C. elegans PRDM1/Blimp1 homolog BLMP-1 is a positive regulator of bed-3 transcription YANG JIN (B.SCI, ZJU) A THESIS SUBMITTED FOR THE DEGREE OF MASTER OF SCIENCE DEPARTMENT OF BIOCHEMISTRY NATIONAL UNIVERSITY OF SINGAPORE 2014 DECLARATION I hereby declare that the thesis is my original work and it has been written by me in its entirety. I have duly acknowledged all the sources of information which have been used in the thesis. This thesis has also not been submitted for any degree in any university previously. Yang Jin 22 January 2014 i Acknowledgements I thank my supervisor, Assistant Professor Takao Inoue, for his continual and patient guidance, support and assistance throughout the entire course of my studies as a graduate student, and for his critical reading and comments on the manuscript. I thank Jason Tan Wei Han and Xie Zhengyang, for their preliminary work on the project. I also thank other members of the lab, Shen Y.Q., Goh K.Y., Poh W.C., Cheng H.Y., Low N., N.W.Ng., and Y.M.Than, for their excellent technical aid and helpful discussions. I also thank NUS, for awarding me the NUS Research Scholarship. Most of the strains used in this study were kindly supplied by the Mitani Lab and the Caenorhabditis Genetics Center, which is funded by the National Institute of Health, National Center for Research Resources. ii Table of Contents Abstract (Summary)............................................................................................................v List of Tables ......................................................................................................................... vii List of Figures and Illustrations ............................................................................... viii List of Abbreviations and Symbols.............................................................................x Introduction ..............................................................................................................................1 Materials and methods ......................................................................................................6 C. elegans strains, alleles and transgenic lines ................................................................ 6 Extrachromosomal array .................................................................................................... 8 Plasmid construction ........................................................................................................... 8 Plasmids for microinjection ............................................................................................... 8 Plasmids for expressing BLMP-1 fusion protein ............................................................. 10 Strain construction ............................................................................................................ 11 Construction of transgenic strains with the blmp-1 mutant background .......................... 11 Constructing lin-35; Pbed-3::gfp and tam-1; Pbed-3::gfp mutants................................. 12 Constructing lin-53(n833) dpy-5(e61); ayIs2 and lin-53(n833) dpy-5(e61); ccIs4251; dpy-20(e1282) mutants .................................................................................................... 13 Fusion PCR ........................................................................................................................ 15 Mutating putative BLMP-1 binding site on SF2 .............................................................. 15 Mutating putative BLMP-1 binding site on SF2-9 .......................................................... 15 RNAi ................................................................................................................................... 18 Observation of bed-3(sy705)-like phenotypes............................................................... 