Đang tải... (xem toàn văn)
... Construction of recombinant strain Recombinant Original Figure 2.6 SDS-PAGE analysis of total proteins in original strain and engineered strain 24 2.2.2.3 Protein engineering for creating new biocatalysts... is to develop novel and efficient biocatalytic systems for oxidoreductions in pharmaceutical synthesis In this thesis, biocatalytic system for bioreduction with efficient recycling of NADPH was... tandem catalysis 1.2 Objective and Approach The main purpose of this thesis is to develop novel and efficient biocatalytic systems for oxidoreductions in pharmaceutical synthesis More specifically:
DEVELOPMENT OF NOVEL AND EFFICIENT BIOCATALYTIC SYSTEMS FOR OXIDOREDUCTIONS IN PHARMACEUTICAL SYNTHESIS ZHANG WEI (M.Med. (Hons.), ECUST) THESIS SUBMITTED FOR THE DEGREE OF DOCTOR OF PHILOSOPHY IN CHEMICAL AND PHARMACEUTICAL ENGINEERING (CPE) SINGAPORE-MIT ALLIANCE NATIONAL UNIVERSITY OF SINGAPORE 2010 ACKNOWLEDGEMENTS At the moment of completing this thesis, I am overwhelmed by gratitude to many people for their continuous support, encouragement and inspiration to me during the past four years. First of all, I would like to express my sincere appreciation to my both supervisors, Prof. Li Zhi and Prof. Daniel I. C. Wang. Prof. Li’s patient guidance through my entire PhD candidature led me to a world full of excitement and challenges. He not only taught me the basic skills and knowledge, but also the ability which empowers me to become an explorer in chemical and pharmaceutical field. His inspiring ideas, energetic state and critical altitude to research will do benefit my whole life. I must also express my great gratitude to Prof. Wang for his incentive comments during my PhD study. I am so impressed by his abundant knowledge, broad vision, quick mind and insights on various topics, which set a good example to me as a great scientist. Moreover, his optimism and willpower towards life will mentor and encourage me on how to face challenges from life. I also thank to my other dissertation committee members, Prof. Too HengPhon, Prof. Alan T. Hatton, and Prof. Saif A Khan for their constructive comments on this thesis. I would like to acknowledge many other people for their effort towards this thesis. The kind help from Mdm. Li Fengmei, Mdm. Li Xiang, Mdm. Su Mei Novel, Dr. Dharmarajan Rajarathnam is really appreciated. Without their help, this thesis would never have been so successful. I Additional thanks go to my colleagues, Dr. Xu Yi, Dr. Wang Zunsheng, Ms. Tang Weng Lin, Ms. Xue Liang, Ms. Wang Wen, Mr. Dai Shiyao, Dr. Chen Yongzheng, Mr. Jia Xin, Mr. Pham Quang Son, Ms. Ngo Nguyen Phuong Thao, Dr. Mou Jie, Mr. Mojtaba Binazadeh, and Dr. Christine Schutz for their friendship, valuable discussion, and practical guidance during my study. The financial support from Singapore-MIT-Alliance Graduate Fellowship in chemical and pharmaceutical engineering program is acknowledged. Last but not least, I give a thousand thanks from the bottom of my heart to my family for everything they have done for me. Without their heartily support and encouragement, I could not have completed this thesis. II TABLE OF CONTENTS ACKNOWLEDGEMENTS ....................................................................................... I SUMMARY .............................................................................................................. IX LIST OF TABLES ................................................................................................. XII LIST OF FIGURES .............................................................................................. XIII LIST OF SYMBOLS ............................................................................................ XVI CHAPTER 1 INTROUDUCTION ........................................................................... 1 1.1 Background............................................................................................................ 2 1.1.1 General applications of biocatalysis in pharmaceutical industry ............... 2 1.1.2 Cofactor recycling in biocatalytic oxidoreductions .................................... 3 1.1.3 Regio- and stereo-selective biohydroxylation ............................................ 3 1.1.4 Tandem biocatalysis ................................................................................... 4 1.2 Objective and Approach ........................................................................................ 5 1.3 Organization .......................................................................................................... 9 CHAPTER 2 LITERATURE OVERVIEWS ....................................................... 10 2.1 Overview of Biocatalysis in Organic Synthesis .................................................. 11 2.1.1 Advantages of biocatalysis ...................................................................... 11 2.1.1.1 High selectivity (chemo-, regio- and stereo-selectivity) ................... 12 2.1.1.2 Environmentally benign catalysis...................................................... 14 2.1.2 General applications of biocatalysis in organic synthesis ........................ 16 2.1.2.1 Biocatalytic kinetic resolution of a racemic mixture ......................... 18 2.1.2.2 Biocatalytic asymmetric synthesis .................................................... 20 2.2 Enzymes .............................................................................................................. 20 2.2.1 Classification of enzymes ......................................................................... 21 2.2.2 Exploiting of enzymes .............................................................................. 22 2.2.2.1 Screening of new microorganisms .................................................... 22 2.2.2.2 Genetic engineering of recombinant strains for more efficient biocatalysts .................................................................................................... 23 2.2.2.3 Protein engineering for creating new biocatalysts with improved catalytic performance .................................................................... 25 2.3 Oxidoreductases .................................................................................................. 27 2.3.1 Reductases ................................................................................................ 27 III 2.3.1.1 Selective bioreduction of ketones ...................................................... 28 2.3.1.2 Selective oxidation of sec-alcohols ................................................... 29 2.3.2 Monooxygenases ...................................................................................... 30 2.3.2.1 Selective biohydroxylation ................................................................ 31 2.4 NAD(P)+ and NAD(P)H Recycling ..................................................................... 34 2.4.1 NAD(P)+ and NAD(P)H ........................................................................... 35 2.4.2 Reasons for NAD(P)+ and NAD(P)H recycling ....................................... 36 2.4.3 Methods for NAD(P)+ and NAD(P)H recycling ...................................... 37 2.4.3.1 Enzymatic method ............................................................................. 38 2.4.3.2 Electrochemical method .................................................................... 39 2.4.3.3 Chemical method ............................................................................... 40 2.4.3.4 Photochemical method ...................................................................... 41 2.4.4 Approaches for enzymatic NAD(P)+ and NAD(P)H recycling ................ 42 2.4.4.1 Substrate-coupled approach............................................................... 42 2.4.4.2 Enzyme-coupled approach ................................................................ 43 2.5 Cell Permeabilization .......................................................................................... 43 2.5.1 Reasons for cell permeabilization ........................................................... 45 2.5.2 Methods for cell permeabilization ............................................................ 45 2.5.2.1 Solvent treatment & detergent treatment ........................................... 46 2.5.2.2 Salt stress ........................................................................................... 46 2.5.2.3 Freeze and thaw ................................................................................. 46 2.5.2.4 Electropermeabilization ..................................................................... 47 2.5.2.5 Genetic method .................................................................................. 47 2.5.3 Applications of permeabilized cells for cofactor recycling ...................... 48 2.6 Tandem Biocatalysis ........................................................................................... 50 2.6.1 Advantages and applications of tandem catalysis .................................... 50 2.6.1.1 Chemo-chemo tandem catalysis ........................................................ 51 2.6.1.2 Chemo-bio tandem catalysis.............................................................. 52 2.6.2 Advantages and applications of tandem biocatalysis ............................... 54 2.6.3 Tandem biocatalysts systems for sequential oxidoreductions .................. 56 CHAPTER 3 BIOREDUCTION WITH EFFICIENT RECYCLING OF NADPH BY COUPLED PERMEABILIZED MICROORGANISMS ............... 59 3.1 Introduction ......................................................................................................... 60 3.2 Experimental Section........................................................................................... 63 IV 3.2.1 Chemicals ................................................................................................. 63 3.2.2 Analytical methods ................................................................................... 63 3.2.3 Strains and cultivation media ................................................................... 64 3.2.4 Genetic engineering of E. coli XL-1 Blue (pGDH1) and E. coli BL21 (pGDH1) .................................................................................................. 64 3.2.5 Growth and GDH activity of E. coli BL21 (pGDH1) and E. coli XL-1 Blue (pGDH1).......................................................................................... 65 3.2.6 Preparation and GDH Activity of permeabilized cells of E. coli BL21 (pGDH1) and E. coli XL-1 Blue (pGDH1) ............................................. 67 3.2.7 Kinetics of GDH activity of the permeabilized cells of E. coli BL21 (pGDH1) ............................................................................................................ 68 3.2.8 NADPH and NADH oxidase activities of the permeabilized cells of E. coli BL21 (pGDH1) ...................................................................................... 68 3.2.9 General procedure for bioreduction of ethyl 3-keto-4, 4, 4triflurobutyrate 1 with NADPH recycling with coupled permeabilized microorganisms ................................................................................................. 69 3.2.10 Bioreduction of ethyl 3-keto-4, 4, 4-triflurobutyrate 1 with NADPH recycling for 4200 times with coupled permeabilized cells of B. pumilus Phe-C3 and E. coli BL21 (pGDH1) ..................................................... 70 3.2.11 Bioreduction of ethyl 3-keto-4, 4, 4-triflurobutyrate 1 with NADPH recycling for 96 h by using coupled permeabilized cells of B. pumilus Phe-C3 and E. coli BL21 (pGDH1) with four-times addition of 0.005 mM NADP+ ............................................................................................. 70 3.3 Results and Discussion ........................................................................................ 71 3.3.1 Genetic engineering, cell growth, and GDH activity of recombinant E. coli expressing GDH ..................................................................................... 71 3.3.2 Preparation and GDH activity of permeabilized cells of E. coli recombinants expressing GDH .......................................................................... 74 3.3.3 GDH kinetics and NAD(P)H oxidase activity of E. coli BL21 (pGDH1) ............................................................................................................ 76 3.3.4 Coupling of permeabilized cells of B. pumilus Phe-C3 and recombinant E. coli expressing GDH for bioreduction of 3-ketoester 1 with NADPH Recycling .................................................................................... 77 V 3.3.5 Long-term bioreduction of 3-ketoester 1 with efficient NADPH recycling by the coupled permeabilized cells approach with the addition of NADP+ for multiple times ............................................................................. 80 3.4 Summary and Conclusions .................................................................................. 82 CHAPTER 4 REGIO- AND STEREO-SELECTIVE BIOHYDROXYLATIONS WITH A RECOMBINANT ESCHERICHIA COLI EXPRESSING P450PYR MONOOXYGENASE OF SPHINGOMONAS SP. HXN-200 ...................................................... 83 4.1 Introduction ......................................................................................................... 84 4.2 Experimental Section........................................................................................... 86 4.2.1 Chemicals ................................................................................................. 86 4.2.2 Strain and biochemicals ............................................................................ 86 4.2.3 Analytical methods ................................................................................... 87 4.2.4 Genetic engineering of E. coli BL21-pRSFDuet P450pyr-pETDuet Fdx FdR1500 [E. coli (P450pyr)] ....................................................................... 88 4.2.5 Growth and specific hydroxylation activity of E. coli (P450pyr) .............. 89 4.2.6 Protein gel and CO difference spectrum of CFE of E. coli (P450pyr)....... 91 4.2.7 Optimization of biohydroxylation of N-benzyl pyrrolidine-2-one 1 with E. coli (P450pyr) ......................................................................................... 92 4.2.8 Kinetic constants of biohydroxylation of N-benzyl pyrrolidine-2one 1 and N-benzyloxycarbonyl pyrrolidine 3 with CFE or resting cells of E. coli (P450pyr) ................................................................................................. 93 4.2.9 General procedure for the biohydroxylation of N-benzyl pyrrolidine-2-one 1 to N-benzyl-4-hydroxy-pyrrolidin-2-one 2 with resting cells of E. coli (P450pyr) ......................................................................... 94 4.2.10 General procedure for the biohydroxylation of (-)-!-pinene 5 to (1R)-trans-pinocarveol 6 with resting cells of E. coli (P450pyr) ........................ 94 4.2.11 General procedure for the biohydroxylation of norbornane 7, tetralin 9, and 6-methoxy-tetralin 11 with E. coli (P450pyr) .............................. 95 4.3 Results and Discussion ........................................................................................ 96 4.3.1 Genetic engineering, cell growth, and protein expression of E. coli (P450pyr) ............................................................................................................. 96 4.3.2 Biohydroxylation of N-benzyl pyrrolidine-2-one 1 and Nbenzyloxycarbonyl pyrrolidine 3 with E. coli (P450pyr) .................................... 98 VI 4.3.3 Preparation of (S)-N-benzyl-4-hydroxy-pyrrolidin-2-one 2 by biohydroxylation of N-benzyl pyrrolidine-2-one 1 with E. coli (P450pyr) ...... 101 4.3.4 Regio- and stereo-selective allylic biohydroxylation of (-)-!-pinene 5 to (1R)-trans-pinocarveol 6 with E. coli (P450pyr) ....................................... 103 4.3.5 Stereoselective biohydroxylation of norbornane 7 to exonorbornaneol 8 with E. coli (P450pyr) .............................................................. 105 4.3.6 Regioselective hydroxylation of tetralin 9 and 11 with E. coli (P450pyr) to 2- tetralol 10 and 12, respectively ................................................ 106 4.4 Summary and Conclusions ................................................................................ 109 CHAPTER 5 GREEN AND SELECTIVE TRANSFORMATION OF METHYLENE TO KETONE VIA TANDEM BIOOXIDATIONS IN ONE POT ................................... 110 5.1 Introduction ....................................................................................................... 111 5.2 Experimental Section......................................................................................... 113 5.2.1 Chemicals ............................................................................................... 113 5.2.2 Biocatalysts............................................................................................. 113 5.2.3 Analytical methods ................................................................................. 114 5.2.4 Cultivation of microorganisms ............................................................... 114 5.2.5 Purification of histag-RDR ..................................................................... 116 5.2.6 Selective hydroxylation of tetralin 1a and indan 1b with P. monteilli TA-5 ................................................................................................................ 117 5.2.7 Oxidation of (R)-1-tetralin 2a and (R)-1-indan 2b with LKADH .......... 118 5.2.8 Reduction of acetone to iso-propanol with NADPH as cofactor ........... 119 5.2.9 Selective hydroxylation of N-benzyl-piperidine 4 with E. coli (P450pyr) ........................................................................................................... 119 5.2.10 Oxidation of 1-benzyl-4-hydroxy-piperidine 5 with RDR ................... 119 5.2.11 Reduction of acetone to iso-propanol with NADH as cofactor ............ 120 5.2.12 Typical procedure for selective sequential oxidations of tetralin 1a to 1-tetralone 3a via tandem biocatalysis with NADP+ recycling in one pot ................................................................................................................... 120 5.2.13 Typical procedure for selective sequential oxidations of tetralin 1a and indan 1b to 1-tetralone 3a and 1-indanone 3b via tandem biocatalysis with NADP+ recycling in one pot .................................................................... 121 VII 5.2.14 Typical procedure for selective sequential oxidations of N-benzylpiperidine 4 to 1-benzyl-4-piperidone 6 via tandem biocatalysis with NAD+ recycling in one pot .............................................................................. 