCTT TACACTTAGCAGGTGTATCCTCAATCTTAGGGGCAATTAATTTTATCACA ACTATTATTAATATGAAACCTCCTGCACTTTCTCAGTATCAGACACCATT ATTCGTTTGATCTGTCTTAATCACAGCTGTCTTACTCCTTCTTTCTCTCCC AGTTTTAGCTGCCGGAATTACAATACTATTAACAGATCGAAATCTAAAT ACCACTTTCTTCGACCCTGCTGGAGGAGGGGA * Gen COI mẫu MP09.10.2015.1 gồm 634 cặp Nu có trình tự: ACTTTATACCTGCTATTTGGCGCTTGAGCTGGTATAGCAGGCACCGCTTT AAGTCTGCTAATTCGCGCAGAACTGGGCCAGCCCGGAGCTTTATTAGGA GATGATCAAATCTATAATGTAATTGTCACCGCCCACGCTTTCGTAATAAT TTTCTTTATAGTTATACCTATTATAATTGGGGGTTTTGGAAACTGACTAG TGCCTTTAATAATTGGAGCCCCTGATATAGCCTTTCCTCGAATAAATAAT ATAAGCTTTTGACTTTTACCCCCTTCTTTCCTACTACTATTAGCCTCATCT ATAGTTGAAGCAGGAGCAGGAACTGGTTGAACAGTTTATCCTCCCTTAG CAGGAAATCTTGCCCATGCAGGAGCTTCTGTTGATCTTGCTATTTTTTCT TTACACTTAGCAGGTGTATCCTCAATCTTAGGGGCAATTAATTTTATCAC AACTATTATTAATATGAAACCTCCTGCACTTTCTCAGTATCAGACACCAT TATTCGTTTGATCTGTCTTAATCACAGCTGTCTTACTCCTTCTTTCTCTCC CAGTTTTAGCTGCCGGAAATTACAATACTATTAACAGATCGAAATCTAA ATACCACTTTCTTCGAACCCTGCTGGAGGAGGGGA M montivagus * Gen COI mẫu DS.15072016.1 gồm 650 cặp Nu có trình tự: TTGAGCTGGTATAGCAGGTACTGCCCTAAGTCTACTGATTCGTGCAGAACT GGGTCAACCAGGAGCCCTATTAGGAGATGATCAGATTTATAATGTAATTGT TACTGCTCATGCCTTTGTGATAATCTTTTTTATAGTAATACCTATTATAATT GGGGGATTCGGAAATTGACTAGTACCTTTAATAATTGGAGCTCCTGATATA GCTTTTCCTCGAATAAACAATATAAGCTTTTGACTTCTCCCTCCTTCCTTCTT ACTATTACTAGCCTCATCTATAGTAGAAGCAGGAGCAGGAACTGGCTGAA CAGTCTATCCTCCCTTAGCAGGAAATCTGGCCCATGCGGGAGCTTCTGTTG ATCTAGCTATTTTTTCTCTACACTTAGCTGGTGTGTCTTCAATTTTAGGAGC AATTAATTTTATCACTACTATTATTAATATAAAACCCCCTGCACTTTCTCAA TATCAAACACCACTGTTTGTTTGATCTGTACTAATTACAGCTGTACTACTCC TTCTCTCTCTCCCAGTTTTAGCCGCCGGAATTACAATACTATTAACAGATCG AAACCTCAATACTACTTTTTTTGACCCTGCTGGGGGAGGAGATCCAATTCT GTATCAACATTTATTCTGATTCTTCGGCCACC M annectans * Gen COI mẫu CS.28082015.7 gồm 658 cặp Nu có trình tự: CTTGAGCCGGTATAGCTGGTACCGCTTTAAGTCTACTAATTCGTGCAGA ATTAGGTCAACCAGGAGCCTTATTAGGTGATGACCAAATCTATAATGTA ATTGTTACTGCTCATGCTTTCGTAATAATTTTTTTTATAGTGATGCCTATC ATGATTGGAGGCTTTGGAAACTGATTAGTGCCCTTAATAATTGGGGCCC CTGATATAGCTTTTCCTCGAATAAACAATATAAGTTTCTGACTTCTTCCT CCCTCTTTTTTACTGCTGTTGTCTTCATCTATAGTTGAAGCAGGAGCAGG AACTGGTTGGACCGTTTATCCCCCCCTGGCAGGAAATCTTGCCCACGCA GGAGCTTCTGTTGATCTTGCTATTTTTTCTCTCCATCTAGCAGGTGTATCT TCAATCCTAGGAGCAATTAACTTCATTACCACCATTATCAATATAAAAC