19 Molting defects ................................................................................................................ 19 Vulval cell count .............................................................................................................. 19 Microscopy......................................................................................................................... 20 Fusion protein expression and purification .................................................................... 20 Fusion protein expression ................................................................................................ 20 Fusion protein purification ............................................................................................... 21 EMSA ................................................................................................................................. 22 iii Bioinformatics ................................................................................................................... 23 Image processing ............................................................................................................... 24 Results ........................................................................................................................................24 BLMP-1 activates endogenous bed-3 transcription ...................................................... 24 BLMP-1 does not regulate Pbed-3::gfp expression through the TAM-1/LIN-35-related mechanism ....................................................................................................................... 24 Further characterization of the bed-3 intron 3 enhancer element..................................... 28 The enhancer activity of SF2-9 needs specific putative BLMP-1 binding motifs ........... 33 BLMP-1 is required for the enhancer activity of sub-fragments of NspI......................... 36 Identification of other chromatin factors involved in bed-3 expression .......................... 41 The blmp-1 mutation causes phenotypes observed in bed-3(sy705) mutants .................. 45 BLMP-1 directly binds to bed-3 in vitro ........................................................................ 50 Expression and Purification of BLMP-1 DNA binding domain ...................................... 50 BLMP-1 binding to motifs A and B................................................................................. 53 Discussion .................................................................................................................................58 BLMP-1 is a positive regulator of bed-3 ........................................................................ 58 BLMP-1 does not reduce Pbed-3::gfp expression through the TAM-1/LIN-35-related mechanism........................................................................................................................ 58 BLMP-1 directly binds to the bed-3 enhancer element in vitro ....................................... 58 Reducing BLMP-1 causes phenotypes observed in bed-3(sy705) mutant........................ 60 Other chromatin factors possibly involved in bed-3 transcription regulation are identified…………………………………………………………………………...61 References ................................................................................................................................62 iv Abstract (Summary) As a master regulator that induces B lymphocytes to terminally differentiate into plasma cells in humans, the function of Blimp1 protein has been widely investigated. C. elegans is a model system in which a better understanding of conserved mechanisms can be obtained with relative ease. Hence, in this study, we focused on the regulatory role of BLMP-1, the ortholog of Blimp1 in C. elegans, to learn more about this important family of proteins and possibly to obtain novel insights into Blimp1 function in other organisms. The