121 5.3 Results and Discussion ...................................................................................... 122 5.3.1 Tandem biocatalysts system for the selective sequential oxidations of tetralin 1a to 1-tetralone 3a with NADP+ recycling .................................... 122 5.3.2 Tandem biocatalysts system for the selective sequential oxidations of indan 1b to 1-indanone 3b with NADP+ recycling ..................................... 126 5.3.3 Tandem biocatalysts system for the selective sequential oxidations of N-benzyl-piperidine 4 to 1-benzyl-4-piperidone 6 with NAD+ recycling .......................................................................................................... 128 5.4 Summary and Conclusions ................................................................................ 131 CHAPTER 6 CONCLUSION AND RECOMMENDATION. .......................... 132 6.1 Conclusion ......................................................................................................... 133 6.2 Recommendation ............................................................................................... 136 BIBLIOGRAPHY ................................................................................................... 140 APPENDICES ......................................................................................................... 170 VIII SUMMARY Enzymatic oxidoreductions are very important biotransformations for efficient asymmetric synthesis, especially for the production of enantiopure compounds in pharmaceutical industry. The aim of this thesis is to develop novel and efficient biocatalytic systems for oxidoreductions in pharmaceutical synthesis. In this thesis, biocatalytic system for bioreduction with efficient recycling of NADPH was developed by coupling permeabilized microorganisms. Coupling of permeabilized cells of Bacillus pumilus Phe-C3 containing an NADPHdependent ketoreductase and E. coli recombinant expressing GDH as novel biocatalytic system allowed for the enantioselective reduction of ethyl 3-keto4, 4, 4-triflurobutyrate with efficient recycling of NADPH: a total turnover number (TTN) of 4200 was achieved by using E. coli BL21 (pGDH1) as the cofactor-regenerating microorganism with the initial addition of 0.005 mM NADP+. In long-term stability test, 50.5 mM of (R)-ethyl 3-hydroxy-4, 4, 4triflurobutyrate was obtained in 95% ee and 84% conversion with an overall TTN of 3400. Thus, a practical method for (R)-ethyl 3-hydroxy-4, 4, 4triflurobutyrate preparation was developed, and its principle is generally applicable to other microbial reductions with cofactor recycling. In this thesis, a recombinant Escherichia coli expressing P450pyr monooxygenase of Sphingomonas sp. HXN-200 was developed as a useful biocatalyst for regio- and stereo-selective hydroxylation, with no side reactions and easy cell growth. Biohydroxylation of N-benzyl pyrrolidine-2one with the resting cells gave (S)-N-benzyl-4-hydroxypyrrolidin-2-one in >99% ee and 10.8 mM, a 2.6 times increase of product concentration in IX comparison with the wild-type strain. Moreover, hydroxylation of (-)-!-pinene with the recombinant E. coli cells showed excellent regio- and stereoselectivity and gave (1R)-trans-pinocarveol in 82% yield and 4.1 mM, which is over 200 times higher than that obtained with the best biocatalytic system known thus far. The recombinant strain was also able to hydroxylate other types of substrates with unique selectivity: biohydroxylation of norbornane gave exo-norbornaeol, with exo/endo selectivity of 95%; tetralin and 6methoxy-tetralin were hydroxylated at the non-activated 2-position, for the first time, with regioselectivities of 83-84%. In this thesis, the novel concept of utilizing tandem biocatalysts system for selective sequential oxidation-oxidation was first time proven by coupling whole-cell biocatalyst P. monteilii TA-5 containing monooxygenase with a commercially available enzyme Lactobacillus kefir alcohol dehydrogenase (LKADH), and using tetralin as substrate. Moreover, “coupled substrate” acetone and small amount of NADP+ were added for simultaneously cofactor recycling. By coupling 10+5 g cdw/L of P. monteilii TA-5 with 3 g protein/L LKADH, 6 mM tetralin was completely converted within 30 h. At the end point, pure 1-tetralone was produced in 5.25 mM with 87.5% yield, 99% regioselectivity, and a TTN of 2200 for NADP+ recycling. An increased TTN of 4100 was achieved by lowering initial amount of NADP+ to 0.001 mM. Indan with similar chemical structure to tetralin was also examined for the same sequential oxidations. The novel concept was also proved by sequential oxidation-oxidation of N-benzyl-piperidine to 1-benzyl-4-piperidone via 1benzyl-4-hydroxy-piperidine with two different biocatalysts. While E. coli (P450pyr) selectively hydroxylated non-activated methylene group of N- X benzyl-piperidine at 4-position, E. coli (RDR) further oxidized the C-H bond to C=O. XI LIST OF TABLES Table 2.1 Classification of enzymes .......................................................................... 21 Table 2.2 Alkane oxidation by wild-type P450BM-3 and its 139-3 variant ................. 26 Table 2.3 Costs of NAD(P)+ and NAD(P)H.............................................................. 36 Table 3.1 Preparation conditions and GDH activities of the permeabilized cells of E. coli XL-1 Blue (pGDH1) and E. coli BL21 (pGDH1) ..................................... 74 Table 3.2 Coupled permeabilized cells of B. pumilus Phe-C3 and a cofactorregenerating microorganism for bioreduction of ethyl 3-keto-4, 4, 4triflurobutyrate 1 with NADPH recycling ................................................................. 78 Table 3.3 Product formation in bioreduction of ethyl 3-keto-4,4,4-triflurobutyrate 1 with coupled permeabilized cells ............................................................. 81 Table 4.1 Kinetic constants of hydroxylation of 1 and 3 with CFE and resting cells of E. coli (P450pyr), respectively ..................................................................... 100 Table 4.2 Regio- and stereo-selective hydroxylation of (-)-!-pinene 5 with E. coli (P450pyr) to (1R)-trans-pinocarveol .................................................................. 104 Table 4.3 Selective biohydroxylation of norbornane 7, tetralin 9, and 6methoxy-tetralin 11 with E. coli (P450pyr) .............................................................. 107 Table 5.1 Selective sequential oxidations of tetralin 1a and indan 1b to 1tetralone 3a and 1-indanone 3b via tandem biocatalysis with NADP+ recycling in one pot ................................................................................................................. 125 Table 5.2 Selective sequential oxidations of N-benzyl-piperidine 4 to 1benzyl-4-piperidone 6 via tandem biocatalysis with NAD+ recycling in one pot ... 129 XII LIST OF FIGURES Figure 1.1 World market for chiral molecules by different technology ...................... 2 Figure 1.2 Substrate-coupled and enzyme-coupled approaches for NAD(P)H recycling ...................................................................................................................... 3 Figure 1.3 Selective biohydroxylation catalyzed by monooxygenase ........................ 4 Figure 1.4 Comparison of traditional vs. tandem catalysis ......................................... 5 Figure 2.1 Fine chemicals that are produced by biocatalysis .................................... 16 Figure 2.2 Enantiomers of Sopromidine with opposite biological effect .................. 17 Figure 2.3 Atorvastation (Lipitor®): inhibitor of HMG-CoA reductase................... 17 Figure 2.4 Screening of efficient biocatalysts for enantioselective benzylic hydroxylation ............................................................................................................. 23 Figure 2.5 Construction of recombinant strain .......................................................... 24 Figure 2.6 SDS-PAGE analysis of total proteins in original strain and engineered strain ........................................................................................................ 24 Figure 2.7 Directed evolution .................................................................................... 25 Figure 2.8 P450cam biohydroxylation system ............................................................ 32 Figure 2.9 Structures of the cofactors NAD(P)+ and NAD(P)H ............................... 35 Figure 2.10 Structures of (a) Gram-negative and (b) Gram-positive outer cell layers.......................................................................................................................... 44 Figure 3.1 Bioreduction with NADPH recycling by using permeabilized microorganisms. OEt, OC2H5; G-6-PDH, glucose-6-phosphate dehydrogenase; 1, ethyl 3-keto-4,4,4-trifluorobutyrate; (R)-2, (R)-ethyl 3-hydroxy-4,4,4trifluorobutyrate ......................................................................................................... 62 Figure 3.2 Growth and GDH activities of E. coli XL-1 Blue (pGDH1) and E. coli BL21 (pGDH1). Cell growth: E. coli XL-1 Blue (pGDH1) (▲); E. coli BL21 (pGDH1). GDH activity of CFE (-); E. coli XL-1 Blue (pGDH1) (●); E. coli BL21 (pGDH1) (■) ........................................................................................... 72 Figure 3.3 SDS-PAGE of E. coli BL21 (pGDH1) (lane 1), E. coli BL21 pUC18 (lane 2), E. coli XL-1 Blue (pGDH1) (lane 3), and B. subtilis BGSC 1A1 (lane 4) ............................................................................................................... 73 XIII Figure 3.4 Product formation in bioreduction of ethyl 3-keto-4,4,4-triflurobutyrate 1 by using coupled permeabilized cells with the addition of 0.005 mM NADP+ at different time points. B. pumilus Phe-C3 (40 g cdw/L) and E. coli BL21 (pGDH1) (20 g cdw/L; activity: 61 U/g cdw) with 120 mM 3ketoester 1 (●) and with 60 mM 3-ketoester 1 (□) .................................................. 80 Figure 4.1 Growth (□) and hydroxylation activity for 1 (■) and 3 (▲) of E. coli (P450pyr) .............................................................................................................. 97 Figure 4.2 SDS-PAGE of CFE of E. coli (P450pyr). non-induced (lane 1), induced with IPTG for 2 h (lane 2), 3 h (lane 3), 4 h (lane 4), and 5 h (lane 5). ....... 97 Figure 4.3 CO difference spectra of CFEs of E. coli (P450pyr): (") noninduced; (---) induced with IPTG for 3 h .................................................................. 98 Figure 4.4 Time course of the formation of (S)-N-benzyl-4-hydroxypyrrolidin-2-one 2 in biohydroxylation of N-benzyl pyrrolidine-2-one 1 with resting cells of E. coli (P450pyr) (5 g cdw/L) in KP buffer (50 mM; pH 8.0) containing glucose (2%, w/v) at 25 ºC and at different substrate concentrations. 5 mM (!); 10 mM (#); 15 mM (-); 20 mM ($); 25 mM (").................................... 102 Figure 4.5 GC chromatograms of samples taken from biohydroxylation of (-)!-pinene 5 (5 mM) in 10 mL cell suspension (10 g cdw/L) in KP buffer (50 mM; pH 8.0) containing glucose (2%, w/v) at 300 rpm and 25 ºC . A) 0 min; B) 5 h ....................................................................................................................... 104 Figure 5.1 SDS-PAGE of cell lysate (lane 1); loading filtrate (lane 2); 10 mM imidazole buffer wash sample (lane 3); 50 mM imidazole buffer wash sample (lane 4); 250 mM imidazole buffer wash fraction one (lane 5); 250 mM imidazole buffer wash fraction two (lane 6); 250 mM imidazole buffer wash fraction three (lane 7); 250 mM imidazole buffer wash fraction four (lane 8); 250 mM imidazole buffer wash fraction five (lane 9) ............................................. 117 Figure 5.2 Selective sequential oxidations of tetralin 1a to 1-tetralone 3a via tandem biocatalysis with NADP+ recycling in one pot. A: 1-tetralone 3a standard, BA is internal standard benzyl alcohol; B: 1 h sample; C: 5 h sample; D: 30 h sample. Reaction conditions: 6 mM 1a, 10+5 g cdw/L TA-5, 3.5 g protein/L LKADH, and 0.001 mM NADP+ ............................................................ 124 Figure 5.3 Time course of selective sequential oxidations of tetralin 1a and indan 1b to 1-tetralone 3a and 1-indanone 3b via tandem biocatalysis with NADP+ recycling in one pot. 3a (%), (R)-2a ("), 3b (&) and (R)-2b (#). Reaction conditions: 6 mM 1a or 1b, 10+5 g cdw/L TA-5, 3.5 g protein/L LKADH, and 0.001 mM NADP+ ............................................................................ 126 Figure 5.4 Selective sequential oxidations of indan 1b to 1-indanone 3b via tandem biocatalysis with NADP+ recycling in one pot. A: 1-tetralone 3b standard, BA is internal standard benzyl alcohol; B: 1 h sample; C: 5 h sample; XIV D: 30 h sample. Reaction conditions: 6 mM 1b, 10+5 g cdw/L TA-5, 3.5 g protein/L LKADH, and 0.001 mM NADP+ ............................................................ 127 Figure 5.5 Selective sequential oxidations of N-benzyl-piperidine 4 to 1benzyl-4-piperidone 6 via tandem biocatalysis with NAD+ recycling in one pot. A: 1-benzyl-4-piperidone 6, PA is internal standard 1-phenylethanol; B: 1 h sample; C: 5 h sample; D: 25 h sample. Reaction conditions: 5 mM N-benzylpiperidine 4, 10 g cdw/L P450pyr, 4 g protein/L RDR, and 0.001 mM NAD+ ...... 129 XV LIST OF SYMBOLS 6-APA 6-Aminopenicillanic Acid FDA Food and Drug Administration of the United States of America ADH Alcohol Dehydrogenase GDH Glucose Dehydrogenase NAD(P)＋ #-Nicotinamide Adenine Dinucleotide (Phosphate) NAD(P)H Reduced #-Nicotinamide Adenine Dinucleotide (Phosphate) DKR Dynamic Kinetic Resolution IUB International Union of Biochemistry E. coli Escherichia coli HTP High Throughput LKADH Lactobacillus kefir Alcohol Dehydrogenase HLADH Horse Liver Alcohol Dehydrogenase TBADH Thermoanaerobium brockii Alcohol Dehydrogenase LBADH Lactobacillus brevis Alcohol Dehydrogenase IPA Isopropyl Alcohol BVMO Baeryer-Villiger Monooxgenase sMMO soluble Methane Monooxygenase MMOH MMO Hydroxylase MMOR MMO Reductase AlkB Alkane Hydroxylase AlkG Alkane Rubredoxin AlkT Alkane Rubredoxin Reductase XVI Fdx Ferredoxin FdR Ferredoxin Reductase FAD Flavine Adenine Dinucleotide FMN Flavine Mononucleotide ATP Adenosine Triphosphate TTN Total Turnover Number TF Turnover Frequency LDH Lactate dehydrogenase MB Methylene Blue ISPR in situ Product Removal FDH Formate Dehydrogenase LPS Lipopolysaccharide G-6-PDH Glucose-6-phosphate Dehydrogenase CPO Chloroperoxidase GOx Glucose Oxidase ITPG Isopropyl !-D-Thiogalactopyranoside BSA Bovine Serum Albumin CFE Cell-free Extract MCS Multiple Cloning Site LB Luria-Bertani PCR Polymerase Chain Reaction SDS-PAGE Sodium Dodecyl Sulfate-Polyacrylamide Gel Electrophoresis KP Potassium Phosphate BA Benzyl Alcohol PA 1-Phenylethanol XVII CHAPTER 1 INTRODUCTION 1 1.1 Background 1.1.1 General applications of biocatalysis in pharmaceutical industry Biocatalysis has merged as an important tool in organic synthesis, especially in pharmaceutical industry. The main application of biocatalysis in pharmaceutical synthesis is to utilize its high selectivity to produce chiral compounds with high purity, which is usually difficult to achieve by traditional chemistry. In the past decade, the worldwide market for chiral fine chemicals has been increasing very fast with a growth rate of ca. 12% annually. According to the statistics of world chiral technology from Frost and Sullivan (Figure 1.1), the world annual market for chiral molecules was about 7 billion in 2002 US$, and biosynthesis accounted for 10% of world production of chiral chemicals. However, by the end of 2009, it rose to 22%, and the revenues for chiral technologies amounted to 14.9 billion US$.1 2002 TOTAL: $7BN 2009 TOTAL: $14.9BN Source: Frost & Sullivan Figure 1.1. World market for chiral molecules by different technology. 2 1.1.2 Cofactor recycling in biocatalytic oxidoreductions Biocatalytic oxidoreductions are important reactions in biosynthesis for chiral compounds.2-6 However, these reactions often need stoichiometric amount of the expensive cofactor NAD(P)H or NAD(P)+, which need to be efficiently recycled during the reaction for practical application.7-14 Enzymatic cofactor recycling can be realized by “coupled substrates”and “coupled enzymes” approaches (Fig.1.2). The latter is more general and utilizes the first enzyme for the desired biotransformation and the second one for cofactor recycling. In this approach, the cofactor regenerating biocatalyst is either isolated enzyme or whole cell containing necessary enzyme.15-23 While approaches based on isolated enzymes16-19,23 are expensive, less stable, approaches based on whole cells20-22 depend on the amount of available intracellular cofactor which may be limiting and cannot be altered by the addition of extracellular cofactor. (a) O R (b) Coupled substrate O OH R Single NAD(P)H enzyme NAD(P)+ (ADH) O OH Coupled enzyme Enzyme A (ADH) OH R R NAD(P)H Cosubstrate NAD(P)+ Enzyme B Coproduct Figure 1.2. Substrate-coupled and enzyme-coupled approaches for NAD(P)H recycling. 1.1.3 Regio- and stereo-selective biohydroxylation Regio- and stereo-selective hydroxylation, especially the hydroxylation at non-activated carbon atom, is a very useful reaction in organic chemistry. 3 However, this type of transformations remains as a great challenge in classical chemistry. On the other hand, hydroxylation can be achieved by using an enzyme such as a monooxygenase which catalyzes the insertion of one O atom of molecular oxygen into a specific C-H bond (Fig.1.3). In addition to the high regio- and stereo-selectivity, biohydroxylation utilizes molecule oxygen as oxidant, thus being an ideal tool for green oxidation and sustainable chemical synthesis. Although many cytochrome P450 monooxygenases25-44 have been identified with the ability to catalyze regio- and stereo-selective hydroxylation, it is still difficult to obtain appropriate monooxygenase with desired substrate specificity and high selectivity and to construct active recombinant biocatalysts via genetic engineering of P450 monooxygenase thus far, possibly due to the particular complicacy of P450 enzyme and system. R H + O2 + H+ + NAD(P)H Monooxygenase R OH + NAD(P)+ + H2O Figure 1.3. Selective biohydroxylation catalyzed by monooxygenase. 