CCCCCGCACTTTCTCAATACCAAACACCGTTATTTGTTTGATCTGTGTTA ATTACAGCTGTATTACTTTTGCTCTCTTTGCCAGTTTTAGCTGCTGGAATT ACAATGCTATTAACAGATCGAAATATTAATACTACTTTTTTTGACCCTGC TGGAGGAGGAGATCCAATTCTTTACCAACATTTATTTTGATTCTTCGGCC ACCAAAAAAA M muricola * Gen COI mẫu LS.05082017.3 gồm 651 cặp Nu có trình tự: TGCTGAGCTGGTATGGCAGGCACTGCTCTAAGTCTATTAATTCGTGCAG AACTAGGTCAGCCAGGGGCCTTGCTAGGAGATGATCAAATTTATAATGT AATCGTCACCGCCCATGCCTTTGTAATAATTTTCTTCATAGTAATGCCCA TTATAATTGGAGGCTTTGGAAATTGACTAGTACCATTAATAATCGGGGC TCCTGACATAGCTTTTCCCCGAATAAATAATATAAGCTTCTGACTTCTCC CTCCCTCATTTCTACTGCTATTAGCCTCATCTATAGTTGAAGCAGGGGTG GGTACTGGTTGAACAGTATACCCTCCTTTAGCGGGAAATCTCGCTCACG CAGGAGCCTCGTTGATCTCGCTATCTTCTCTCTACACCTGGCAGGTGTGT CTTCAATCTTAGGAGCTATTAATTTTATTACTACTATTATTAATATAAAA CCACCTGCACTTTCTCAATATCAGACACCATTGTTTGTTTGATCCGTACT AATCACAGCTGTACTACTTCTTCTTTCCCTCCCAGTTCTAGCTGCCGGAA TTACAATGTTACTAACAGATCGAAACTTAAATACTACTTTTTTTGATCCT GCTGGAGGAGGGGATCCAATTTTATACCAACACTTATTTTGATTCTTCGG CCAC * Gen COI mẫu T.060817.1 gồm 653 cặp Nu có trình tự: GTGCTGAGCTGGTATGGCAGGCACTGCTCTAAGTCTATTAATTCGTGCA GAACTAGGTCAGCCAGGGGCCTTGCTAGGAGATGATCAAATTTATAATG TAATCGTCACCGCCCATGCCTTTGTAATAATTTTCTTCATAGTAATGCCC ATTATAATTGGAGGCTTTGGAAATTGACTAGTACCATTAATAATTGGGG CTCCTGACATAGCTTTTCCCCGAATAAATAATATAAGCTTCTGACTTCTC CCTCCCTCATTTCTACTGCTATTAGCCTCATCTATAGTTGAAGCAGGGGT GGGTACTGGTTGAACAGTATACCCTCCTTTAGCGGGAAATCTCGCTCAC GCAGGAGCCTCTGTTGATCTCGCTATCTTCTCTCTACACCTGGCAGGTGT GTCTTCAATCTTAGGAGCTATTAATTTTATTACTACTATTATTAATATAA AACCACCTGCACTTTCTCAATATCAGACACCATTGTTTGTTTGATCCGTA CTAATCACAGCTGTACTACTTCTTCTTTCCCTCCCAGTTCTAGCTGCCGG AATTACAATGTTACTAACAGATCGAAACTTAAATACTACTTTTTTTGATC CTGCTGGAGGAGGGGATCCAATTTTATACCAACACTTATTTTGATTCTTC GGCCACC * Gen COI mẫu T.060817.2 gồm 649 cặp Nu có trình tự: TGAGCTGGTATGGCAGGCACTGCTCTAAGTCTATTAATTCGTGCAGAAC TAGGTCAGCCAGGGGCCTTGCTAGGAGATGATCAAATTTATAATGTAAT CGTCACCGCCCATGCCTTTGTAATAATTTTCTTCATAGTAATGCCCATTA TAATTGGAGGCTTTGGAAATTGACTAGTACCATTAATAATTGGGGCTCC TGACATAGCTTTTCCCCGAATAAATAATATAAGCTTCTGACTTCTCCCTC CCTCATTTCTACTGCTATTAGCCTCATCTATAGTTGAAGCAGGGGTGGGT ACTGGTTGAACAGTATACCCTCCTTTAGCGGGAAATCTCGCTCACGCAG GAGCCTCTGTTGATCTCGCTATCTTCTCTCTACACCTGGCAGGTGTGTCT TCAATCTTAGGAGCTATTAATTTTATTACTACTATTATTAATATAAAACC