C. elegans bed-3 gene was reported to regulate molting and the vulval precursor cell division pattern, but the mechanism that controls the expression of bed-3 was unknown. Previously, researchers found that an NspI fragment in the bed-3 gene between intron 2 and exon 5 contained an enhancer activity and our lab further localized the enhancer element to a 400bp region named SF2. In a large scale ChIP-Seq study done by the modENCODE project, BLMP-1 was found to have a putative binding site in bed3 intron 3. Furthermore, our lab found that the expression of a bed-3 reporter was significantly down-regulated by a blmp-1 mutation and blmp-1 RNAi. These results raised the possibility that BLMP-1 may be the regulator which controls the expression of bed-3 in C. elegans. Here we identified the exact BLMP-1 binding sites by in vitro EMSA assays. These sites are located within a 200bp SF2-9 region located within bed-3 intron 3, the smallest region we identified containing the enhancer activity. In addition, loss of these motifs completely abolished the enhancer activity of the SF2-9 region. We also found that disrupting BLMP-1 function caused molting defects and vulval cell division pattern abnormality similar to bed-3 mutants, which provide additional evidence for BLMP-1 functioning as a transcriptional activator of bed-3. We v also identified other chromatin factors that may be involved in bed-3 expression. The role of BLMP-1 as a transcriptional activator in C. elegans may help us better understand the complicated functions of Blimp1 in humans. vi List of Tables Table 1: Chromatin modulators of Pbed-3::gfp………………………………………………..6 Table 2: Strains and alleles used in this study…………………………………………............7 Table 3: Transgenic strains used in this study…………………………………........................7 Table 4: List of primers used in microinjection and cloning BLMP-1 cDNA………………...9 Table 5: dCAPS Primers and sequences for lin-53(n833) mutant genotype confirmation..……………………………………………………………………....................14 Table 6: Primers for fusion PCR…………………………………………………...................16 Table 7: Primers and oligonucleotides used for EMSA assay……………………...................22 Table 8: Sub-fragments of SF2 driving Δpes-10::gfp expression……………………………..30 Table 9: Blimp1 bind sites in murine genes…………………………………………………...34 Table 10: Enhancer activity analysis of motif D mutated SF2………………………………...35 Table 11: Enhancer activity analysis of putative BLMP-1 binding motif mutated SF29……………………………………………………………………………………………….35 Table 12: List of Blimp1 cofactor orthologs tested in this study………………………..........43 Table 13: blmp-1(tm548) and blmp-1 RNAi animals have a weak molting defect phenotype……………………………………………………………………………………..48 vii List of Figures and Illustrations Figure 1: BLMP-1 does not down-regulate Pbed-3::gfp through the TAM-1/LIN-35-related mechanism……………………………………………………………………………............27 A: Expression of Pbed-3::gfp is obviously reduced by tam-1(cc567) and lin-35(n745) mutants. B: Microscope view of Pbed-3::gfp expression reduced by tam-1 and lin-35 mutants. C: BLMP-1 and other chromatin factors seem not to regulate the expression of Pbed-3::gfp through the TAM-1/LIN-35-related mechanism, except LIN-53. Figure 2: Location and enhancer activity analysis of NspI and its sub-fragments…………….32 A: Location and enhancer activity analysis of NspI, F1, F2, F3 and sub-fragments of F2 (including SF1, SF2 and SF3). B: Location and enhancer activity analysis of SF2-1~SF2-9, and verification of possible important regions IR1, IR2, IR3 and IR4. Figure 3: Location and scores of putative BLMP-1 binding sites on SF2-9…………………..36 Figure 4: BLMP-1 regulation of the enhancer activity of NspI sub-fragments……………….38 A: Enhancer activity of sub-fragments of SF2 regulated by BLMP-1, in vulval cells. B: Enhancer activity of sub-fragments of SF2 regulated by BLMP-1, in hypodermal cells. C: Enhancer activity