1.1.4 Tandem biocatalysis Tandem biocatalysis with multiple biocatalysts in one pot enables multi-step sequential reactions in the same mild conditions, thus avoiding the timeconsuming, yield-decreasing, and waste-producing isolation and purification of intermediates (Fig.1.4). Tandem biocatalysis is regarded as an important direction for sustainable chemical and pharmaceutical synthesis, and gaining more and more attention.45-53 Although in nature, it is quite common that a single microorganism that contains multiple enzymes can uptake and 4 metabolize nature compound such as glucose,54-59 it is not easy to find and array appropriate multiple biocatalysts to carry out sequential bioconversions, especially for efficient oxidoreductions. In terms of tandem biocatalysts systems for enzymatic sequential reactions, only two deracemization examples of sequential oxidation-reduction for deracemization have been reported thus far.60-62 In terms of enzymatic sequential oxidation-oxidation with tandem biocatalysts systems, due to the complicacy of its electron transfer system and the variety of its reaction mechanism, no practical example has been published yet. A Traditional catalysis Tandem catalysis Traditional catalysis Conversion steps Conversion steps B C C D B C Recovery steps Recovery steps B A D D D Figure 1.4. Comparison of traditional vs. tandem catalysis. 1.2 Objective and Approach The main purpose of this thesis is to develop novel and efficient biocatalytic systems for oxidoreductions in pharmaceutical synthesis. More specifically: 1) We aim to develop an efficient bioreduction system with cofactor recycling by coupling two permeabilized microogransims. 5 Previously, we developed a novel method for efficient bioreduction with cofactor recycling by coupling two permeabilized microorganisms, one containing keto-reductase, while the other containing glucose dehydrogenase (GDH).63 However, the total turnover number (TTN) for cofactor recycling and final product concentration were not high enough for practical application. The main reason is the relative low activity of the whole cell biocatalyst for cofactor recycling. We want to improve the TTN for cofactor recycling and final product concentration in this bioreduction system by enhancing the activity of the cofactor regenerating strain. Because nicotinamide cofactor normally has a half-life time about 24 h in reaction system, by increasing the activity of cofactor regenerating strain, more products could be produced before the cofactor completely decomposes, thus leading to higher TTN for cofactor recycling. Firstly, we construct a recombinant strain for cofactor recycling with improved activity by choosing suitable plasmid, suitable host cell, and expression optimization. Then, we permeabilize the new cofactor recycling strain and couple it with permeabilized bioredcution strain in order to achieve higher TTN and increased final product concentration. 2) We aim to engineer a recombinant E. coli strain expressing P450pyr monooxygenase with high hydroxylation activity, no side reaction, and easy growth on non-flammable substrate, and then employ this recombinant strain for regio- and stereo-selective hydroxylation. Previously, we discovered Sphingomonas sp. HXN-200 containing a P450pyr monooxygenase as a powerful biohydroxylation catalyst with 6 unique substrate specificity and range as well as high selectivity.64 The wild-type strain was shown to be the best catalyst known thus far for the hydroxylation of a range of alicyclic substrates.65-68 Later, a Pseudomonas putida strain expressing P450pyr monooxygenase was constructed.69 However, the hydroxylation activity of the P. putida recombinant strain was rather low. Moreover, both the wild-type strain and the P. putida recombinant need to grow on n-octane which is a flammable and relatively expensive substrate, thus being a technical challenge in large-scale application. By the means of choosing suitable plasmid, suitable host cell, construction strategy, and expression optimization, we construct a new E. coli recombinant strain which is able to grow easily in LB media, shows elevated hydroxylation activity, and gives higher product concentration compared to either our wildtype strain Sphingomonas sp. HXN-200 or the best biocatalyst know thus far. Final product concentration is one of the key critieria commonly used to evaluate a chemical process in pharmaceutical industry. 3) We aim to develop novel tandem biocatalysis as the first example for selective sequential oxidations of methylene group into ketone by the use of a monooxygenase and an alcohol dehydrogenase (ADH) in one pot. Selective oxidation of methylene group (C-H bonds) into ketone is a useful synthetic method to generate many crucial chemical and pharmaceutical compounds. However, methylene groups, abundant in chemical structures, are the most challenging chemical groups to be 7 selectively functionalized, since they are inert to most chemical reagents. Thus far, the selective oxidation of methylene groups into ketone still poses a great challenge to traditional chemistry.70-79 Furthermore, it has remained impossible to oxidize non-activated C-H into C=O with high selectivity.80-83 Tandem biocatalysis for selective sequential oxidations of methylene group into ketone by the use of a monooxygenase and an alcohol dehydrogenase (ADH) in one pot might be a possible alternative. In nature, it is quite common that microbial cells containing multiple enzymes can uptake and metabolize nature compound via sequential bioconversions. However, it is not easy to find and array appropriate multiple biocatalysts to carry out sequential biocatalysis with non-natural substance to achieve full conversion. To date, only scarce examples have been reported for sequential transformations with tandem biocatalysis in organic synthesis, and there is no tandem biocatalysts system for sequential oxidations has been reported yet. It is difficult in both concept and practice. Enzymatic oxidations are quite complicated, involving electron transfer, varied mechanisms, etc, and it is difficult to efficiently find and arrange necessary biocatalysts for tandem biooxidations. We look for suitable biocatalysts from strain stock in our lab, as well as commercially available enzymes, and then fine-tune and optimize experimental conditions to demonstrate the novel concept. 8 1.3 Organization After this introduction, an overview of biocatalysis is provided, especially oxidoreductions in pharmaceutical synthesis. In Chapter 3, the bioreduction with efficient recycling of NADPH by coupled permeabilized microorganism is described. The regio- and stereo-selective biohydroxylations with a recombinant Escherichia coli expressing P450pyr monooxygenase of Sphingomonas sp. HXN-200 is discussed in the following Chapter. In Chapter 5, the green and selective transformation of methylene to ketone via tandem biooxidations in one pot is demonstrated. Chapter 6 concludes the whole thesis and recommends the future work. 9 CHAPTER 2 LITERATURE OVERVIEWS 10 2.1 Overview of Biocatalysis in Organic Synthesis Brewing, with a history about 6,000 years, is one of the oldest biocatalyses known to humans. Only in recent 100 years, biocatalysis is employed for the production of non-natural organic compounds, either with isolated enzyme or with whole cells. For the past 30 years, biocatalysis is increasingly applied to the synthesis of fine chemicals, especially in pharmaceutical industry. The growing emphasis on green and sustainable processes makes biocatalysis a more and more valuable alternative to traditional chemistry in chemical synthesis.84 . 2.1.1 Advantages of biocatalysis Biocatalysis has plenty of advantages: biocatalysis is usually highly selective, including chemo-, regio-, and stereo-selectivity; biocatalysis has mild operation conditions, such as room temperature and neutral pH; enzymes are non-toxic catalysts; multiple biocatalyses can be performed in one pot, thus allowing cascade reactions which avoid the time-consuming, yield-reducing, and waste-producing purification of intermediate; enzymes are efficient catalysts, and the rates of biocatalysis are much higher than their chemical counterparts by some orders of magnitude; biocatalysis usually generates minimal undesired side-reactions such as rearrangement, decomposition, isomerization and racemization due to their mild operation conditions; enzymes can catalyze a broad range of reactions, including the selective conversion at non-activated sites in a substrate which is very difficult for 11 traditional chemistry; enzymes are not restricted to their natural substrates, many enzymes exhibit a high substrate tolerance to non-natural substances; enzymes can also work in an non-aqueous environment, and some enzymes can catalyze the reaction in organic solvent or in biphasic system to improve substrate and product solubility.85,86 2.1.1.1 High selectivity (chemo-, regio- and stereo-selectivity) The primary reason for using biocatalysis in organic synthesis is to utilize the high chemo-, regio-, and stereo-selectivity of enzymes.87 O n-C4H9 N O O n-C4H9 N O Grape (Vitis vinifera L.) NO2 NHOH Scheme 2.1 Chemoselective bioreduction of aromatic nitro group to hydroxylamine. The chemoselectivity of enzymes means that they can selectively act on a single type of functional group while in the presence of others. For instance, cells from a grape (Vitis vinifera L.) reduced aromatic nitro compound 4-nitrosubstituted naphthalimide to the corresponding hydroxylamine with 100% chemoselectivity (Scheme 2.1). In this case, only nitro group of the substrate was selectively reduced, while carbonyl groups survived. Furthermore, the reaction stopped at the stage of hydroxylamine, no further reduced product amine was examined.88 12 The regioselectivity of enzymes means that they may be able to distinguish between functional groups which are chemically situated in different regions, due to their complex three-dimensional structure. For example, Sphingomonas sp. HXN-200 selectively hydroxylated N-benzyl-piperidin-2-one at 4 position to produce 4-hydroxypiperidion-2-one with 99.9% regioselectivity, while kept other carbon atoms at 2 and 3 positions intact (Scheme 2.2).68 OH Sphingomonas sp. HXN-200 N CH2Ph N CH2Ph Scheme 2.2 Regioselective hydroxypiperidion-2-one. biohydroxylation of N-benzyl-piperidin-2-one to 4- The stereoselectivity of enzymes means that they can catalyze the reaction in which one enantiomer is formed in preference to the other. This is because enzymes are chiral catalysts since almost all of them are made from L-amino acids, and their specificity can be exploited for selective and asymmetric conversions. For example, tetralin was selectively hydroxylated with resting cells of Pseudomonas monteilii TA-5, giving the optically active product (R)1-tetralol in 99% ee. (Scheme 2.3).89 OH Pseudomonas monteilii TA-5 Scheme 2.3 Stereoselective biohydroxylation of tetralin to (R)-1-tetralol. 13 Due to its exquisite chemo-, regio-, and stereo-selective properties, biocatalysis is widely used for selective transformation, especially for those, which are not easy to be achieved by classical organic chemistry. 2.1.1.2 Environmentally benign catalysis Most biocatalysis can be performed in an environmentally benign manner, e.g., operation in water at ambient temperature and neutral pH, environmentally compatible and biodegradable catalyst (an enzyme) derived from renewable raw materials, capability to metabolize natural substrates (renewable raw materials) to produce useful products, avoiding the use of large amount organic solvent and toxic metal catalysts, no need for high pressure and extreme conditions, thereby minimizing the hazardous substances involved, and saving energy normally required for processing. Due to its environmentally benign feature, biocatalysis is regarded as a promising way to achieve green chemistry goals. Green catalytic synthesis that meets increasingly stringent environmental requirements is greatly demanded in pharmaceutical and chemical industries. Green chemistry, also called sustainable chemistry, can be conveniently defined as: the efficient utilization of (preferably renewable) raw materials, elimination of waste and avoiding the use of toxic and/or hazardous reagents and solvents in the manufacture and application of chemical products. 45,90 Furthermore, the use of enzymes generally circumvents the need for the functional group activation and protection often required in traditional organic syntheses, affording more environmentally and economically attractive 14 processes with fewer steps and, hence, less waste. This is clearly illustrated by the remarkable transition of deacylation of penicillin G into 6aminopenicillanic acid (6-APA) from multiple-step classical chemical synthesis (Scheme 2.4) to biotransformation (Scheme 2.5).91 The one-step enzymatic cleavage of penicillin G was carried out in water rather than in halogenated solvent PCl5 at -40 °C with multiple-step reactions, and afforded 6-APA in excellent yield.92,93 It is estimated that at least 16,000 tones of 6APA is produced by biocatalysis each year. H N O S CH3 N O N 1. Me3SiCl CH3 - + COO K Cl 2.PCl5, -40°C S N O CH3 CH3 COOSiMe3 Penicillin G N 3. n-BuOH, -40°C S OBu O 4. H2O COOBu N CH3 CH3 COOSiMe3 + H3N S + CH3 N O CH3 COO- 6-APA Scheme 2.4 Chemical deacylation of penicillin G into 6-APA. H N O O S N Penicillin G CH3 CH3 COO-K+ H2O penicillin acylase + S H3N O N CH3 CH3 COO6-APA + PhCH2COO-K+ Scheme 2.5 Enzymatic deacylation of penicillin G into 6-APA. 15 2.1.2 General applications of biocatalysis in organic synthesis Biocatalysis has emerged as an important tool in organic synthesis. A large number of fine chemicals have been produced by the means of biocatalysis, ranging from achiral compounds to products with multiple chiral centers (Figure 2.1).94 O O O NH2 N NH2 N Nicotinamide Acrylamide CH3 1,5-Dimethyl-2-piperidone HN O HO H2N COOH N H HO NH2 OMe O O (S)-tert-Leucine NH2 HO O Ephedrine NH2 H N O Amoxicillin Aspartame S N Me Me COOH O H N O S N Me COOH Cephalexin Figure 2.1. Fine chemicals that are produced by biocatalysis. Chiral compounds account for a large part of pharmaceutical products. In 2000, 35% of pharmaceutical intermediates were chiral and this number is expected to increase to 70% by the end of 2010.95,96 It has been known for the last decades that different stereoisomers frequently differ in terms of their biological activity and pharmacokinetic profiles, and the use of such mixtures 16 or opposite enantiomer may contribute to the adverse effects of the drug. For a striking example, the (R)-sopromidine is an agonist at H2-receptors, while the (S)-enantiomer is an antagonist; the racemate exhibits the properties of a partial agonist on guinea pig atrium preparation (Figure 2.2).97 Although the major regulatory authorities including Food and Drug Administration of the United States of America (FDA) do not force the submission of single enantiomer drugs, they do encourage it by requiring additional information on the pharmacology effect of racemic candidates. As a result, in recent years, the percentage of single isomer drugs approved by FDA kept increasing. N N H H N H N H CH3 NH S N H3C N H Agonist at H2-receptors (R)-Sopromidine N N H H N H N H3C H NH S N H3C N H Antagonist at H2-receptors (S)-Sopromidine Figure 2.2. Enantiomers of Sopromidine with opposite biological effect. OH OH O F OH N O Lipitor Figure 2.3. Atorvastation (Lipitor®): inhibitor of HMG-CoA reductase. 17 Biocatalytic production of enantiopure compounds can be divided into two different manners: kinetic resolution of a racemic mixture and asymmetric synthesis. Biocatalysis plays important role in the manufacture of pharmaceuticals, where selective reactions are very crucial. Many important pharmaceutical intermediates and products synthesized by biocatalysis have been reported.98,99 For example, Lipitor developed by Pfizer is one of the best-selling drugs in the world (Figure 2.3), and its key intermediate hydroxynitrile was produced by biocatalysis. Reduction step gave exquisite ee >99.9 % and cyanation step maintained stereochemistry completely (Scheme 2.6).100 This process has already been successfully applied to tons scale. O Cl CO2Et OH ADH/GDH Cl CO2Et NAD(P)H OH HCN Halohydrin dehalogenase NC CO2Et Scheme 2.6 Manufacture of pharmaceutical intermediate Hydroxynitrile (ee > 99.9%). 2.1.2.1 Biocatalytic kinetic resolution of a racemic mixture In biocatalytic kinetic resolution of a racemic mixture, one of the enantiomers can be converted at a higher rate than the other enantiomer. For example, a dehalogenase from Pseudomonas putida catalyzed the (R)-isomer of racemic 2-chloropropanoic acid into lactic acid, while the (S)-2-chloropropanoic acid was unreacted, and then isolated from the reaction mixture (Scheme 2.7).101 18 The biotransformation was brought to full-scale manufacture in 1991, and currently 2,000 tons of (S)-2-chloropropanoic acid are annually produced in this manner. H Cl HO2C H2O CH3 H HCl HO2C + H HO2C Cl H + CH3 HO2C OH CH3 dehalogenase Cl CH3 (S)-2-chloropropanoic acid L-lactic acid Scheme 2.7 Kinetic resolution of 2-chloropropanoic acid. In theory, the maximum yield of such kinetic resolutions is 50%, since both enantiomers are equal in the racemic mixtures. However, if the two enantiomeric substrates can continuously racemize during the resolution, then all substrate may be converted into enantiopure product. This is called dynamic kinetic resolution (DKR). For example, lipase was used as the biocatalyst in the enantioselective hydrolysis of (S)-naproxen thioester from racemic naproxen thioester, in which trioctylamine was added to perform in situ racemization of the remaining (R)-thioester substrate (Scheme 2.8).102 O O S S + CH2CF3 O S S O + H2O CH2CF3 O lipase OH OCt3N, H2O S O + CF3CH2SH + +H+ -H +H+ -H+ OS S CH2CF3 O Scheme 2.8 Dynamic kinetic resolution of (R, S)-naproxen thioester. 19 2.1.2.2 Biocatalytic asymmetric synthesis Enzyme, as an enantiopure substance, can introduce chirality into non-chiral substrate in enantioselective way. For example, yeast Saccharomyces cerevisiae selectively reduced !-chloroacetoacetic acid octyl ester by addition of hydrogen on a carbonyl group, to give the intermediate (R)-!-chloro-"hydroxybutanoic acid octyl ester (Scheme 2.9) for L-carnitine synthesis.103 The high selectivity of the enzyme-catalyzed reaction results in the formation of only one enantiomer of the product, and this biosynthetic process is used to produce thousands tons of L-carnitine a year. O Cl O Reductase Cl OC8H17 !--chloroacetoacetic acid octyl ester HO H O OC8H17 (R)-!-chloro-"-hydroxybutanoic acid octyl ester Scheme 2.9 Biocatalyzed asymmetric reduction of !-chloroacetoacetic acid octyl ester. 