ACCTGCACTTTCTCAATATCAGACACCATTGTTTGTTTGATCCGTACTAA TCACAGCTGTACTACTTCTTCTTTCCCTCCCAGTTCTAGCTGCCGGAATT ACAATGTTACTAACAGATCGAAACTTAAATACTACTTTTTTTGATCCTGC TGGAGGAGGGGATCCAATTTTATACCAACACTTATTTTGATTCTTCGGCC ACC * Gen COI mẫu DC.03.09.2014.1 gồm 645 cặp Nu có trình tự: GCACTGCTCTAAGTCTATTAATTCGTGCAGAACTAGGTCAGCCAGGGGC CTTGCTAGGAGATGATCAAATTTATAATGTAATCGTCACCGCCCATGCCT TTGTAATAATTTTCTTCATAGTAATGCCTATTATAATTGGAGGCTTTGGA AATTGACTAGTACCATTAATAATTGGGGCTCCTGACATAGCTTTTCCCCG AATAAACAATATAAGCTTCTGACTTCTCCCTCCCTCATTTCTACTGCTAT TAGCCTCATCTATAGTTGAAGCAGGGGTGGGTACTGGTTGAACAGTATA CCCTCCTTTAGCAGGAAATCTCGCTCACGCAGGAGCCTCTGTTGATCTCG CTATCTTCTCTCTACACCTGGCAGGTGTGTCTTCAATCTTAGGAGCTATT AATTTTATTACTACTATTATTAATATAAAACCACCTGCACTCTCCCAATA TCAGACACCATTGTTTGTTTGATCCGTTCTAATCACAGCTGTACTACTTC TTCTTTCCCTCCCAGTTCTAGCTGCCGGAATTACAATGTTACTAACAGAT CGAAACTTAAATACTACTTTTTTTGATCCTGCTGGAGGAGGAGATCCAA TTCTATACCAACACTTATTTTGATTCTTCGGCCACCAAAAGTCTAAGG M siligorensis * Gen COI thuộc mẫu CS.25082017.32 gồm 662 cặp Nu có trình tự: CTGAGCCGGTATAGCAGGCACTGCCCTAAGTCTACTCATTCGCGCAGAA CTAGGCCAACCAGGGGCCTTATTGGGAGACGATCAAATCTATAATGTAA TTGTTACTGCCCATGCTTTTGTAATAATTTTCTTTATAGTTATGCCTATTA TAATCGGAGGCTTCGGAAATTGACTAGTACCTTTAATAATTGGGGCTCC CGACATAGCTTTCCCCCGAATGAATAATATAAGCTTCTGACTACTCCCTC CCTCTTTTTTATTACTACTAGCCTCATCTATAGTTGAAGCAGGGGCTGGC ACTGGTTGAACCGTCTATCCACCCTTAGCAGGAAATCTTGCCCATGCAG GAGCTTCTGTTGATCTTGCTATCTTTTCTCTACACCTAGCAGGTGTGTCTT CAATCTTAGGAGCAATTAACTTTATTACCACCATTATTAATATAAAACCA CCTGCTCTATCTCAATATCAGACACCACTGTTTGTCTGATCTGTCCTAAT TACAGCTGTATTACTTCTCCTCTCTCTTCCAGTCTTAGCTGCTGGGATTAC AATATTATTAACAGATCGAAACTTGAACACTACCTTTTTTGATCCTGCCG GGGGAGGGGATCCATTCTGTATCAACACCTGTTTTGATTCTTCGGCCACA AAAAAATCCTAA 10 P abramus * Gen 16S mẫu MP.10.07.2016.2 gồm 478 cặp Nu có trình tự: GAGTTTTTCACAGGGACTCGTATGATGGCCACACGAGGGTTTTACTGTCT CTTATTTCAAATCAGTGAAATTGACATTCCCGTGAAGAGGCGGGAATAA AAAAATAAGACGAGAAGACCCTATGGAGCTTTAATTCACTAACTCATAT TACTATCCTAACTCCTCACGGGGAATAAATCTACTATTAGTGAGTTAGC AATTTAGGTTGGGGTGACCTCGGAATAAAACCTAACCTCCGAGAAACAT TTTTAAGACCTACAAGTCAAAATTATATACTAACATACAATGATCCGCC AATGACGATCAACGAAACAAGTTACCCTAGGGATAACAGCGCAATCCT ATTCAAGAGTCCATATCGACAATTAGGGTTTACGACCTCGATGTTGGAT