of motif mutated SF2-9 regulated by BLMP-1, in vulval cells. D: Enhancer activity of motif mutated SF2-9 regulated by BLMP-1, in hypodermal cells. E: Enhancer activity of F1 sub-fragment regulated by BLMP-1, in vulval cells. F: Enhancer activity of F1 sub-fragment regulated by BLMP-1, in hypodermal cells. Figure 5: Identification of chromatin factors of which may interact with BLMP-1…………...45 Figure 6: blmp-1(tm548) and RNAi against blmp-1 animals cause a molting defect phenotype……………………………………………………………………………..............49 Figure 7: Average P5.p and P7.p descendent cell number of mutants and RNAi treated animals………………………………………………………………………………..............49 A: Average P5.p and P7.p descendent cell number of mutants. B: Average P5.p and P7.p descendent cell number of RNAi treated animals. Figure 8: Comparison of conserved functional domains between C. elegans BLMP-1 and human Blimp1………………………………………………………………………………...52 A: human Blimp1 protein isoform 1 with the PR-SET domain and Zinc finger domains, the length of the protein is 825AA. B: C. elegans BLMP-1 protein isoform b with the PR-SET domain and Zinc finger domains, the length of the protein is 817AA. C: Alignment of the conserved Zinc finger domains between C. elegans BLMP-1 isoform b viii and human Blimp1 isoform 1. Figure 9: Soluble BLMP-1 conserved Zinc finger domain fusion protein was detected and purified in pGEX-KG vector.....................................................................................................53 Figure 10: BLMP-1 zinc finger domain binds to motifs A and B in EMSA assays…………..56 A: EMSA with the fusion protein and BBF1. B: EMSA with the fusion protein and biotin end-labeled 45bp fragments containing motifs A and B, competed by different DNA competitors. C: EMSA with the fusion protein and biotin end-labeled 45bp fragments containing motifs A and B, competed by different DNA competitors. ix List of Abbreviations and Symbols dCAPS: Derived cleaved amplified polymorphic sequences Egl phenotype: Egg-laying defect phenotype EMSA: Electrophoretic mobility shift assay GST: Glutathione S-transferase HAT: Histone acetyltransferase HDAC: Histone deacetylase His-tag: Polyhistidine-tag HMT: Histone methyltransferase IPTG: Isopropyl β-D-1-thiogalactopyranoside L1: The first larval stage during C. elegans development L3: The third larval stage during C. elegans development L4: The fourth larval stage during C. elegans development LSD: Lysine specific demethylase modENCODE: The National Human Genome Research Institute model organism ENCyclopedia Of DNA Elements NCC: Neural crest cell NGM: Nematode growth media PBS: Phosphate buffered saline PFM: Position frequency matrices PR domain: Positive-regulatory domain PRDM: PR domain zinc finger protein x PWM: Position weight matrix SUMO: Small ubiquitin-related modifier Unc: Uncoordinated movement phenotype VPCs: Vulval precursor cells Significance symbols are: “N”-not significant “*”-P-value[...]... sequence TI 019 3 2406 (in pET-2 1a) TI0248 CACATCTAGAAATGGGTCAAGGAAG TGGGGA CACAAAGCTTTTATGGATAATGCGGC AATC CACAGAATTCATGGGTCAAGGAAGT GGGGA CACACTCGAGTGGATAATGCGGCAA TCCGA CACATCTAGAAAGCTGTACACGGCC TGTTGC CACAAAGCTTTTATGGATAATGCGGC AATC CACAGAATTCAGCTGTACACGGCCT GTTGC CACACTCGAGTGGATAATGCGGCAA TCCGA CACATCTAGAATCATTTAATGGAGTT CCAAA CACAAAGCTTAAAAGATTCCCAGAT TTCCAT CACAGCTAGCTCATTTAATGGAGTTC CAAA CACACTCGAGAAAGATTCCCAGATT... AAAAACCCAGAGA TCTCTGGGTTTTT GGGGAGGGAAACC GGTTTCCCTCCCC GGGGACCCAAACC GGTTTGGGTCCCC AGACAAAAAAAGGGAGAGATGAAGGGGG AGGGAAACCGGTTGGTC GACCAACCGGTTTCCCTCCCCCTTCATCTC TCCCTTTTTTTGTCT AGACAAAATGGTGGGCCGATGAAGGGCC ATCAGCACCGGTTGGTC GACCAACCGGTGCTGATGGCCCTTCATCG GCCCACCATTTTGTCT AGACAAAATGGTGGGCCGATGAAGGGGG AGGGAAACCGGTTGGTC GACCAACCGGTTTCCCTCCCCCTTCATCG GCCCACCATTTTGTCT AGACAAAAAAAGGGAGAGATGAAGGGCC ATCAGCACCGGTTGGTC... CGCGTCTAGACGCGCAA TCGTCTACAAAGC Motifs A Wild-type and B SF2-9 TI0255: GCGCGTCGACAG ACAAAAAAAGGG AGAGATGA