2.2 Enzymes Enzymes are proteins with catalytic functions, thus being able to initiate or increase the rate of a biochemical reaction. They could be used as isolated enzyme, cell lysate or inside of microbial cell. 20 2.2.1 Classification of enzymes Table 2.1 Classification of enzymes Enzyme Class Reaction Catalyzed Enzyme examples To catalyze oxidation/reduction reactions; 1. Dehydrogenase, transfer of H and O atoms or electrons from Oxidoreductases oxidase one substance to another Transfer of a functional group from one Transaminase, 2. Transferases substance to another. The group may be kinase methyl-, acyl-, amino- or phosphate group Formation of two products from a substrate Lipase, 3. Hydrolases by hydrolysis peptidase Non-hydrolytic addition or removal of Decarboxylase, 4. Lyases groups from substrates. C-C, C-N, C-O or aldolases C-S bonds may be cleaved Intramolecule rearrangement, i.e. Fumarase, 5. Isomerases isomerization changes within a single mutase molecule Join together two molecules by synthesis of 6. Ligases new C-O, C-S, C-N or C-C bonds with Synthetase simultaneous breakdown of ATP The enzymes that have been exploited for organic synthesis, as well as the type of reaction catalyzed, are summarized in Table 2.1.86 The importance of practical applications for organic synthesis is not all evenly distributed among different enzymes. Among all these enzymes, hydrolases and oxidoreductases are most important for practical organic synthesis.104 21 2.2.2 Exploitation of enzymes New or improved biocatalysts can be obtained in several different waysscreening available natural sources, genetic engineering and protein engineering of known enzymes. In 2006, over 3,000 enzymes have been recognized by the International Union of Biochemistry (IUB), and this number may be greatly augmented in the wake of genomic and proteomic research.86 2.2.2.1 Screening of new microorganisms Screening of a broad variety of microorganisms represents the traditional method used to discover new enzymes. Microorganisms are of particular interest because of their short generation time and large diversity of metabolic pathways and enzymes. In vivo screening of microorganisms is often used for the discovery of new enzyme, especially for cofactor dependent multi-component enzyme.105,106 To avoid random screening of a large number of microorganisms, pre-selection are usually done on microorganisms which possibly contain the desired enzymes based on their degradation ability. Miniaturized screening system allows the parallel inoculation, growth, and bioconversion of microorganisms on microtiter plates, thus greatly improving the screening efficiency. For example, F. Lie et al. collected and isolated a set of 22 toluene- and ethylbenzene-degrading strains from the sediment, and topsoils in Singapore. Those strains were screened for the enantioselective benzylic hydroxylation of 22 indan and tetralin, and Pseudomonas monteilii TA-5 was discovered as an active and selective biocatalyst for such hydroxylation (Fig.2.4).89 Soil collection locations Microtiter plate screening Isolated strains OH Pseudomonas monteilii TA-5 n n n = 1 99% ee, 65% yield n = 2 99% ee, 63% yield Figure 2.4. Screening of efficient biocatalysts for enantioselective benzylic hydroxylation. 2.2.2.2 Genetic engineering of recombinant strains for more efficient biocatalysts In general, microorganisms isolated from nature only can produce the desired enzyme at a low level, with low activity, or even with low selectivity, which cannot provide an economical production process, thus a modification of the enzyme is needed. Genetic engineering or recombinant DNA technology is developed by which the genes encoding the desired enzyme could be over-expressed in wellunderstood host microorganisms. The resulting engineered strains express the desired enzyme at an elevated level, thus providing a more economical production process. Moreover, the engineered strains can also avoid side 23 reactions which the original microorganism may suffer, since the genes coding for the enzyme catalyzing unwanted reaction are not transferred into the new host cells. K. J. Xiang et al. engineered a recombinant Escherichia coli (E. coli) strain over-expressing glycerol dehydrogenase (GldA) (Fig.2.5), and the recombinant strain demonstrated much higher catalytic activity compared to wild-type strain (Fig.2.6). 107 E. coli genome gldA gldA Amp’ BamH # and Xho# Expression Vector Amp’ Ligase pET-21b Recombinant Plasmid Transfer Only gldA’ recombinants can survive LB Plate (Amp’) and Xho# Expression GldA gldA Amp’ Host E. coli cell Figure 2.5. Construction of recombinant strain. Recombinant Original Figure 2.6. SDS-PAGE analysis of total proteins in original strain and engineered strain. 24 2.2.2.3 Protein engineering for creating new biocatalysts with improved catalytic performance The general strategies for protein engineering are random mutagenesis, sitedirected mutagenesis and directed evolution. Random mutagenesis or site-directed mutagenesis, which could randomly or directionally replace one or a few amino acid residues in the gene sequence, has led to the development of enzyme variants with a better biocatalytic performance. However, such kind of mutagenesis is not always effective, and this method is rather time-consuming. Genes/Enzymes mutations: good neutral bad Shuffle, Screen etc. Shuffle, Screen Add new diversity at every round Figure 2.7. Directed evolution. Directed evolution mimics natural evolution and generally produces superior results than simple random mutagenesis or site-directed mutagenesis. In this method, random mutagenesis is first applied to a protein, and a selection regime is used to pick out variants that have desired qualities. Further rounds 25 of mutation and selection are then applied on the basis of backbone selected in the last round. DNA shuffling technology enables the mixing and matching pieces of successful variants in order to produce better results (Fig.2.7).108 High throughput (HTP) screening methods and robotic equipments speed up the screening process, allowing many rounds evolution in a short period. Tremendous progress in genomics and bioinformatics also facilitates directed evolution.109 Table 2.2 Alkane oxidation by wild-type P450BM-3 and its 139-3 variant Maximum turnover rate Product distribution (%) Substrate Wild-type n-octane n-hexane 80 182 139-3 Variant 3020 Product Wild-type 139-3 Variant 2-octanol 17 66 3-octanol 40 32 4-octanol 43 2 2-hexanol 20 19 3-hexanol 80 81 3840 cyclohexane 151 3910 cyclohexanol 100 100 n-butane 17 1830 2-butanol n.d 100 propane 15 860 2-propanol n.d 100 Directed evolution, which enables the possible creation of designer catalysts, has particularly contributed significantly to elucidate enzyme structure and mechanism, improve enzyme activity, increase enzyme chemo-, regio- and stereo-selectivity, broaden their substrate specificity, increase solvent tolerance, increase thermo-stability, and overcome substrate or product inhibition. For example, Arnold et al. applied directed evolution to engineer 26 P450 BM-3 for alkane hydroxylation. A very active P450 BM-3 variant 139-3 was thus identified after 5 round evolutions (Table 2.2).24,110,111 2.3 Oxidoreductases Oxidoreductase is a type of enzymes that catalyze the transfer of electrons from hydrogen or electron donor to hydrogen or electron acceptor, which leads to electron transfer, proton abstraction, hydrogen extraction, and hydride transfer or oxygen insertion. Oxidoreductase widely exists in microbes, plants and animals. Oxidoreductase can be classified into oxidases, peroxidases, oxygenases/ hydroxylases, and dehydrogenases/reductases according to the type of reactions they can catalyze. Oxidoreductase catalyzed biotransformations are very important for efficient asymmetric synthesis. They can catalyze both aliphatic and aromatic substrates; functionalize hydrocarbons by hydroxylation, sulfoxidation, epoxidation; carry out chemo-, regio- and stereo-selective reactions; create important intermediates and synthons from inexpensive and renewable biomaterials.112 2.3.1 Reductases Reductases are good biocatalysts for asymmetric synthesis. NAD(P)Hdependent dehydrogenases catalyzed enzymatic reductions are very useful reactions in asymmetric synthesis and industrial production of enantiopure synthons and pharmaceutical intermediates, such as hydroxy acids, amino acids, steroids, or alcohols from prochiral precursors. For example, they can 27 directly convert prochiral ketone to chiral alcohol with high enantioselectivity (Scheme 2.10).113 They also can catalyze the corresponding reverse reactionthe oxidation of sec-alcohols to ketone. R C R' + O NAD(P)H + H+ Dehydrogenase H * R C R' OH + NAD(P)+ Scheme 2.10 Reactions catalyzed by NAD(P)-dependent dehydrogenases leading to chiral alcohols. The interconversion of a ketone to the corresponding alcohol and vice versa represents one of the most common redox-reactions in organic chemistry. Whereas traditional synthetic methods predominantly use toxic metals and expensive complex hydrides, biotransformations offer some significant advantages. They are highly selective, many problems of chemical reduction such as racemization can be avoided because of the mild enzymatic reaction condition, and many alcohol dehydrogenases (ADHs) accept a broad variety of ketones and ketoesters as substrates. ADHs are in generally subdivided into three groups: the medium-chain, zinccontaining ADHs, represented by horse liver ADH; short-chain ADHs without any metal ion, represented by the Drosophila ADH; and the "iron-activated" long-chain ADHs with the ADH II from Zymomonas mobilis as the typical enzyme of this group.114 2.3.1.1 Selective bioreduction of ketones Methods to produce chiral alcohols with ADHs are essentially described, especially using Horse liver alcohol dehydrogenase (HLADH), 28 Thermoanaerobium brockii alcohol dehydrogenase (TBADH), Lactobacillus kefir alcohol dehydrogenase (LKADH), Lactobacillus brevis alcohol dehydrogenase (LBADH), and Rhodococcus erythropolis alcohol dehydrogenase. NADP-dependent LKADH can reduce ketone to (R)-alcohols in high enantiomeric excess. Due to the broad substrate specificity of this enzyme, aromatic, cyclic, polycyclic as well as aliphatic ketones can be reduced. A simple method for the recycling of NADPH is given by the simultaneously coupled oxidation of isopropanol (IPA) by the same enzyme. For instance, reduction of 10 mM acetophenone with recycling of NADPH (0.2 mM) in the presence of isopropanol, 8.0 mM (R)-phenylethanol was produced in 1 h (Scheme 2.11).115 O C CH3 + NADPH + H+ LKADH OH C CH3 + H NADP+ Scheme 2.11 Selective bioreduction of acetophenone to (R)-phenylethanol. 2.3.1.2 Selective oxidation of sec-alcohols ADHs also can catalyze the oxidation of sec-alcohols to ketone, while the availability of environmentally benign oxidation methods for the oxidation of sec-alcohols to the corresponding ketones still represents a significant problem for synthetic organic chemistry. B. Kosjek et al. demonstrated the selective oxidation of (S)-4-(phydroxyphenyl)butan-2-ol (rhododendrol) into 4-(p-hydroxyphenyl)butan-229 one (raspberry ketone) by R. ruber ADH (Scheme 2.12). Biocatalytic oxidative kinetic resolution of racemic rhododendrol led to the production of raspberry ketone, as well as enantiopure (S)-rhododendrol in 98% ee. The oxidation was performed at substrate concentrations up to 500 g/L.116 O OH R. ruber ADH HO HO rac-rhododendrol (R)-rhododendrol + OH HO raspberry ketone Scheme 2.12 Selective oxidation of (S)-rhododendrol into raspberry ketone. 2.3.2 Monooxygenases Monooxygenases are also good biocatalysts for asymmetric synthesis. They can functionalize molecules such as hydrocarbon by inserting active O atoms, which are very difficult for conventional chemistry. For example, cytochrome P450, one of important monooxygenases, can catalyze selective carbon hydroxylation, heteroatom oxygenation, dealkylation, epoxidation, aromatic hydroxylation, reduction, and dehalogenation.117 Baeryer-Villiger monooxgenase (BVMO) is another important oxygenase, since it is able to catalyze the nucleophilic oxygenation of ketone. This enzymatic method is much more advantageous than the conventional chemical ways, which required the use of hazardous organic catalyst and gave poor selectivity.118 30 2.3.2.1 Selective biohydroxylation Regio- and stereo-selective hydroxylation, especially the hydroxylation at non-activated carbon atom, is a very useful reaction in organic chemistry. For example, it could be used in the chemical industry to activate alkanes, one of the least expensive and most abundant hydrocarbon resources. It could also be used in pharmaceutical industry to prepare chiral alcohols that are useful synthons or pharmaceutical intermediates. This transformation has received much attention over several decades, but it still remains as a significant challenge in classic chemistry. Some progress has achieved with metal catalysts. However, the regio- and stereo-selectivities of these chemical catalysts are generally very poor. Monooxygenases can catalyze the selective insertion of one O atom of molecular oxygen into a C-H bond, while reducing the second O atom into H2O with electrons from NADH or NADPH. Such biohydroxylation has several distinctive features: it is often highly regio- and stereo-selective; it uses oxygen as a cheap and non-toxic oxidant, thus being environmentally benign; and it is often highly efficient and could provide economically competitive process for practical synthesis. Biohydroxylations have been applied in organic synthesis, including the hydroxylation of steroids, terpenes, and some other alicyclic compounds.7 Some monooxygenases, such as the soluble cytochrome P450 monooxygenases, the soluble methane monooxygenase (sMMO), and the membrane-bound alkane hydroxylase (AlkB), have been extensively 31 investigated. The X-ray structures of several soluble bacterial P450s25-27 and sMMO hydroxylase (MMOH)28 are known. hydroxylation system often requires a This relatively complex metal center: while P450 monooxygenase contains heme iron, MMOH or AlkB has a non-heme iron center. Electron transfer from the reduced cofactors often requires additional proteins, such as a reductase MMOR in sMMO, a rubredoxin (AlkG) and rubredoxin reductase (AlkT) in the AlkB system, and a ferredoxin (Fdx) and a ferredoxin reductase (FdR) in P450cam (Figure 2.8). 29,105 NADPH R-CH3+O2+2H+ + NAD +H + R-CH2OH+H2O Figure 2.8. P450cam biohydroxylation system. Among all types of monooxygenases, cytochrome P450 monooxygenases are of great interest, due to their wide existence in nature and high diversity. Many P450 monooxygenases from wild-type strains were identified for biohydroxylations,30,31 and some of them, such as P450cam and P450BM-3, have been characterized,25-27 cloned and expressed,32-36 and engineered via directed evolution24,27-41 or protein engineering42-44 to improve the substrate range, activity, and regio- and stereo-selectivity. Thus far, it is still difficult to obtain appropriate P450 monooxygenase with desired substrate specificity and high selectivity and to construct active recombinant biocatalysts via genetic engineering of P450 monooxygenase, possibly due to the particular complicacy of P450 enzyme and system. 32 Sphingomonas sp. HXN-200 containing cytochrome P450pyr has been found to be a particularly promising hydroxylating system due to its high activity, regio- and stereo-selectivity and ease of use as a biocatalyst. Sphingomonas sp. HXN-200 was found to contain a soluble alkane monooxygenase and was shown to be the best catalyst known thus far for the hydroxylation of a range of alicyclic substrates such as N-substituted pyrrolidines,65 pyrrolidinones,66 piperidines,67 piperidinones,68 and azetidines,67 with high activity and good to excellent regio- and stereo-selectivity (Scheme 2.13). Moreover, cells of Sphingomonas sp. HXN-200 can be easily prepared in large amounts and stored at -80oC for 2 years without any significant loss in activity after being thawed and resuspended. However, the wild-type strain needs to grow on noctane, which is a flammable and relatively expensive substrate, thus being a technical challenge in large-scale application. * HO OH N R N R R=CH2Ph, COPh, CO2CH2Ph, CO2Ph, CO2t-Bu N R O O N R R= CH2Ph, CO2t-Bu OH N R O N R O R= CH2Ph, CO2t-Bu OH OH N R N R R= CH2Ph, COPh, CO2CH2Ph, CO2Ph, CO2t-Bu N R N R R= CH2Ph, CO2t-Bu Scheme 2.13 Selective biohydroxylation with Sphingomonas sp. HXN-200. 33 Although oxidoreductases are very important for organic synthesis, only few oxidoreductases have been commercialized until now, because their biocatalytic systems are relatively complicated, and often require expensive cofactors. 2.4 NAD(P)+ and NAD(P)H Recycling Enzymatic oxidoreductions catalyzed by oxidoreductases often require stoichiometric amount of cofactors. The most important cofactors involved in biocatalytic oxidations and reductions include flavine adenine dinucleotide (FAD) and flavine mononucleotide (FMN), adenosine triphosphate (ATP), nicotinamide adenine dinucleotide NAD+, and nicotinamide adenine dinucleotide phosphate NADP+.119 These cofactors act as transport metabolites, transporting hydrogen, oxygen or electrons on the one hand, or other atoms or molecules on the other, between different parallel reactions. Among these cofactors, some of them are firmly bound to the enzymes, such as FAD and FMN. By contrast, ATP, NAD and NADP mostly exist as soluble component of the enzyme. Statistically, almost one fifth of all enzymes registered at the International Union of Biochemistry require dissociable cofactors, as so-called ‘free cofactors’. AMP/ADP/ATP is required for biochemical energy transfer, and most reaction systems they are used in are too complex for economical applications in cell free systems. Thus, nearly no product of economic importance has emerged that requires these cofactors in cell free synthetic reactions so far. However, NAD+/NADH and NADP+/NADPH dependent oxidoreductions have been widely studied and 34 used in various fields, particularly for the production of various valuable enantiopure chiral compounds. 2.4.1 NAD(P)+ and NAD(P)H O H O H NH2 O O HO O P O O HO P O O O HO NH2 N OH O O HO O P O O HO P O O O NH2 N N N N OR HO NAD+ + NADP N OH NH2 N N N N OR R=H NADH R=PO3H2 NADPH Figure 2.9. Structures of the cofactors NAD(P)+ and NAD(P)H. The pyridine nucleotide cofactors NAD(P)+ and NAD(P)H are essential components of cells, where they act as electron carriers or acceptors in reduction and oxidation reactions. The functions of them are related to unique structures of their molecules which combine several functional groups together (Fig.2.9). The nicotinamide moiety is the oxidation/reduction center. The remaining portion of the molecule is important for selective interactions with different enzymes. In nicotinamide adenine dinucleotide (NAD+), the left part is adenosine diphosphoribose, while in nicotinamide adenine dinucleotide phosphate (NADP+) it has an additional phosphate group esterified to the 2' hydroxyl of the adenine. Unlike other electron transfer centers such as Cu, 35 heme, and flavin, these molecules exist free in solution and function by binding to enzymes transiently during enzymatic oxidation and reduction. NAD(P)+ and NAD(P)H play an increasingly important role in biotechnology industry. They are used in various analytical, biomedical, and technological processes, where they take part in a wide range of oxidation-reduction reactions via pyridine-dependent dehydrogenases that lead to the synthesis of fine chemicals for the pharmaceutical and food industries. 