CAGGACATCCCAATGGTGTAGCAGCTATTAATGTGTTCGTTTGTTCAACG ATTAAAGTCCTACGTGATCTGAGTTAGACCGGGAGA 11 P tenuis * Gen COI mẫu T.311017.3 gồm 652 cặp Nu có trình tự: GCTTGAGCTGGCATAGTGGGCACTGCACTAAGCCTGCTAATTCGCGCCGAA TTAGGTCAACCAGGAGCCCTGCTCGGGGATGATCAGATTTATAATGTGATT GTAACAGCCCATGCTTTTGTAATAATTTTCTTTATAGTAATACCCATTATGA TCGGAGGCTTTGGTAACTGACTTGTCCCACTAATAATCGGAGCTCCTGACA TAGCATTTCCTCGCATGAATAATATAAGTTTTTGACTCCTCCCCCCTTCTTT CCTTCTGCTCTTGGCATCATCCATGGTGGAAGCGGGCGCGGGGACAGGCTG AACGGTCTACCCGCCTCTGGCAGGAAACCTCGCTCACGCAGGGGCCTCCGT GGACTTAACTATTTTTTCACTACATCTAGCAGGGGTGTCATCAATCCTAGG GGCAATTAATTTTATTACTACTATTATTAATATAAAACCCCCCGCTCTTTCT CAATATCAGACACCATTATTTGTTTGATCCGTATTAATTACAGCCGTTCTTC TTTTACTATCACTCCCAGTGCTAGCCGCTGGTATTACAATACTACTAACAGA CCGAAATTTAAACACAACCTTTTTCGACCCTGCCGGAGGGGGAGACCCCAT TCTATATCAACACCTATTTTGATTCTTCGGCCACC 12 P javanicus * Gen COI mẫu T.190717.1 gồm 568 cặp Nu có trình tự: AAAATTTATAATGTAATTGTGACAGCCCATGCTTTCGTAATAATTTTCTT TATAGTAATACCCATTATGATCGGAGGCTTTGGTAACTGACTTGTTCCAC TAATAATTGGGGCCCCTGACATAGCATTTCCTCGCATGAACAATATAAG TTTCTGACTTCTTCCCCCCTCTTTTCTCCTGCTTTTAGCATCATCTATAGT AGAAGCGGGCGCAGGAACGGGTTGAACAGTCTACCCCCCTCTGGCAGG AAACCTCGCCCATGCAGGGGCCTCCGTAGACTTGACTATCTTTTCTCTAC ATCTAGCAGGGGTCTCATCAATCCTAGGGGCAATTAATTTTATTACTACT ATTATTAATATAAAACCCCCCGCTCTTTCTCAATACCAAACACCGTTGTT TGTCTGATCTGTATTAATCACAGCGGTTCTTCTCTTATTATCACTCCCTGT ACTGGCCGCTGGTATTACAATATTACTAACAGACCGAAATTTAAATACA ACCTTTTTTGATCCTGCCGGAGGGGGTGACCCCATTCTATATCAACATCT ATTTTGATTCTTCGGCCACC * Gen COI mẫu T.190717.2 gồm 602 cặp Nu có trình tự: GTCAGCCAGGAGCCCTGCTTGGGGATGATCAAATTTATAATGTAATTGTG ACAGCCCATGCTTTCGTAATAATTTTCTTTATAGTAATACCCATTATGATC GGAGGCTTTGGTAACTGACTTGTTCCACTAATAATTGGGGCCCCTGACAT AGCATTTCCTCGCATGAACAATATAAGTTCTGACTTCTTCCCCCCTCTTTT CTCCTGCTTTTAGCATCATCTATAGTAGAAGCGGGCGCAGGAACGGGTTG AACAGTCTACCCCCCTCTGGCAGGAAACCTCGCCCATGCAGGGGCCTCCG TAGACTTGACTATCTTTTCTCTACATCTAGCAGGGGTCTCATCAATCCTAG GGGCAATTAATTTTATTACTACTATTATTAATATAAAACCCCCCGCTCTTT CTCAATACCAAACACCGTTGTTTGTCTGATCTGTATTAATCACAGCGGTT CTTCTCTTATTATCACTCCCTGTACTGGCCGCTGGTATTACAATATTACTA ACAGACCGAAATTTAAATACAACCTTTTTTGATCCTGCCGGAGGGGGTGA CCCCATTCTATATCAACATCTATTTTGATTCTTCGGCCACCAAAAAA * Gen COI mẫu T.190717.3 gồm 568 cặp Nu có trình tự: AAATTTATAATGTAATTGTGACAGCCCATGCTTTCGTAATAATTTTCTTT ATAGTAATACCCATTATGATCGGAGGCTTTGGTAACTGACTTGTTCCACT AATAATTGGGGCCCCTGACATAGCATTTCCTCGCATGAACAATATAAGT TTCTGACTTCTTCCCCCCTCTTTTCTCCTGCTTTTAGCATCATCTATAGTA GAAGCGGGCGCAGGAACGGGTTGAACAGTCTACCCCCCTCTGGCAGGA AACCTCGCCCATGCAGGGGCCTCCGTAGACTTGACTATCTTTTCTCTACA TCTAGCAGGGGTCTCATCAATCCTAGGGGCAATTAATTTTATTACTACTA TTATTAATATAAAACCCCCCGCTCTTTCTCAATACCAAACACCGTTGTTT GTCTGATCTGTATTAATCACAGCGGTTCTTCTCTTATTATCACTCCCTGTA CTGGCCGCTGGTATTACAATATTACTAACAGACCGAAATTTAAATACAA CCTTTTTTGATCCTGCCGGAGGGGGTGACCCCATTCTATATCAACATCTA TTTTGATTCTTCGGCCACCA * Gen COI mẫu 20130406-06 gồm 654 cặp Nu có trình tự: TGAGCCGGTATGGTAGGCACCGCACTAAGCCTACTTATTCGTGCCGAATT AGGTCAACCAGGTGCTTTGCTTGGCGATGATCAAATTTATAACGTAATTG TAACAGCTCATGCTTTCGTAATAATTTTCTTTATAGTAATACCTATCATAA TTGGGGGCTTTGGAAACTGGCTTGTCCCATTGATAATCGGAGCCCCCGAT ATAGCATTCCCTCGTATAAATAATATGAGTTTTTGACTCCTCCCTCCTTCT TTTCTTCTTCTCCTAGCATCATCTATAGTAGAAGCAGGTGCAGGGACGGG TTGAACAGTATATCCTCCTTTAGCAGGAAATCTTGCCCATGCAGGAGCCT CTGTAGATTTGGCTATTTTTTCCCTACATTTAGCGGGAGTATCATCAATTC TAGGAGCAATCAATTTTATTACTACTATTATTAATATAAAACCCCCCGCT CTTTCTCAATATCAAACACCCTTATTTGTTTGATCTGTATTAATTACAGCA GTCCTCCTTTTATTATCACTACCTGTGTTAGCCGCTGGTATCACAATACTA CTAACAGACCGAAATTTAAATACTACATTCTTTGACCCTGCCGGGGGAGG AGACCCTATTTTATATCAACATCTATTCTGATTCTTCGGCCACAAAAAA ... mút mõm số loài thuộc giống Myotis 66 Bảng 3.11 Một số số hộp sọ 14 loài dạng loài thuộc giống Myotis nghiên cứu 69 Bảng 3.12 Một số số hộp sọ loài thuộc giống Pipistrellus. .. định loại loài dơi thuộc giống Myotis giống Pipistrellus số tỉnh thuộc miền Bắc Việt Nam Mục tiêu đề tài luận án Cung cấp đặc điểm hình thái nhận diện loài dơi thuộc giống Myotis giống Pipistrellus. .. phần loài dơi thuộc giống Myotis giống Pipistrellus số tỉnh miền Bắc Việt Nam Bổ sung nhiều dẫn liệu hình thái, tiếng kêu siêu âm, di truyền phân tử, phạm vi phân bố số loài dơi thuộc giống Myotis
- Xem thêm -

Xem thêm: Nghiên cứu phân loại các loài dơi thuộc giống myotis và pipistrellus (chirotera vespertilionidae) ở một số tỉnh thuộc miền bắc việt nam, Nghiên cứu phân loại các loài dơi thuộc giống myotis và pipistrellus (chirotera vespertilionidae) ở một số tỉnh thuộc miền bắc việt nam

Từ khóa liên quan