TI02 53: CGCGTCTAGACG CGCAATCGTCTAC AAAGC TI 030 0: GCGCGTCGACAG ACAAAATGGTGG GCCGATGAAGGG TI02 53: CGCGTCTAGACG CGCAATCGTCTAC AAAGC TI0295: AGACAAAATGGTGGGCC GATGAAGGGCCATCAGC ACCGGTT TI02 53: CGCGTCTAGACGCGCAA TCGTCTACAAAGC TI 030 0: GCGCGTCGACAG ACAAAATGGTGG GCCGATGAAGGG TI02 53: CGCGTCTAGACG CGCAATCGTCTAC... GCGCGTCGACTTGAAACATTTGAAAGTTCA TI0 216 GCGCGTCTAGACCTTTAAGATGAGAATAACT GG SF2-2 211 TI0 218 GCGCGTCGACTCTGCTTGGCTAGATGCCA TI0 219 GCGCGTCTAGAACCAGCTTCTTCGAAAACAT A SF2 -3 210 TI0 217 GCGCGTCGACTGGTCCAGTTATTCTCATCT TI 014 7 GCGCGTCTAGATTCTTTCAATCCAGTGGCGT SF2-4 30 9 TI 014 6 GCGCGTCGACTTGAAACATTTGAAAGTTCA TI0 219 GCGCGTCTAGAACCAGCTTCTTCGAAAACAT A SF2-5 30 2 TI0 218 GCGCGTCGACTCTGCTTGGCTAGATGCCA TI 014 7 GCGCGTCTAGATTCTTTCAATCCAGTGGCGT... GAAA To CCATC AGCA C: ATTCTC ATC to GCCCG AATA Motifs DEF D mutated TI 014 6: SF2 GCGCGTCGACTTGAAAC ATTTGAAAGTTCA TI0298: ATAGCGCGTAGTCCCGA AAAGCGACACTACCGTG TTG TI0299: CAACACGGTAGTGTCGC TTTTCGGGACTACGCGC TAT TI 014 7: GCGCGTCTAGATTCTTTC AATCCAGTGGCGT TI0255: GCGCGTCGACAG ACAAAAAAAGGG AGAGATGA TI02 53: CGCGTCTAGACG CGCAATCGTCTAC AAAGC E: GAAGA AAAA To TGTCG CTTT F: AATCT CTTT To TTTCG GGAC RNAi RNAi assays... CGCAATCGTCTAC AAAGC Motifs C D mutated TI 014 6: and D SF2 GCGCGTCGACTTGAAAC ATTTGAAAGTTCA TI0296: ACGTCCTTTAATATTCGG GCAACTGGACC TI0297: GGTCCAGTTGCCCGAAT ATTAAAGGACGT TI 014 7: GCGCGTCTAGATTCTTTC AATCCAGTGGCGT TI0255: GCGCGTCGACAG ACAAAAAAAGGG AGAGATGA TI02 53: CGCGTCTAGACG CGCAATCGTCTAC AAAGC 17 D: AAAGA GAAA To CGGCT ACGC A: AAAGG GAGA To TGGTG GGCC B: GGAGG GAAA To CCATC AGCA A: AAAGG GAGA To TGGTG GGCC B: GGAGG... SF2-6 35 0 TI 014 6 GCGCGTCGACTTGAAACATTTGAAAGTTCA TI02 53 CGCGTCTAGACGCGCAATCGTCTACAAAGC SF2-7 35 0 TI0254 GCGCGTCGACTCTGAGATCAAAAGCGGTTAC TI 014 7 GCGCGTCTAGATTCTTTCAATCCAGTGGCGT SF2-8 200 TI0254 GCGCGTCGACTCTGAGATCAAAAGCGGTTAC TI0256 GCGCGTCTAGA GCATTTCTCTTTTCTCAGTTGC SF2-9 200 TI0255 GCGCGTCGACAGACAAAAAAAGGGAGAGAT GA TI02 53 CGCGTCTAGACGCGCAATCGTCTACAAAGC 9 BLMP- 1 cDNA fragments BLMP- 1 full length cDNA Fragment... CCGTCTCAGTTGCTGA TI02 51: TCAGCAACTGAGACGGC TACGCTGCATAACAACA TI 014 7: GCGCGTCTAGATTCTTTC AATCCAGTGGCGT Below were motifs mutated in SF2-9 16 Second round primers TI 014 6: GCGCGTCGACTT GAAACATTTGAA AGTTCA TI 014 7: GCGCGTCTAGATT CTTTCAATCCAGT GGCGT Sequence mutated D: AAAGA GAAA To CGGCT ACGC Motif D D mutated SF2 Motifs ABD D mutated TI0295: SF2-9 AGACAAAATGGTGGGCC GATGAAGGGCCATCAGC ACCGGTT TI02 53: CGCGTCTAGACGCGCAA... shown in Table 7 Table 7: Primers and oligonucleotides used for EMSA assay Fragment primer Primer sequence Biotin end- BBF1 TI0279B 5Biosg/AGACAAAAAAAGGGAGAGATGAA labeled (10 0bp) G DNA TI0256 GCGCGTCTAGAGCATTTCTCTTTTCTCAGT TGC Motifs TI0 31 5 B 5Biosg/AGACAAAAAAAGGGAGAGATGAA A+ B GGGGGAGGGAAACCGGTTGGTC TI0 31 6 GACCAACCGGTTTCCCTCCCCCTTCATCTC TCCCTTTTTTTGTCT Mutated TI0 31 7 B 5Biosg/AGACAAAATGGTGGGCCGATGAAG 22... A+ B Competitor DNA Motif A Mutated motif A Motif B Mutated motif B Motifs A+ B TI0 31 8 TI 032 0 TI 03 21 TI 032 2 TI 032 3 TI 032 4 TI 032 5 TI 032 6 TI 032 7 TI0 31 5 TI0 31 6 Mutated motifs A+ B TI0 31 7 TI0 31 8 A mutated A- mutated motifs TI 032 0 A+ B A- mutated TI 03 21 B mutated B-mutated motifs TI 032 2 A+ B B-mutated TI 032 3 GGCCATCAGCACCGGTTGGTC GACCAACCGGTGCTGATGGCCCTTCATCG GCCCACCATTTTGTCT AAAAAGGGAGAGA TCTCTCCCTTTTT AAAAACCCAGAGA ... AATC CACAGAATTCAGCTGTACACGGCCT GTTGC CACACTCGAGTGGATAATGCGGCAA TCCGA CACATCTAGAATCATTTAATGGAGTT CCAAA CACAAAGCTTAAAAGATTCCCAGAT TTCCAT CACAGCTAGCTCATTTAATGGAGTTC CAAA CACACTCGAGAAAGATTCCCAGATT... CACATCTAGAAATGGGTCAAGGAAG TGGGGA CACAAAGCTTTTATGGATAATGCGGC AATC CACAGAATTCATGGGTCAAGGAAGT GGGGA CACACTCGAGTGGATAATGCGGCAA TCCGA CACATCTAGAAAGCTGTACACGGCC TGTTGC CACAAAGCTTTTATGGATAATGCGGC AATC... AAAAAGGGAGAGA TCTCTCCCTTTTT AAAAACCCAGAGA TCTCTGGGTTTTT GGGGAGGGAAACC GGTTTCCCTCCCC GGGGACCCAAACC GGTTTGGGTCCCC AGACAAAAAAAGGGAGAGATGAAGGGGG AGGGAAACCGGTTGGTC GACCAACCGGTTTCCCTCCCCCTTCATCTC TCCCTTTTTTTGTCT