2.4.2 Reasons for NAD(P)+ and NAD(P)H recycling Table 2.3 Costs of NAD(P)+ and NAD(P)H !/g Cofactor from Juelich Fine Chemicals (2003) NAD+ 4.0 NADH 12 NADP+ 15 NADPH 201 NAD(P)+ and NAD(P)H are necessary for most biocatalytic oxidations and reductions. However, the high cost (Table 2.3)119 makes their stoichiometric application economically unfeasible. Thus, the recycling of cofactor is necessary in order to develop economically and industrially feasible process. In addition to reducing the cost of synthesis, cofactor recycling is also synthetically advantageous. Firstly, cofactor recycling can drive the reaction to completion by coupling substrate conversion leading to an equilibrium constant, which favors the product formation. Secondly, cofactor recycling can 36 simplify the reaction work-up, since it eliminates the need for stoichiometric quantities of cofactors.8 2.4.3 Methods for NAD(P)+ and NAD(P)H recycling For a feasible cofactor recycling method, some basic criteria need to be met. First, all the chemicals and facilities, including enzymes, reagents and necessary equipments should be readily available, inexpensive, easily manipulated and stable under operation conditions. Furthermore, the recycling step should be kinetically and thermodynamically favorable. Last but not the least, none of the byproducts generated from recycling step should interfere with product isolation. In order to evaluate the effectiveness of a cofactor recycling process, the concept “total turnover number” (TTN) is typically introduced. It is defined as the total number of moles of product formed per mole of cofactor used during the course of a complete reaction.120 Generally, TTNs of 4,000-5,000 should be sufficient economically considering the value of product. In the past three decades, many research groups have been devoted to the development of cofactor recycling, and several recycling approaches have been investigated and used, including enzymatic method, electrochemical method, chemical method and photochemical method.8-11,120-125 37 2.4.3.1 Enzymatic method Enzymatic methods for cofactor recycling are most widely studied by numerous research groups. Many enzymatic systems for nicotinamide cofactor recycling have been tested. The best methods are based on the use of formate, glucose, glucose-6-phosphate, or alcohols as reducing agents.15,126 The advantages of this method are obvious: high TTNs and high selectivity can be achieved; reaction for desired product can be easily coupled with cofactor recycling process. As early as 1980s, Wong et al. demonstrated an efficient NADH recycling method with the use of glucose and glucose dehydrogenase (GDH) from Bacillus cereus (Scheme 2.14).127,128 In a synthesis of D-lactate, NADH was cycled 36,000 times with no loss in GDH activity. The GDH from B. cereus is extremely stable and accepts both NAD+ and NADP+ with high specific activity. Glucose as a strong reducing agent is easily available and innocuous to enzymes. OH OH O HO OH OH OH H2O O HO OH OH OH O HO OH OH CO2 OH glucose dehydrogenase NAD(P)+ NAD(P)H Scheme 2.14 NAD(P)H recycling method with the use of glucose and glucose dehydrogenase. 38 2.4.3.2 Electrochemical method Electrochemical methods are attractive since cofactors only switch between the oxidized and reduced forms. Direct cathodic reductions129 without any auxiliary devices in recycling were widely studied in 1980s. However, this kind of approaches suffer from low regioselectivity and side reactions because of the high over-potentials, electrode fouling and dimerization of the cofactor, the correct regioisomer can be regenerated only in 0 to 75% yield. Therefore, indirect electrochemical reduction of NAD(P)+, using electron transport agents as mediators which is an attractive alternative to direct reduction methods was developed (Scheme 2.15).130-132 A large number of mediators have been examined with viologens, anthraquinones and [Cp*Rh(bpy)Cl]Cl receiving much attention. For example, Hollmann et al. reported the first electrochemical NADH recycling coupled to a monooxygenase reaction using [Cp*Rh(bpy)(H2O)]2+, which led to turnover frequency (TF) 11/hr. Mediator Product NAD(P)+ 2eEnzyme Mediator2Regeneration NAD(P)H Substrate Synthesis Scheme 2.15 Electrochemical reduction for NAD(P)+ recycling. Challenge in this approach is to create efficient electrochemical chain to transfer electrons. When designing reactors, stability of enzyme is an 39 important factor as well. Though this problem can be addressed by immobilization on electrode’s surface, only a few relatively stable oxidoreductases can be immobilized. Fragile enzymes can be hardly immobilized due to great loss of activity. 2.4.3.3 Chemical method Very few examples of chemical methods of cofactor recycling have been found in the literature. At present, chemical methods still suffer from cumbersome reaction conditions, expensive and toxic reagents, side reactions, and low TTN. The highest TTN reached with this method was just 300 so far.133 Therefore, chemical approach for cofactor recycling has been not preferred for practical synthesis. H+ K H2 NAD+ safranineH K safranine L-lactate Ep NAD pyruvate Scheme 2.16 Chemical method for NAD+ recycling. Bhaduri et al. reported the use of a platinum carbonyl cluster for reductive recycling of NAD+ to NADH by dihydrogen (Scheme 2.16).134 Since both NAD+ and L-LDH are only soluble in water, while the platinum carbonyl cluster is only soluble in organic solvents, so a biphasic system consisting of water and dichloromethane was used. 40 2.4.3.4 Photochemical method The irradiation of photo-sensitizer dyes with visible light can lead to the oxidation of reduced form cofactor NAD(P)H. Recently, photochemical methods attract more attention due to the efficient use of clean and cheap solar energy. Homogenous photo-sensitizers such as ruthenium or zinc complexes, dyes like methylene blue, and heterogeneous semiconductor powders and colloids like cadmium sulfide or titanium dioxide (TiO2) are generally used. Julliard et al.135 studied this photochemical cofactor recycling method in ethanol oxidation process (Scheme 2.17). In this case, a TTN of 1,125 for the recycling of NAD+ from NADH was achieved by using a methylene blue (MB) as the electron acceptor, which is able to emit energy and oxidize NADH in its excited state. NADH + MB+ + H+ 2e- NAD+ + MBH + H+ Scheme 2.17 Photochemical method for NAD+ recycling. To date, enzymatic recycling methods are preferred. Because compared with enzymatic approaches, other strategies often lack the high selectivity required to achieve satisfactory high TTNs and are usually not compatible with the other components of the enzymatic reactions. 41 2.4.4 Approaches for enzymatic NAD(P)+ and NAD(P)H recycling For enzymatic recycling method, there are two different approaches: the substrate-coupled136-139 and the enzyme-coupled16-19,140 processes. Substratecoupled recycling uses a second substrate as driving force, while enzymecoupled recycling uses a second enzyme. As shown in Figure 1.2, substratecoupled recycling of NAD(P)H uses the same enzyme to convert substrates in two pathways. By contrast, there are two different enzymes using as catalysts in enzyme-coupled recycling. 2.4.4.1 Substrate-coupled approach Some enzymes are capable of catalyzing the oxidation and reduction of several substrates in reversible reactions. By adding two substrates, one in the reduced form and the other in the oxidized form, a cofactor recycling system can be created. In substrate-coupled approach, only one enzyme is involved, which simplifies purification process comparing with complicated isolation process in enzymecoupled approach. However, it is not easy to find a suitable second substrate for the recycling of the cofactor. Moreover, in substrate-coupled reaction system, there is a competition between substrate, product, cosubstrate and coproduct. In order to achieve high yield, a large excess of alcohol or in situ product removal (ISPR) processes should be used to drive equilibrium towards the desired product. 42 2.4.4.2 Enzyme-coupled approach In enzyme-coupled approach, a second enzyme and its substrate are added. The utilization of the auxiliary enzyme facilitates to create a cycle for cofactor recycling. Of course it adds to the cost and complexity of the system with adding an extra enzyme, however, this method is superior to substrate-coupled one in terms of product isolation. In this case, the second enzyme and its substrate can be chosen to achieve a favorable equilibrium position in the primary reaction. For instance, formate dehydrogenase (FDH) is favorable due to its product carbon dioxide, which can be easily removed from solid or liquid system. Many methods using a second enzyme have been developed and widely used for the recycling of nicotinamide cofactors in both aqueous media and organic media. Both whole cell containing necessary enzymes and isolated enzymes are capable in NAD(P)+ and NAD(P)H recycling. While approaches based on isolated enzymes are expensive and less stable, approaches based on whole cells containing necessary enzymes depend on the amount of intracellular cofactor, which may be limiting, and cannot be altered by the addition of extracellular cofactor. 2.5 Cell Permeabilization The cell wall and the cellular membrane of microbial cells provide semipermeable barriers to chemical species which are exposed to the cell. Gram- 43 (a) Porins Lipopolysaccharides OUTER MEMBRANE Lipoprotein Nutrient Binding protein Phospholipids PERIPLASM PEPTIDOGLYCAN INNER MEMBRANE Phospholipids Effux protein Proteins (b) Functional proteins PEPTIDOGLYCAN INNER MEMBRANE Phospholipids Efflux protein Proteins Figure 2.10. Structures of (a) Gram-negative and (b) Gram-positive outer cell layers. negative and Gram-positive (Fig.2.10) strains have different membrane structures. The outmost cell layer of Gram-negative bacteria is an outer membrane called envelops, which is a bilayer structure composed of lipopolysaccharide (LPS) and phospholipids, and it is a good barrier for both hydrophobic and hydrophilic molecules. There is also a thin layer of peptidoglycan and a periplasmic space situated between the outer membrane and the peptidoglycan in Gram-negative strain cells. Different from Gramnegative bacteria, most Gram-positive bacteria are surrounded by a thick peptidoglycan cell wall. Though the meshwork composed of peptidoglycan is 44 too coarse and poses little resistance to the diffusion of small molecules, the cell wall is mechanically very strong and completely impermeable to big molecules including nicotinamide cofactors.141 2.5.1 Reasons for cell permeabilization Whole cells can be made permeable by chemical or physical treatment to allow or improve the conversion of substrates to useful products. Cell permeabilization has been widely applied to increase productivity since the permeabilized cells have better access to substrate and better release of product. It is also possible of utilizing permeabilized cells for cofactor recycling, since both Gram-negative and Gram-positive whole cells can be made permeable to nicotinamide cofactor by chemical or physical treatment. 2.5.2 Methods for cell permeabilization To date, solvent treatment, detergent treatment, salt stress, freeze and thaw, electropermeabilization, organic reagents such as EDTA as permeabilizer, reverse micelles, etc., methods have successfully been used for cell permeabilization. 45 2.5.2.1 Solvent treatment & detergent treatment M. Canovas et al.142,143 showed in a permeabilization study with Escherichia coli strains that permeabilization of cells improved the yield of L-carnitine obtained and cell activity when crotonobetaine was used as substrate. A higher cell activity was observed with organic solvents such as acetone, ethanol, isopropanol and toluene (65-70% yield), detergents such as Triton X-100 and Tween 20 (70-75% yield) and polyethylenimine (80-89% yield). 2.5.2.2 Salt stress M. Canovas et al. also studied the salt stress effect to the production of Lcarnitine of E. coli cells. The whole-cell catalyzed reaction was carried out in the presence of NaCl. Product yield was increased with the increase of the NaCl concentration in the reaction medium. When NaCl concentration reached 0.5 M, the product yield was doubled (from 40% to 80%) compared with that of the control reaction without the salt.144 2.5.2.3 Freeze and thaw M. W. Breedveld et al. investigated the synthesis of cyclic "-(1,2)-glucans from UDP-[14C]glucose by whole cells of Rhizobium leguminosarum bv. trifolii TA-1. With resting cells of TA-1, no excretion of glucan was observed; however, after these cells were alternately frozen and thawed eight times, they excreted product glucans.145 46 2.5.2.4 Electropermeabilization R. Y. K. Yang et al. investigated the use of low-level electric currents and voltages to release and collect intracellular secondary metabolites from living plant cells. Indole alkaloids, ajamlicine, and yohimbine were extracted from Catharanthus roseus cells by applying 1-5 mA electric current in the membrane reactors, and they were also simultaneously collected by electrophoresis.146 2.5.2.5 Genetic method The development of chemical or physical treatment permeabilization is mainly replied on trial-and-error manner. However, with the development of recombinant DNA technology, permeability issues can be addressed in a more predictable manner. Cell surface display, modification of outer membrane structures, expressing membrane-active peptides, etc., have been exploited fruitfully to improve cell permeability. Ni and Chen reported that they successfully altered E. coli outer membrane structures by genetic method. Typically, a LPS mutant SM101 and a Braun’s lipoprotein mutant E609L were used along with two model substrates nitrocefin and a tetrapeptide N-succinyl-Ala-Ala-Pro-Phe-p-nitroanilide. The reduction of the outer membrane permeability by genetic methods led to significant increases (up to 380%) in reaction rates of whole-cell catalyzed reactions.147 47 2.5.3 Applications of permeabilized cells for cofactor recycling Cell permeabilization is widely applied to increase productivity since the permeabilized cells have better access to substrate and better release of product. It is also possible of utilizing permeabilized cells for cofactor recycling. In fact, both Gram-negative and Gram-positive whole cells can be made permeable to nicotinamide cofactor by chemical or physical treatment. However, only few examples of using permeabilized cells for cofactor recycling were reported thus far. O F3C OH O O OEt F3C OEt keto-reductase NADP+ NADPH NADPH NADP+ G-6-PDH Glucose-6phosphate 6-Phosphogluconolactone Permeabilized B. pumilus Phe-C3 Scheme 2.18 Single permeabilized microorganism for efficient enantioselective reduction of ketone with cofactor recycling. Zhang et al. used the single permeabilized microorganism for bioreduction and simultaneous cofactor recycling. B. pumilus Phe-C3 which could catalyze the bioreduction of 3-ketoester was found containing an NADP+-dependent glucose-6-phosphate. The cells B. pumilus Phe-C3 was treated with EDTA/toluene to active permeabilized cells. Under optimized conditions, the use of permeabilized cells of B. pumilus Phe-C3 with the initial supply of 48 glucose-6-phosphate and 0.005 mM NADP+ resulted in bioreduction of 3ketoester with recycling of NADPH 4,220 times (Scheme 2.18).148 The high total turnover number (TTN) for cofactor recycling significantly reduced the cofactor cost for the bioreduction. However, the requirement for two enzymes in one microorganism and using relatively expensive glucose-6-phosphate may limit the scope of the application of the single-permeabilizedmicroorganism approach. OH O R1 R2 R1 *R2 keto-reductase NAD(P)H NAD(P)+ Permeabilized B. pumilus Phe-C3 Glucose Gluconolactone glucose dehydrogenase NAD(P)+ NAD(P)H Permeabilized B. subtilis BGSC 1A1 Scheme 2.19 Coupling of permeabilized microorganisms for efficient enantioselective reduction of ketone with cofactor recycling. Later, Zhang, et al. developed a novel coupled permeabilized microorganisms system for bioreduction with efficient recycling of NADPH. Permeabilized cells of B. pumilus Phe-C3 containing a ketoreductase were coupled with permeabilized cells of Bacillus subtilis BGSC 1A1 containing a GDH for bioreduction of 3-ketoester to produce (R)-3-hydroxyester, which resulted in a TTN for NADPH recycling of 1,600 with initial addition of glucose and 0.01 mM NADP+ (Scheme 2.19).63 Though this novel system was rather promising, the TTN for cofactor recycling and final product concentration need to be further improved in order to make this system more economically practical. 49 Compared with isolated enzymes, permeabilized cells are much cheaper and more stable; compared with whole cells, permeabilized cells allow the use of extracellular cofactor and increase the substrate and product permeability. Thus, the use of easily available permeabilized cells for oxidoreductions with cofactor recycling might be of advantage over the isolated enzymes or whole cells approaches. 2.6 Tandem Biocatalyses Tandem catalyses are processes in which multiple catalysts operate concurrently in one pot to enable cascade reactions, circumventing the often time-consuming and yield-reducing isolation and purification of intermediates in multistep synthesis.149 2.6.1 Advantages and applications of tandem catalyses The advantages of tandem catalyses over conventional chemistry are clearly illustrated in Figure 1.4.150 In traditional catalysis, starting material A is converted step-by-step to final product D, and intermediates B and C are isolated and purified in each conversion step (Figure 1.4.a). In tandem catalysis, final product D is directly produced from starting material A through multistep reactions in one pot, without separation of intermediates B and C (Figure 1.4.b). This one-pot approach can increase product yield, use less organic reagent, generate less waste, and avoid the isolation or purification of intermediates.151 50 A variety of promising tandem catalyses have been described in the literature, involving different combinations of enzymes, homogeneous and heterogeneous catalysts. According to the catalytic types of involved in the system, tandem catalyses can be categorized into chemo-chemo tandem catalysis, chemo-bio tandem catalysis and bio-bio tandem catalysis. 2.6.1.1 Chemo-chemo tandem catalysis Chemo-chemo tandem catalysis has been applied in the fields of carbonylation, polymerization, metathesis, etc. PPh2 O Ph3P=CHCOR' 0.7mol% [Rh(CO2)acac] O R=alkyl, OEt R'=Me, OMe R PPh2 O R' R CH3 CH3 PPh2 O O R CH3 O Hydrogenation Hydroformylation O O PPh2 Olefination O O R' R CH3 O Scheme 2.20 Diastereoselective tandem hydroformylation olefination, hydrogenation sequence with a chiral auxiliary. 51 Breit et al. functionalized alkenes by hydroformylation, olefination, and then hydrogenation (Scheme 2.20). They carried out a diastereoselective transformation of a substituted allylic alcohol using the chiral directing group ortho-diphenylphosphanyl benzoate. It was found that under hydroformylation conditions, mono-substituted ylides could be used to generate the corresponding $, "- unsaturated ketone or ester. Then the newly produced olefin underwent metal catalyzed hydrogenation to form ester.107 Another very illustrative example showing the chemo-chemo tandem catalysis was the combination of proline-catalyzed cross-aldol reaction with Barbier-type allylation in aqueous media (Scheme 1.21).108 O O + H H OH OH L-proline, DMF Br R R , indium R=H, Me L-proline DMF O Br OH H R indium Scheme 2.21 Combined one-pot proline-catalyzed aldol reaction/indium-mediated allylation. 2.6.1.2 Chemo-bio tandem catalysis There is an increase in the number of papers published about chemo-bio tandem catalysis as one-pot operation for the production of fine chemicals, especially for chiral compounds. 52 (S)-A Chemocatalyst (R)-A Bio catalyst (R)-A chemo racemisation + bio enantioselectivity Scheme 2.22 Dynamic kinetic resolution by chemo-bio tandem catalysis. One distinctive example is the dynamic kinetic resolution (DKR) by the use of a chemocatalyst and a biocatalyst in one pot (Scheme 2.22). Through such a combination, so called 100% ee and 100% yield synthesis of enantiopure compounds is possibly to be achieved from racemic starting materials. Otherwise, the maximum yield can be obtained is only 50%. A number of examples of such DKR have been reported. For instance, Jung et al. reported the combination of ruthenium catalyzing ketone and imine hydrogenation with Novozym-435 catalyzing resolution to prepare chiral acetates (Scheme 2.23).154 O R OH Ruthenium catalyst H2 R OH cat. R OAc Novozym-435 EtOAc R Scheme 2.23 Hydrogenation of ketone combined with dynamic kinetic resolution. Although many chemo-chemo or chemo-bio tandem catalyses have been demonstrated, most of them are two-step reactions. Three- or more steps chemo-chemo or chemo-bio tandem catalyses are still rare, mainly due to the incompatibility of many chemo-catalytic reactions or chemo-catalytic with 53 enzymatic conversions in terms of reagents, solvent, pH and temperature. 2.6.2 Advantages and applications of tandem biocatalyses Tandem biocatalysis is a process in which multiple biocatalysts catalyze multiple-step enzymatic reactions in one pot without intermediates recovery. Except the general advantages of tandem catalysis, such as avoiding the timeconsuming, yield-decreasing and waste-producing intermediates, tandem biocatalysis also has all the advantages of biocatalysis, including high selectivity and mild reaction conditions. Recently, tandem biocatalysis has drawn significant attention in chemical and pharmaceutical synthesis, and development of tandem biocatalysis is regarded as one of the most important directions for sustainable chemistry.89 OH M. isabellina Tetralin O M. isabellina (R)-1-tetralol 1-tetralone Scheme 2.24 Sequential oxidations of tetralin into 1-tetralone with single microorganism. Some single microorganism demonstrated the ability to catalyze tandem bioconversions, but their efficiencies were low, especially when using nonnatural compounds as substrate. For instance, M. isabellina was reported to be able to sequentially oxidize tetralin into 1-tetralone. However, only 2.72 mM 1-tetralone was prepared together with 1-tetralol and tetralin during 120 h (Scheme 2.24).155 54 Alternatively, developing tandem biocatalysts systems for tandem bioconversions is regarded as a promising way. O2 O HO OH glucose oxidase HO OH O HO OH !-D-Glucose HO O OH OH H2O2 "--D-Gluconolactone chloroperoxidase N H Indole O N H H2O 2-Indolinone Scheme 2.25 Tandem biocatalysts system with immobilized chloroperoxidase and glucose oxidase. Many tandem biocatalysts systems including one biocatalyst for in situ cofactor recycling or in situ oxidant generation have been reported. For example, indole was oxidized into 2-indolinone using chloroperoxidase and glucose oxidase immobilized on SBA-15 as tandem biocatalysts (Scheme 2.25). Chloroperoxidase (CPO) from Caldariomyces fumago was immobilized on molecular sieve SBA-15 and applied to the oxidation of indole with hydrogen peroxide as oxidant. Through such in situ hydrogen peroxide generation by glucose oxidation with glucose oxidase (GOx) immobilized on SBA-15, the deactivation of peroxidase by addition of hydrogen peroxide was prevented.156 In another tandem biocatalysts system, LeuDH was used to catalyze the reductive amination of trimethylpyruvate to L-tert-leucine, while FDH was used to in situ regenerate cofactor FDH at the same time (Scheme 2.26).157 55 O (H3C)3C COOH + H LeuDH NH3 (H3C)3C COOH + H2O NAD+ NADH CO2 NH2 HCOOH FDH Scheme 2.26 Tandem biocatalysts system for L-tert-leucine synthesis with cofactor recycling. In terms of tandem biocatalysts systems for sequential biotransformations, only limited examples have been reported. For example, Xu et al. demonstrated asymmetric dihydroxylation of aryl olefins with tandem biocatalysis in two-biocatalyst system: one containing an enantioselective styrene monooxygenase, and the other containing a regioselective epoxide hydrolase (Scheme 2.27). By this method, chiral aryl vicinal diols were obtained in high ee and high yield.158 R E. coli JM101 pSPZ10 R=H, 4-Cl, 3-Cl, or 2-Cl OH O Styrene monooxygenase from OH Epoxide hydrolase from R Sphingomonas sp. HXN-200 R Up to > 99% ee Up to 95% yield Scheme 2.27 Tandem biocatalysts systems for asymmetric dihydroxylation of aryl. 2.6.3 Tandem biocatalysts systems for sequential oxidoreductions Although in nature, it is quite common that a single microorganism containing multiple enzymes can uptake and metabolize nature compound such as glucose, it is not easy to find and array appropriate multiple biocatalysts to carry out sequential bioconversions, especially for efficient oxidoreductions. 56 Firstly, it is difficult to develop a tandem biocatalysts system, especially for the conversion of non-natural compound. For the development of a tandem biocatalysts system, one of the most important considerations is biocatalysts compatibility, since there always are diverging reaction conditions required for single-step bioconversion. The two or more biocatalysts should not only be able to function well in the presence of others, they also should be compatible with any solvents, reagents, temperatures, pH that they might come across throughout the course of the whole reaction. The steps must be balanced carefully to ensure that the catalytic processes run at comparable rates, and the different catalytic reactions do not interfere with others. These issues are more apparent when applying tandem biocatalysts system to the conversion of nonnatural substances. OH R R' + biooxidation catalyst, O2 + alcohol dehydrogenase +cofactor-recycling system 30 oC, pH 7.5 buffer OH R R' enantioselective biooxidation O2 OH R R' + O R OH R R' single enantiomer >99% yield >99% ee stereoselective reduction ADH cofactor recycling R' Scheme 2.28 Tandem biocatalysts system for the deracemization of racemic secondary alcohols through an oxidation-reduction sequence. Moreover, most enzymatic oxidoreductions require stoichiometric amount expensive cofactors, which are usually quite expensive. These cofactors act as transport metabolites, transporting hydrogen, oxygen or electrons on the one 57 hand, or other atoms or molecules on the other, between different parallel reactions. For example, P450 hydroxylation system needs NADPH for electron transfer. For practical application of oxidoreductions, expensive cofactor needs to be efficiently recycled. To date, in terms of sequential transformations with tandem biocatalysts systems in organic synthesis, only two deracemization examples have been reported. One example is the sequential oxidation-reduction for deracemization of secondary alcohol (Scheme 2.28),60,61 the other is the sequential oxidation-reduction for deracemization of hydroxy acid.62 When it comes to enzymatic sequential oxidations with tandem biocatalysts systems, due to the complicacy of its electron transfer system and the variety of its reaction mechanism, no practical example has been published yet. 58 CHAPTER 3 BIOREDUCTION WITH EFFICIENT RECYCLING OF NADPH BY COUPLED PERMEABILIZED MICROORGANISMS 59 3.1 Introduction Biocatalytic oxidoreductions are important reactions in asymmetric synthesis, with great potential in industrial production of enantiopure chemicals and pharmaceuticals.2-6 These reactions often need stoichiometric amount of the expensive cofactor NAD(P)H or NAD(P)+, thus their practical application requires the efficient recycling of the necessary cofactor.7-14 In general, cofactor recycling can be achieved by the coupling of a desired enzymatic reaction with an additional chemical, electrochemical, photocatalytic or enzymatic reaction, among which the enzymatic method is favored.7-14,162 Enzymatic cofactor recycling can be realized by “coupled substrates”138,163-165 and “coupled enzymes” 15-23 approaches. The latter is more general and utilizes the first enzyme for the desired biotransformation and the second one for cofactor recycling. Formate dehydrogenase (FDH)17,18 and glucose dehydrogenase (GDH)16,23 are well-known enzymes for the recycling of NADH and NADPH, respectively. The “coupled enzymes” approach has been successfully applied via two isolated enzymes16-19,23 or whole cells20-22 of a microorganism co-expressing the two necessary enzymes. While the use of isolated enzymes is still costly, the use of whole cells depends on the availability of intracellular cofactor, which may be limiting and cannot be altered by the addition of extracellular co-factor. On the other hand, whole cells can be made permeable to NAD(P)H and NAD(P)+ by the treatment with organic solvent/detergent while keeping high enzymatic activity. 22,142,147,166 Thus, the use of easily available permeabilized cells for oxidoreductions with cofactor recycling might be of advantage over the isolated enzymes or whole cells approaches. 60 We recently discovered that Bacillus pumilus Phe-C3 containing a NADPHdependent ketoreductase catalyzed the enantioselective reduction of ethyl 3keto-4-triflurobutyrate 1 giving the corresponding product 3-hydroxyester (R)2 in 95% ee,167 a useful intermediate for the preparation of the antidepressant Befloxatone.168 This strain was also found to contain a NADP+-dependent glucose-6-phosphate dehydrogenase.148 Treatment of the cells of B. pumilus Phe-C3 with EDTA/toluene gave active permeabilized cells that catalyzed the bioreduction of 3-ketoester 1 and the recycling of NADPH.148 Under optimized conditions, the use of permeabilized cells of B. pumilus Phe-C3 with the initial supplying of glucose-6-phosphate and 0.005 mM NADP+ afforded the bioreduction of 3-ketoester 1 with the recycling of NADPH for 4220 times (Figure 3.1). 148 The high TTN of the cofactor recycling significantly reduced the cofactor cost in the bioreduction. However, the requirement of having two necessary enzymes in one microorganism and the using of relatively expensive glucose-6-phosphate may limit the application scope of the single permeabilized microorganism approach. To solve these problems, we recently developed a novel and general approach of using two permeabilized microorganisms for bioreduction with cofactor recycling:63 permeabilized cells of B. pumilus Phe-C3 containing a ketoreductase were coupled with permeabilized cells of Bacillus subtilis BGSC 1A1 containing a GDH169 for the bioreduction of 3-ketoester 1 to produce 3-hydroxyester (R)-2, giving a total turnover number (TTN) for NADPH recycling of 1600 with the initial addition of glucose and 0.01 mM NADP+. Several advantages were demonstrated: compared with whole cells, this approach enables the use of the externally added cofactor for efficient catalysis and cofactor recycling, and it 61 a) Via a single permeabilized microorganism containing ketoreductase and glucose 6-phosphate dehydrogenase O F3C OH O OEt 1 F3C O (R)-2 OEt keto-reductase NADPH NADP+ NADP+ NADPH G-6-PDH Glucose-6phosphate 6-Phosphogluconolactone TTN = 4220 Permeabilized B. pumilus Phe-C3 b) Via coupled permeabilized microorganisms containing ketoreductase and glucose dehydrogenase, respectively O F 3C O OH OEt 1 F3C O Glucose OEt keto-reductase NADPH Gluconolactone (R)-2 NADP+ Permeabilized B. pumilus Phe-C3 glucose dehydrogenase NADPH NADP+ NADP+ NADPH Permeabilized B. subtilis BGSC 1A1 Permeabilized E. coli XL-1 Blue (pGDH1) Permeabilized E. coli BL21 (pGDH1) TTN = 1620 TTN = 3100 (this study) TTN = 4200 (this study) Figure 3.1. Bioreduction with NADPH recycling by using permeabilized microorganisms. OEt, OC2H5; G-6-PDH, glucose-6-phosphate dehydrogenase; 1, ethyl 3-keto-4,4,4trifluorobutyrate; (R)-2, (R)-ethyl 3-hydroxy-4,4,4-trifluorobutyrate. allows for easy substrate access and easy product release; compared with the isolated enzyme, permeabilized cells are cheap, easily available in large amount, active for a longer period, stable, and reusable. The coupled permeabilized cells approachis of great application potential also due to the general applicability, in addition to the above demonstrated advantages. However, the highest total turnover number (TTN) for NADPH recycling from this approach has been so far only 1620. The main reason is the relative low activity of the whole cell biocatalyst for cofactor recycling. To make this method suitable for practical syntheses of fine chemicals, the TTN of the 62 expensive cofactor has to be significantly increased. To achieve this goal, we aim to develop better cofactor-regenerating systems, better permeabilized cells couple, and efficient synthesis of 3-hydroxyester (R)-2 by the use of the new biocatalyst system. 3.2 Experimental Section 3.2.1 Chemicals Nicotinamide adenine dinucleotide phosphate (NADP+, > 99%), nicotinamide adenine dinucleotide (NAD+, > 99%), ampicillin (> 99%), and ethyl 3-keto-4, 4, 4-triflurobutyrate 1 (> 98%) were purchased from Sigma-Aldrich. Isopropyl !-D-thiogalactopyranoside (ITPG, > 99%) was bought from 1st BASE. Medium components tryptone and yeast extract were purchased from Biomed Diagnostics. Ethyl 3-hydroxyl-4, 4, 4-trifluorobutanoate 2 was prepared according to the published procedures.159 3.2.2 Analytical methods The assays of GDH activity and NADPH or NADH oxidase activity were carried out on Shimadzu UV-Vis 1700 spectrophotometer with Time-scan function. The concentrations of ethyl 3-keto-4, 4, 4-triflurobutyrate 1 and ethyl-3- hydroxyl-4, 4, 4-trifluoro-butanoate 2 were analyzed by Agilent GC 6890 on an Agilent HP-5 column (25 m x 0.32 mm) with inlet temperature of 290 ºC and detector temperature of 310 ºC. Temperature program: 50 ºC for 8 63 min, increase to 300 ºC at a rate of 50 ºC/min, keep at 300 ºC for 2 min. Retention time: 2.8 min and 9.3 min for 3-ketoester 1; 6.2 min for 3hydroxyester 2; 12.5 min for n-hexadecane. The ee of (R)-ethyl-3-hydroxyl-4, 4, 4-trifluoro-butanoate 2 was analyzed by Agilent GC 6890 with a chiral column: Lipodex-A (25 m x 0.25 mm); temperature program: 40 ºC to 120 ºC at a rate of 5 ºC/min, increase to 170 ºC at a rate of 45 ºC/min; retention time: 11.9 min for 3-hydroxyester (S)-2 and 12.2 min for 3-hydroxyester (R)-2. 3.2.3 Strains and cultivation media Bacillus subtilis BGSC 1A1 was obtained from the Bacillus Genetic Stock Centre at the Ohio State University; Escherichia coli XL-1 Blue, Escherichia coli BL21, and Bacillus pumilus Phe-C322 were from the collection of our laboratories. The cells of B. pumilus Phe-C3 were grown in E2 medium on glucose (1% w/v) at 25 ºC in 2 L fermenter, and the cells were harvested and permeabilized according to the previously reported procedure.145 E. coli XL-1 Blue (pGDH1) and E. coli BL21 (pGDH1) were grown in LB medium containing ampicillin (100 g/mL). 3.2.4 Genetic engineering of E. coli XL-1 Blue (pGDH1) and E. coli BL21 (pGDH1) Genomic DNA of B. subtilis BGSC 1A1 was obtained using Trizol Reagent (sigma), according to manufacture instructions. The full length GDH was amplified by high fidelity polymerase chain reaction with GDH primers. The 64 genomic DNA was used as the template. The primer 1 (BSG-TAA1) (5’GGTAAGCTTCTCGAGTTAACCGCGG CCTGCCTG3’) and primer 2 (BSG-ATG1) (5’CAGGAATTCATACATGTATCCAGATTTAAAAGGAA 3’) were designed according to the nucleotide sequence of GDH of Bacillus subtilis BGSC 1A1. The primers contained the restriction sites for Hind III in the primer 1 and EcoRI in the primer 2, respectively. The amplification condition for 817 bps PCR product was: 95 ºC for 5 min (hot start), followed by 30 cycles of 95 ºC for 45 s, 55 ºC for 45 s, 72 ºC for 45 s, and finally 72 ºC for 7 min. The GDH fragment was digested with EcoR I (Roche) and Hind III (Roche) for 90 min at 37 ºC, and was inserted into the lacZ expression vector pUC18 through these restriction enzyme sites to form pGDH1. E. coli XL-1 Blue cells were made chemically competent and were then transformed with pGDH1. The insertion was confirmed by plasmid prep (QIAGEN) from cell culture and restriction digest analysis using EcoR I and Hind III. The GDH protein was expressed in recombinant E. coli XL-1 Blue by using the inducible lac promoter under control of the presence of isopropyl!-D-thiogalactopyranoside (IPTG). Similarly, plasmid pGDH1 was transferred into E. coli BL21 by electroporation method. 3.2.5 Growth and GDH activity of E. coli BL21 (pGDH1) and E. coli XL-1 Blue (pGDH1) Both strains were inoculated on LB agar plate (10 g Tryptone, 5 g yeast extract and 5 g NaCl in 1 L deionized water with 1.5% agar) containing ampicillin (100 "g/mL) and grown overnight at 37 ºC, respectively. A single 65 colony from the LB agar plate of each strain was inoculated into 100 mL of LB medium with ampicillin (100 "g/mL) and grown at 250 rpm and 37 ºC for 12 h, giving an OD450 of 8.0 (cell density of 2.2 g cdw/L) for E. coli BL21 (pGDH1) and an OD450 of 6.0 (cell density of 1.7 g cdw/L) for E. coli XL-1 Blue (pGDH1), respectively. To obtain high hydroxylase activity of this recombinant strain, culture condition was optimized, including inducing time (1.5 to 2.5 h after inoculation), inducing duration (2 to 6 h), inducing amount (0.3 to 1.0 mM IPTG) and inducing temperature (25 to 37ºC). The optimal culture procedure is: 12 mL of the above preculture of E. coli BL21 (pGDH1) were added in LB (800 mL) medium containing ampicillin (100 "g/mL) and the mixture was shaken at 250 rpm and 37 ºC. Samples (1 mL) were taken at different time points for OD measurement and activity test. IPTG (1 mM) was added when OD450 reached 1.8 (cell density of 0.5 g cdw/L) at 2.5 h. The cells were harvested at the late exponential phase with an OD450 of 5.8 (cell density of 1.6 g cdw/L) at 6 h, washed with KP buffer (5 mM, pH = 7.5), and then stored in -80 ºC freezer. 12 mL of above prepared preculture of E. coli XL-1 Blue (pGDH1) were added in LB (600 mL) medium containing ampicillin (100 "g/mL) and the mixture was shaken at 250 rpm and 37 ºC. Samples (1 mL) were taken at different time points for OD measurement and activity test. IPTG (1 mM) was added when OD450 reached 1.2 (cell density of 0.3 g cdw/L) at 3 h. The cells were harvested at the late exponential phase with an OD450 of 7.2 (cell density of 2.0 g cdw/L) at 10 h, washed with KP buffer (5 mM, pH = 7.5), and then stored in -80 ºC. 66 To test the GDH activity, 7 mL cell suspensions (10 g cdw/L) of each recombinant E. coli in KP buffer (50 mM, pH = 7.5) were passed through a homogenizer (Constant Cell Disruption System™) twice at 20 kpsi. The cell debris was removed by centrifugation at 13,000 g at 4 ºC for 30 min. The supernatant was diluted 10 times with KP buffer (50 mM, pH = 7.5), and the protein concentration was determined as 0.4 g protein/L by Bradford protein content assay170 with bovine serum albumin (BSA) as standard. To 940 "L of the prepared CFE was added 50 "L glucose stock solution (2.0 M), 10 "L NADP+ solution (0.2 M). The formation of NADPH was followed by UV absorption at 340 nm at 25 ºC, and the concentration was calculated by using #340 of 6.22 L*mmol-1. The specific GDH activity was given as U (the formation of 1 "mol NADPH per minute)/g protein. SDS-PAGE was performed by loading 15 "L CFE (0.21 g protein/L) on a gel containing 0.1% sodium dodecyl sulfate and 10% acrylamide, staining with a 0.1% solution of Commassie brilliant blue R-250 in methanol/acetic acid/water (4:1:5; v/v/v), and destaining by soaking in deionized water overnight. 3.2.6 Preparation and GDH Activity of permeabilized cells of E. coli BL21 (pGDH1) and E. coli XL-1 Blue (pGDH1) The frozen cells of E. coli BL21 (pGDH1) and E. coli XL-1 Blue (pGDH1) were thawed for 2 h and resuspended in Tris-HCl buffer (100 mM, pH = 8.0) to a density of 10 g cdw/L, respectively. For E. coli BL21 (pGDH1), EDTA (10 mM) and toluene (1% v/v) were added, and the mixture was shaken at 300 67 rpm and 25 °C for 10 min. For E. coli XL-1 Blue (pGDH1) EDTA (5 mM) was added, and the mixture was shaken at 300 rpm and 25 °C for 30 min followed by incubation at 4 °C for 1 h. The permeabilized cells were obtained by centrifugation at 4 °C and 3,320 g for 10 min, and their GDH activity assay was performed by the bioconversion of glucose (55 mM) with permeabilized cells (0.2 g cdw/L) in Tris-HCl buffer (100 mL, pH = 7.0) in the presence of NADP+ (2 mM) on 1 mL scale at 25 ºC and determined by following NADPH formation at 340 nm. 3.2.7 Kinetics of GDH activity of the permeabilized cells of E. coli BL21 (pGDH1) To 900-945 "L permeabilized cells of E. coli BL21 (pGDH1) (0.2 g cdw/L) in Tris-HCl buffer (100 mM, pH = 7.0) were added 50 "L glucose stock solution (2.0 M), 5-50 "L NADP+or NAD+ (0.02 M). The reaction was followed by the UV absorbance at 340 nm at 25 ºC. The initial velocities were obtained from the curves of NADPH or NADH concentrations vs. time, and they were used to plot 1/[v] vs. 1/[S].171 3.2.8 NADPH and NADH oxidase activities of the permeabilized cells of E. coli BL21 (pGDH1) The permeabilized cells were resuspended in 990 "L Tris-HCl buffer (100 mM, pH = 7.0) to a density of 0.2 g cdw/L. 10 "L NADPH or NADH (0.2 M) 68 were added. The concentration of NADPH or NADH was followed by UV absorption at 340 nm at 25 °C. 3.2.9 General procedure for bioreduction of ethyl 3-keto-4, 4, 4triflurobutyrate 1 with NADPH recycling with coupled permeabilized microorganisms To a suspension of permeabilized cells of B. pumilus Phe-C3 (20-40 g/cdw) and E. coli XL-1 Blue (pGDH1) or E. coli BL21 (pGDH1) (20-40 g/cdw) in 10 mL Tris-HCl buffer (100 mM, pH = 7.0) was added 3-ketoester 1 (110 mg, 60 mM), NADP+ (0.04 mg, 0.005 mM), and glucose (0.8 g, 440 mM). The mixture was shaken at 25 ºC and 300 rpm and aliquots (300 "L) were taken at different time points for GC analysis. Additional 3-ketoester 1 (97 mg, 60 mM) was added at 5 h. More glucose (1.5-2.0 M) was added at several time points. Analytic samples were prepared by centrifugation, dilution to 4 times volume, extraction with same volume chloroform containing 2 mM hexadecane as the internal standard, and desiccation with anhydrous Na2SO4. GC analysis gave the product concentration at different time points, and final TTN of NADPH recycling was calculated by mole of product formed per mole of NADP+ added. 69 3.2.10 Bioreduction of ethyl 3-keto-4, 4, 4-triflurobutyrate 1 with NADPH recycling for 4200 times with coupled permeabilized cells of B. pumilus Phe-C3 and E. coli BL21 (pGDH1) To a suspension of permeabilized cells of B. pumilus Phe-C3 (40 g cdw/L) with E. coli BL21 (pGDH1) (20 g cdw/L) in 10 mL Tris-HCl buffer (100 mM, pH = 7.0) was added 3-ketoester 1 (110 mg, 60 mM), NADP+ (0.04 mg, 0.005 mM), and glucose (0.8 g, 440 mM). The mixture was shaken at 25 ºC, 300 rpm. Additional 3-ketoester 1 (97 mg, 60 mM) was added at 5 h. More glucose was added at 5 h (0.70 g, 440 mM), 10 h (0.67 g, 440 mM), 19 h (0.65 g, 440 mM), 24 h (0.16 g, 110 mM), 29 h (0.15 g, 110 mM). At different time points, analytic samples were taken, prepared using the same method described above, and analyzed by GC. 3.2.11 Bioreduction of ethyl 3-keto-4, 4, 4-triflurobutyrate 1 with NADPH recycling for 96 h by using coupled permeabilized cells of B. pumilus PheC3 and E. coli BL21 (pGDH1) with four-times addition of 0.005 mM NADP+ The above reaction procedure was repeated till 24 h. Additional NADP+ (0.005 mM) was added at 24, 48, and 72 h. More glucose was added at 24 h (0.16 g, 110 mM), 29 h (0.15 g, 110 mM), 34 h (0.57 g, 440 mM), 44 h (0.55 g, 440 mM), 48 h (0.13 g, 110 mM), 53 h (0.12 g, 110 mM), 58 h (0.48 g, 440 mM), 68 h (0.47 g, 440 mM), 72 h (0.11 g, 110 mM), 77 h (0.10 g, 110 mM), 82 h (0.38 g, 440 mM) and 92 h (0.36 g, 440 mM). At different time points, 70 samples were taken, prepared using the same method described above, and analyzed by GC. The reaction was stopped at 96 h. 3.3 Results and Discussion 3.3.1 Genetic engineering, cell growth, and GDH activity of recombinant E. coli expressing GDH Previously, permeabilized cells of B. subtilis BGSC 1A1 containing GDH were used for the recycling of NADPH in the coupled permeabilized cells approach.63 The GDH activity was, however, only about 5.0 U/g cdw,63 which is the limiting factor for achieving high cofactor TTN. In addition, this strain was found to have NADPH oxidase activity, which competed with the NADPH-dependent bioreduction. Thus, our first target was to engineer a recombinant strain expressing GDH from B. subtilis BGSC 1A1 with higher GDH activity and no NADPH oxidase activity. Two primers BSG-TAA1 and BSG-ATG1 were designed for the cloning of the gdh gene of B. subtilis BGSC 1A1 based on the known gene sequence.169 The full length of gdh gene was amplified by high fidelity polymerase chain reaction with the primers. The gdh gene fragment was digested with EcoR I (Roche) and Hind III (Roche) and inserted into the lacZ expression vector pUC18. The formed pGDH1 was then transformed into E. coli XL-1 Blue and E. coli BL21, respectively. The two recombinant E. coli strains were grown in LB medium containing ampicillin (100"g/mL) at 37ºC, respectively, and their GDHs were induced by the addition of 0.5-1.0 mM isopropyl-!-D- 71 thiogalactopyranoside (IPTG) after the lag phase. Typical growth curves were shown in Fig.3.2. E. coli BL21 (pGDH1) grew faster at the beginning and reached the exponential phase at 5 h with a cell density of 1.5 g cdw/L. On the other hand, E. coli XL-1 Blue (pGDH1) grew slower at the beginning and reached the stationary phase at 10 h with a cell density of 2.0 g cdw/L. 3 180 Cell Density (g/L) 140 2 120 100 1.5 80 IPTG IPTG 1 60 40 0.5 Activity (U/g protein) 160 2.5 20 0 0 0 2 4 6 8 10 12 14 Time (h) Figure 3.2. Growth and GDH activities of E. coli XL-1 Blue (pGDH1) and E. coli BL21 (pGDH1). Cell growth: E. coli XL-1 Blue (pGDH1) ($); E. coli BL21 (pGDH1). GDH activity of CFE (-); E. coli XL-1 Blue (pGDH1) (%); E. coli BL21 (pGDH1) (&). Conditions for cell growth and GDH expression were examined. The GDH activity at different time points was measured by taking samples from the E. coli cultivation, preparing cell-free extract (CFE), determining the protein concentration by bioassay,170 and examining the GDH activity by adding 1% glucose and 2 mM NADP+ to the CFE and following the NADPH formation by UV absorption at 340 nm. In fact, the temperature from 20 to 37 °C and IPTG concentration from 0.5 to1.0 mM did not influence the GDH activity and expression, and induction at early stage is necessary. For both E. coli strains, high activity was found in the stationary phase over a period of 4-6 h. As shown in Figure 3.2, the highest activity was 170 U/g protein at 6 h for E. 72 coli BL21 (pGDH1) and 70 U/g protein at 10 h for E. coli XL-1 Blue (pGDH1), respectively, are much higher than that of the wild-type Bacillus strain. 175 83 62 47.5 GDH 32.5 H 25 16.5 Marker 1 2 3 4 Figure 3.3. SDS-PAGE of E. coli BL21 (pGDH1) (lane 1), E. coli BL21 pUC18 (lane 2), E. coli XL-1 Blue (pGDH1) (lane 3), and B. subtilis BGSC 1A1 (lane 4). The cloning and expressing of GDH in the two recombinants E. coli were successful, demonstrated by the observed GDH activity of the two E. coli, and by the GDH bands in the SDS-PAGE as well. SDS-PAGE in Figure 3.3 showed the proteins in the CFE of E. coli BL21 (pGDH1) (lane 1), E. coli BL21 pUC18 (lane 2), E. coli XL-1 Blue (pGDH1) (lane 3), and B. subtilis BGSC 1A1 (lane 4). The GDH band was clearly visible for the two pGDH1containing recombinant strains, and E. coli BL21 (pGDH1) showed a higher expression level of GDH than E. coli XL-1 Blue (pGDH1). 73 3.3.2 Preparation and GDH activity of permeabilized cells of E. coli recombinants expressing GDH The preparation of permeabilized cells with high activity is a very important step towards the successful application of the whole concept. A simple “freeze/thaw” treatment was firstly applied to E. coli BL21 (pGDH1) permeabilization. Table 3.1. Preparation conditions and GDH activities of the permeabilized cells of E. coli XL1 Blue (pGDH1) and E. coli BL21 (pGDH1) Entry E. coli cells EDTA Toluene Time Activity (mM) (v/v %) (min) (U/g cdw) a 23 1 BL21 (pGDH1) 5 0 30 2 BL21 (pGDH1) 10 0 30a 24 3 BL21 (pGDH1) 5 1 30a 24 4 BL21 (pGDH1) 5 0 10b 26 5 BL21 (pGDH1) 10 0 10b 38 6 BL21 (pGDH1) 10 1 10b 61 0 a 14 7 XL-1 Blue (pGDH1) 5 30 a) Samples were shaken at 25OC and 300 rpm for 30 min and then put on ice for 1 h. b) Samples were shaken at 25 OC and 300 rpm for 10 min without the treatment on ice. The GDH activity of whole cells was examined by adding 1% glucose and 2 mM NADP+ to cell suspension in KP buffer (0.2 g cdw/L) and following the NADPH formation by UV absorption at 340 nm. The fresh cells of E. coli BL21 (pGDH1) showed no activity under such assay. However, the frozen/thawed cells demonstrated an activity of 25 U/g cdw, indicating the partial permeabilization of cells. Further freeze/thaw treatments increased the activity of the cells after each cycle and gave an activity of 45 U/g cdw after 5 cycles. However, the activity decreased to 39 U/g cdw after 6 times treatment. 74 Nevertheless, the CFE of the 6-times-treated cells showed the full activity of 170 U/g protein, indicating that GDH is stable under the treatment condition and cells were not fully permeabilized for cofactor across. The activity of permeabilized E. coli BL21 (pGDH1) cells is 39-45 U/g cdw, which is much lower than the theoretical value: the CFE of the resulted cells had an activity of 170 U/g protein; based on the assumption that 50% cdw is the weight of the total protein, the highest possible activity of permeabilized cells is 85 U/g cdw. To prepare more active permeabilized cells of E. coli BL21 (pGDH1), treatment with surfactant and organic solvent were examined and turned out to be a better method. The cells were incubated with EDTA (510 mM) containing toluene (0-1%) at 25 ºC and 300 rpm for 10-30 min, and the permeabilized cells were harvested by centrifugation and the GDH activity was determined. As shown in Table 3.1, permeabilized cells prepared by incubation with 10 mM EDTA containing 1% toluene for 10 min showed the best activity of 61 U/g cdw which is higher than the activity of 45 U/g cdw obtained by freeze/thaw treatment for 5 times, and close to the theoretic maximum for the cells. Here, the amount of toluene used is very critical. The use of high than 1% toluene decreased the activity. In addition, the incubation time is important: 10 min is better than 30 min. Similarly, EDTA (5-10 mM) and toluene (0-1%) were used for the treatment of the cells of E. coli XL-1 Blue (pGDH1). Although many conditions were examined, the best permeabilization condition was the treatment with 5 mM EDTA without toluene, giving a rather low GDH activity of 14 U/g cdw. Nevertheless, this is more than double of the activity of the permeabilized cells of the wild-type Bacillus strain. 75 3.3.3 GDH kinetics and NAD(P)H oxidase activity of E. coli BL21 (pGDH1) To investigate the cofactor dependence and the affinity of NADP+ or NAD+ to the GDH in permeabilized E. coli BL21 (pGDH1), a set of activity assays were performed with NADP+ or NAD+ at different concentrations (0.1-1.0 mM) in the suspension of the permeabilized cells (0.2 g cdw/L) in Tris-HCl buffer (100 mM, pH = 7.0) containing glucose (55 mM) at 25 ºC. The reaction was followed by UV absorption at 340 nm. The initial velocities at different concentration of NADP+ or NAD+ were used for the plot of 1/[v] vs 1/[S],171 giving Km of 0.90 mM and Vmax of 130 U/g cdw for NADP+ and Km of 1.4 mM and Vmax of 76 U/g cdw for NAD+ for the permeabilized cells. Such permeabilized cells can be used for the recycling of NADPH and NADH. The value of Vmax/Km, which measures enzyme efficiency, was 2.7-fold higher for NADPH recycling than for NADH recycling. To examine NADH or NADPH oxidase activity of the permeabilized cells of E. coli recombinants, oxidation of NADH or NADPH was performed in cells suspension (0.2 g cdw/L) in Tris-HCl buffer (100 mM, pH = 7.0) in the presence of NADPH (2 mM) or NADH (2 mM) at 25 ºC for 30 min. The NADPH or NADH concentration was determined by UV absorbance at 340 nm. In both case, no NADPH or NADH was consumed, suggesting these permeabilized E. coli recombinant free of NADPH or NADH oxidase. 76 3.3.4 Coupling of permeabilized cells of B. pumilus Phe-C3 and recombinant E. coli expressing GDH for bioreduction of 3-ketoester 1 with NADPH Recycling The potential of using permeabilized cells of E. coli BL21 (pGDH1) or E. coli XL-1 Blue (pGDH1) for cofactor recycling was examined in the enantioselective reduction of ethyl 3-keto-4-triflurobutyrate 1 to the corresponding 3-hydroxyester (R)-2. Previously, the best TTN for NADPH recycling in the reduction was obtained as 1600 when permeabilized cells of B. pumilus Phe-C3 and B. subtilis BGSC 1A1 were used in 20 g cdw/L and 40 g cdw/L, respectively, with initial addition of 0.01 mM NADP+.99 For comparison, 0.005 mM NADP+ was used for the same biotransformation, giving exactly the same TTN. Coupling of permeabilized cells of E. coli XL-1 Blue (pGDH1) with an activity of 14 U/g cdw (40 g cdw/L) with permeabilized cells of B. pumilus Phe-C3 (20 g cdw/L) for bioreduction of 3ketoester 1 with initial supply of 0.005 mM NADP+ at 25 ºC and 300 rpm for 30 h gave a TTN of 3100. Permeabilized cells of E. coli BL21 (pGDH1) with an activity of 24 U/g cdw, prepared by the treatment with EDTA (10 mM), were then examined for the cofactor recycling. Coupling of B. pumilus Phe-C3 (20g cdw/L) with E. coli BL21 (pGDH1) (30 g cdw/L) led to the recycling of NADPH for 3000 times in the bioreduction. Further increase the cell density of E. coli BL21 (pGDH1) to 40 g cdw/L resulted in a slight increase of the TTN from 3000 to 3200. Instead, increase of the reduction enzyme has more influence on the cofactor TTN: bioreduction of 3-ketoester 1 with 30 g cdw/L of B. pumilus Phe-C3 and 77 30 g cdw/L of E. coli BL21 (pGDH1) afforded a TTN of 3700 for the recycling of NADPH. Finally, the permeabilized cells of E. coli BL21 (pGDH1) with an activity of 61 U/g cdw, prepared by the treatment with 10 mM EDTA containing 1% toluene, was used for the coupled permeabilized cells approach. Since these cells have very high activity for NADPH recycling, they were used in 20 g cdw/L to couple with 40 g cdw/L of B. pumilus Phe-C3 for the bioreduction of 3-ketoester 1. With initial addition of NADP+ (0.005 mM) and glucose (440 mM), bioreduction for 34 h gave a TTN of 4200 for NADPH recycling. Table 3.2. Coupled permeabilized cells of B. pumilus Phe-C3 and a cofactor-regenerating microorganism for bioreduction of ethyl 3-keto-4, 4, 4-triflurobutyrate 1 with NADPH recycling Entry Substrate NADP+Glucoseb Phe-C3c 1a (mM) (mM) (mM) (g BGSC 1A1d XL-1e BL21f Time Product (g (g (h) cdw/L) (g cdw/L) cdw/L) cdw/L) 2 TTN (mol/mol) (mM) 1 60+60 0.005 440 20 40 - - 43 8.0 1600 2 60+60 0.005 440 20 - 40 - 43 15.5 3100 3 60+60 0.005 440 20 - - 30g 39 15.0 3000 g 39 16.0 3200 4 60+60 0.005 440 20 - - 40 5 60+60 0.005 440 30 - - 30g 39 17.5 3700 6 60+60 0.005 440 40 - - 20h 34 21.0 4200 - h 34 25.0 2500 7 60+60 0.001 440 40 - 20 a) 3-ketoester 1 was added at beginning (60 mM) and at 5 h (60 mM). b) More glucose (1.5-2.0 M) was supplied during the reaction. c) B. pumilus Phe-C3. d) B. subtilis BGSC 1A1. e) E. coli XL-1 Blue (pGDH1). f) E. coli BL21 (pGDH1). g) Permeabilized cells with an activity of 24 U/g cdw. h) Permeabilized cells with an activity of 61 U/g cdw. The more active permeabilized cells of E. coli recombinant are suitable catalysts for the recycling of NADPH as well as NADH. In addition, they 78 contain no NADPH/ANDH oxidase activity. With permeabilized cells of B. subtilis BGSC 1A1 as the cofactor-recycling microorganism, a TTN of 1600 was achieved for bioreduction of 3-ketoester 1 with the initial addition of 0.01 mM NADP+.63 The TTN could not be increased by adding a reduced amount of cofactor, such as 0.005 mM NADP+ (Table 3.2). It was, however, significantly increased to 3100 by using E.coli XL-1 Blue (pGDH1) with an activity of 14 U/g cdw to replace the wide-type strain. Further increase the GDH activity by using even more active cells of E. coli BL21 (pGDH1) did not increase too much the TTN (entry 4, Table 3.2). Obviously, the limiting factor here is the inefficiency of the reducing-microorganism. Increase of the cell density of B. pumilus Phe-C3 to 40 g cdw/L and coupling with E. coli BL21 (pGDH1) (20 g cdw/L) with an activity of 61 U/g cdw led to the increase of NADPH recycling to 4200 times. This is very significant improvement of the cofactor TTN for the coupled permeabilized cells approach: considering the price of NADP+ of 6-7 EUR/g, recycling of NADPH for 4200 significantly reduced the cofactor cost and made the process in the practical range for producing final chemicals and pharmaceutical intermediates. The high TTN achieved for the bioreduction of 3-ketoester 1 with two permeabilized cells approach is similar to the TTN obtained for the same reduction with a single permeabilized microorganism with two necessary enzymes.148 This indicates that the cofactor can easily across between the two permeabilized microbial cells and provides the same catalytic efficiency as it was in the single permeabilized cell. In current system, NADP+ was used at 0.005 mM that is far below the Km. Increase of NADP+ to 0.01 mM should resulted in a doubling of the rate for the recycling 79 of NADPH. However, the rate of the reduction was only slightly increased (21 vs. 25 mM product for entry 6 vs. 7, Table 3.2), and the TTN of the cofactor recycling was significantly reduced. This is mainly due to the low activity of the reductase-containing microorganism. Thus, the system could be further improved by using a highly active reducing microorganism. 3.3.5 Long-term bioreduction of 3-ketoester 1 with efficient NADPH recycling by the coupled permeabilized cells approach with the addition of NADP+ for multiple times Bioreduction of 60 mM 3-ketoester 1 with permeabilized cells of B. pumilus Phe-C3 (40 g cdw/L) and E. coli BL21 (pGDH1) (20 g cdw/L) was performed for 68 h with three times addition of 0.005 mM NADP+. As shown in Figure 3.4, the reaction rate was high at beginning and produced 16.5 mM of 3hydroxyester (R)-2 in the first 10 h. From 10 h to 20 h, the reaction rate 80 NADP+ Conc. of 2 (mM) 70 60 NADP+ 50 40 NADP+ 30 20 10 0 0 20 40 60 80 100 T ime (h) Figure 3.4. Product formation in bioreduction of ethyl 3-keto-4,4,4-triflurobutyrate 1 by using coupled permeabilized cells with the addition of 0.005 mM NADP+ at different time points. B. pumilus Phe-C3 (40 g cdw/L) and E. coli BL21 (pGDH1) (20 g cdw/L; activity: 61 U/g cdw) with 120 mM 3-ketoester 1 (%) and with 60 mM 3-ketoester 1 ('). 80 Table 3.3. Product formation in bioreduction of ethyl 3-keto-4,4,4-triflurobutyrate 1 with coupled permeabilized cells Entry B. pumilus Phe- 1 2 E. coli C3 BL21a 40 (g cdw/L) 20 (g cdw/L) 40 20 ActivitybTimeNADP+ (R)-2 Conv. 1 (mM) Glucose (U/g 60 60+60 440 (mM) c 440 1.3 cdw) 1.3 TTN (h) (mM) (mM) (%) (mol/mol) 0 0.005 20 +0.005 19.0 32 3800 44 +0.005 36.0 60 3600 68 50.5 84 3400 24 +0.005 20.0 17 4000 48 +0.005 38.0 31 3800 72 +0.005 52.5 44 3500 96 53 3200 0 0.005 64.0 a) Permeabilized E. coli BL21 (pGDH1) cells with an activity of 61 U/g cdw. b) Activity was determined over the first 1h. c) 3-ketoester 1 was added at beginning (60 mM) and at 5 h (60 mM). became lower, which may have been due to decomposition of the cofactor, since the half-life of NADPH in the buffer was 24 h.148 Nevertheless, the product concentration reached 19.0 mM in the first cycle with a TTN of 3800. The addition of another 0.005 mM NADP+ at 20 h resulted in a fast conversion of 3-ketoester 1 to 3-hydroxyester (R)-2. The phenomena in the second and third cycle are similar to the first one. As listed in Table 3.3, the 3hydroxyester (R)-2 was formed in 36.0 mM with an overall cofactor TTN of 3600 at 44 h and in 50.5 mM and 95% ee (R) with an overall TTN of 3400 and 84% conversion at 68 h. This is a very good result. In a comparison experiment, bioreduction of 60 mM 3-ketoester 1 with the resting cells of B. pumilus Phe-C3 (40 g cdw/L) for 25 h resulted in only 20.5 mM (R)-2 with 34% conversion. In another experiment, bioreduction was performed with 120 mM of 3-ketoester 1 for 96 h with four times addition of 0.005 mM NADP+. Figure 2.4 gave nearly the same curves for two cases within the first 68 h. The 81 3-hydroxyester (R)-2 was formed in 52.5 mM with an overall TTN of 3500 at 72 h. The addition of 0.005 mM NADP+ at this time point accelerated again the bioreductions, and the product concentration reached 64.0 mM at 96 h with an overall TTN of 3200. 3.4 Summary and Conclusions In conclusion, the GDH of B. subtilis BGSC 1A1 was cloned and functionally expressed in E. coli BL21 (pGDH1), showing an activity of 170 U/g protein. The recombinant strain was successfully permeabilized with EDTA/toluene to give an activity of 61 U/g cdw for NADPH recycling. Such permeabilized cells demonstrated much higher GDH activity and no NADPH or NADH oxidase activity, being advantageous over the wild-type strain. They were suitable for the recycling of both NADPH and NADH. Coupling of permeabilized cells of B. pumilus Phe-C3 and E. coli BL21 (pGDH1) for the reduction of ethyl 3-keto-4-triflurobutyrate 1 gave a TTN of 4200 for NADPH recycling, which is 2.6 times of the TTN obtained by using B. subtilis BGSC 1A1. The high TTN value is in the practical range for the synthesis of fine chemicals. Bioreduction of 3-ketoester 1 via coupled permeabilized cells with the addition of 0.005 mM NADP+ for 3 times gave 50.5 mM of 3hydroxyester (R)-2 in 95% ee and 84% conversion with an overall TTN of 3400 for NADPH recycling. These results demonstrated the high stability and productivity of the new biocatalysts system and a practical synthesis of (R)ethyl 3-hydroxy-4-trifluorobutanoate 2. Our method could be applicable to other microbial reductions with cofactor recycling. 82 CHAPTER 4 REGIO- AND STEREO-SELECTIVE BIOHYDROXYLATIONS WITH A RECOMBINANT ESCHERICHIA COLI EXPRESSING P450PYR MONOOXYGENASE OF SPHINGOMONAS SP. HXN-200 83 4.1 Introduction Regio- and stereo-selective hydroxylations are useful reactions for the preparation of chiral alcohols that are valuable fine chemicals, pharmaceutical intermediates, and flavors and fragrances. However, this type of transformations remains as a great challenge in classical chemistry.172-177 On the other hand, hydroxylation can be achieved by using an enzyme such as a monooxygenase which catalyzes the insertion of one O atom of molecular oxygen into a specific C-H bond. 5,105,178-185 In addition to the high regio- and stereo-selectivity, biohydroxylation utilizes molecule oxygen as oxidant, thus being an ideal tool for green oxidation and sustainable chemical synthesis. Some progress has been made in the discovery and application of appropriate monooxygenases for biohydroxylations, 5,105,178-185 and several enzymatic systems have been extensively investigated, such as methane monooxygenase (MMO),186,187 membrane-bound alkane hydroxylase (alkB),188-190 and cytochrome P450 monooxygenases.25-44 Among them, cytochrome P450 monooxygenases are of great interest, due to their wide existence in nature and high diversity. Many P450 monooxygenases from wild-type strains were identified for biohydroxylations,30,31 and some of them, such as P450cam and P450BM-3, have been characterized,25-27 cloned and expressed,32-36 and engineered via directed evolution24,37-41 or protein engineering42-44. However, it is still difficult to obtain appropriate P450 monooxygenase with desired substrate specificity and high selectivity for a given hydroxylation. It is also a significant challenge to construct highly active recombinant biocatalysts via genetic engineering of P450 monooxygenase, possibly due to the particular complicacy of P450 enzyme and system. 84 Previously, we discovered Sphingomonas sp. HXN-20064 containing a P450pyr monooxygenase as a powerful biohydroxylation catalyst with unique substrate specificity and range as well as high selectivity. The wild-type strain was shown to be the best catalyst known thus far for the hydroxylation of a range of alicyclic substrates such as N-substituted pyrrolidines,65 pyrrolidinones,66 piperidines,67 piperidinones,68 and azetidines,67 with high activity and good to excellent regio- and stereo-selectivity. For example, hydroxylation of Nbenzyl-pyrrolidin-2-one 1 with this strain gave N-benzyl-4-hydroxypyrrolidin2-one 2 in >99% ee,66 a useful intermediate for the preparation of an oral carbapenem antibiotic CS-83469 and nootropic drug (S)-Oxiracetame.191 A Pseudomonas putida strain expressing P450pyr monooxygenase was constructed,69 but the hydroxylation activity was rather low. Both the wildtype strain and the P. putida recombinant need to grow on n-octane, which is a flammable and relatively expensive substrate, thus being a technical challenge in large-scale application. We aim to engineer a recombinant E. coli strain expressing P450pyr monooxygenase with high whole-cell hydroxylation activity, no side reaction, and easy growth on non-flammable substrate, and then employ this recombinant strain for regio- and stereo-selective hydroxylation. 85 4.2 Experimental Section 4.2.1 Chemicals Ampicillin (>99%), kanamycin solution (50 mg/mL), NADH (>99%), Nbenzyl pyrrolidine-2-one 1 (98%), (-)-!-pinene ("99%) 5, norbornane 7 (98%), tetralin 9 (99%), (-)-trans-pinocarveol ("96%), exo-norborneol 8 (98%), endonorborneol (96%), and DL-dithiothreitol ("99%) were purchased from SigmaAldrich. 2-Tetralol 10 (97%) was obtained from Acros Organics. 6-Methoxy2-tetralol (>96%) was purchased from JW-Pharmlab. 6-Methoxy-1-tetralol (98%) and 7-methoxy-1-tetralol (98%) were bought from Aurora Building Blocks. Isopropyl !-D-thiogalactopyranoside (ITPG, >99%) was bought from 1st BASE. 6-Methoxy-tetralin 11 (85%, sigma) was further purified by column chromatography on silica gel (Rf = 0.32, n-hexane/ethyl acetate 40:1) to purity >98% (GC). N-benzyloxycarbonyl pyrrolidine 365 was prepared according to the published procedures. 4.2.2 Strain and biochemicals Escherichia coli BL21 (DE3), DH5#, plasmids pETDuet and pRSFDuet were purchased from Novagen. Failsafe PCR 2X Premix G was purchased from Epicentre Biotechnologies. Phusion DNA polymerase, T4 DNA ligase and the restriction enzymes NcoI, NdeI, KpnI, and AflII were purchased from New England Biolabs. Medium components tryptone and yeast extract were purchased from Biomed Diagnostics. 86 4.2.3 Analytical methods The concentrations of N-benzyl pyrrolidine-2-one 1, N-benzyl-4-hydroxypyrrolidin-2-one 2, N-benzyloxycarbonyl pyrrolidine 3 and N- benzyloxycarbonyl-3-hydroxypyrrolidine 4 were analyzed by Shimadzu Prominence HPLC on a Hypersil BDS-C18 column (125 mm $ 4 mm) at 25 ºC. UV detection: 210 nm; flow rate: 1 mL/min. Eluent: acetonitrile/water (20:80); retention time: 2.8 min for N-benzyl-4-hydroxy-pyrrolidin-2-one 2, and 7.8 min for N-benzyl pyrrolidine-2-one 1. Eluent: acetonitrile/water (25:75); retention time: 4.7 min for N-benzyloxycarbonyl-3- hydroxypyrrolidine 3, and 11.4 min for N-benzyloxycarbonyl pyrrolidine 4. The ee of N-benzyl-4-hydroxy-pyrrolidin-2-one 2 and N-benzyloxycarbonyl3-hydroxypyrrolidine 4 were determined by Shimadzu Prominence HPLC on a Chiralpak AS-H column (150 mm $ 2.1 mm) at 25 ºC. UV detection: 210 nm; flow rate: 1 mL/min. Eluent: n-hexane/2-propanol (4:1); retention time: 20.3 min for (S)-N-benzyl-4-hydroxy-pyrrolidin-2-one 2, and 30.5 min for (R)-Nbenzyl-4-hydroxy-pyrrolidin-2-one 2. Eluent: n-hexane/2-propanol (10:1); retention time: 13.5 min for (S)-N-benzyloxycarbonyl-3-hydroxypyrrolidine 4, and 15.4 min for (R)-N-benzyloxycarbonyl-3-hydroxypyrrolidine 4. The concentrations of (-)-!-pinene 5, trans-pinocarveol 6, norbornane 7, exonorbornaneol 8, tetralin 9, 2-tetralol 10, 6-methoxy-tetralin 11, 7-methoxy-2tetralol 12 and their corresponding products were analyzed by Agilent GC 6890 on an Agilent HP-5 column (25 m $ 0.32 mm) with inlet temperature of 280 ºC and detector temperature of 300 ºC. Temperature program: 60 ºC increase to 100 ºC at a rate of 5 ºC/min, increase to 116 ºC at a rate of 2 87 ºC/min, keep 2 min, then increase to 280 ºC at a rate of 30 ºC/min, and keep for 3 min. Retention time: 4.2 min for norbornane 7, 7.8 min for exonorborneol 8, 7.9 min for (-)-!-pinene 5, 8.0 min for endo-norborneol, 12.6 min for trans-pinocarveol 6, 13.5 min for tetralin 9, 19.9 min for 1-tetralol, 20.4 min for 2-tetralol 10, 20.9 min for 6-methoxy-tetralin 11, 21.1 min for 7methoxy-1-tetralol, 21.3 min for 7-methoxy-2-tetralol 12, 22.3 min for nhexadecane (internal standard), 22.5 min for 6-methoxy-1-tetralol and 22.8 min for 6-methoxy-2-tetralol. 4.2.4 Genetic engineering of E. coli BL21-pRSFDuet P450pyr-pETDuet Fdx FdR1500 [E. coli (P450pyr)] Plasmid pCom8-PA7F200R150069 was used as a PCR template to amplify the coding region of cytochrome P450pyr (PA7), ferredoxin (F200), and ferredoxin reductase (R1500). The P450pyr gene was amplified using the forward primer P450fwd (5’ TTA ACT ACT CCA TGG AAC ATA CAG GAC AAA GCG CGG 3’, the NcoI restriction site is underlined) and reverse primer P450rev (5’ TTA ACT ACT GGT ACC CTA CGC GTG GAC GCG AAC 3’, the KpnI restriction site is underlined). The F200 gene was amplified using the forward primer Frdxfwd (5’ TTA ACT ACT CCA TGG ca ACA GTG ACC TAT GTT GAA ATA AAT GGC AC 3’, the NcoI restriction site is underlined, the second codon of the F200 gene, in small caps, was changed from the original cca to gca) and reverse primer Frdxrev (5’ TTA ACT ACT CTT AAG TCA ATG CTG CGC GAG AGG AAG 3’, the AflII restriction site is underlined). The R1500 gene was amplified using the forward primer R1500fwd (5’ TTA 88 ACT ACT CAT ATG ATC CAC ACC GGC GTG AC 3’, the NdeI restriction site is underlined) and the reverse primer R1500rev (5’ TTA ACT ACT GGT ACC TTA GAG GGA GGT TGG GGA CG 3’, the KpnI restriction site is underlined). PCR amplified genes were digested with their respective enzymes. The digested P450pyr fragment was ligated into the pRSFDuet vector that was digested with NcoI and KpnI restriction enzymes. The digested F200 fragment was ligated into the multiple cloning site (MCS) 1 of the pETDuet vector that was digested with NcoI and AflII. The resulting plasmids from the ligations were separately transformed into chemical competent E. coli DH5# cells which were then plated on Luria-Bertani (LB) agar plates containing 50 µg/mL kanamycin (for pRSFDuet P450pyr) and 100 µg/mL ampicillin (for pETDuet F200) respectively. Subsequently, the digested R1500 fragment was ligated into the MCS 2 of the same pETDuet vector, containing the F200 gene, digested with NdeI and KpnI restriction enzymes. The resulting plasmid from the ligation was transformed into chemical competent E. coli DH5# cells, which were then plated on LB agar plates containing 100 µg/mL ampicillin. Finally, the purified pRSFDuet P450pyr and pETDuet F200 plasmids were transformed into electrocompetent E. coli BL21 (DE3) and plated on LB agar plates containing 50 µg/mL kanamycin and 100 µg/mL ampicillin. 4.2.5 Growth and specific hydroxylation activity of E. coli (P450pyr) The recombinant E. coli (P450pyr) was inoculated on LB agar plate (10 g tryptone, 5 g yeast extract and 5 g NaCl in 1 L deionized water with 2% agar) containing ampicillin (100 µg/mL) and kanamycin (50 µg/mL), and grown 89 overnight at 37 ºC. A single colony from the LB agar plate was inoculated into 30 mL of LB medium containing ampicillin (100 µg/mL) and kanamycin (50 µg/mL), and grown at 300 rpm and 37 ºC for 12 h, giving an OD600 of 4.0 (1.6 g cdw/L). To obtain high specific hydroxylation activity of this recombinant strain, induction conditions were optimized, including induction time points (1.5 to 2.5 h after inoculation), induction durations (2 to 6 h), induction amounts (0.3 to 1.0 mM IPTG), and induction temperatures (25 to 37 ºC). The optimum culture procedure was the followings: 2 mL of the above preculture was added in 100 mL LB medium containing ampicillin (100 µg/mL) and kanamycin (50 µg/mL), and the mixture was shaken at 300 rpm and 37 ºC. IPTG (0.5 mM) was added when OD600 reached 1.5 (0.6 g cdw/L) at 2 h, the temperature was changed to 30 ºC, and the mixture was shaken at 300 rpm for another 3 h. Samples were taken at different time points for OD measurement, activity test, and CFE preparation. The cells were harvested at the late exponential phase with an OD600 of 4.0 (1.6 g cdw/L) by centrifugation at 10,375 g for 10 min and the cells were directly used for the activity test and biotransformation. To test the specific hydroxylation activity of the recombinant strain, the above freshly harvested cells were resuspended in KP buffer (50 mM; pH = 7.5) to obtain a density of 1.5 g cdw/L. To 950 µL of the cell suspension was added 40 µL of glucose stock solution (50%, w/v), 10 µL of N-benzyl pyrrolidine-2one 1 or N-benzyloxycarbonyl pyrrolidine 3 stock solution (0.2 M in methanol) to a final volume of 1 mL in a 2 mL Eppendorf tube. The mixture was shaken at 1200 rpm and 30 ºC with a Bioer mixing block MB-102 for 30 min, and then 1 mL cold methanol was added to quench the reaction. Analytic 90 sample was prepared by violent vortex and centrifugation of the reaction mixture. Reverse phase HPLC was used to determine the product 2 or 4 concentration. The specific hydroxylation activity was expressed in U/g cdw, and 1 U was defined as the formation of 1 µmol product/min. 4.2.6 Protein gel and CO difference spectrum of CFE of E. coli (P450pyr) 5 mL cell suspension (10 g cdw/L) of above freshly harvested cells in KP buffer (50 mM; pH = 7.5) was passed through a homogenizer (Constant Cell Disruption System) twice at 20 kpsi. The cell debris was removed by centrifugation at 13,000 g at 4 ºC for 30 min. The supernatant was diluted 10 times with KP buffer (50 mM; pH = 7.5), and the protein concentration was determined by Bradford protein content assay139 with bovine serum albumin (BSA) as standard. SDS-PAGE was performed by loading 15 µg CFE on a gel containing 0.1% sodium dodecyl sulfate and 14% acrylamide, staining with a 0.1% solution of Commassie brilliant blue R-250 in methanol/acetic acid/water (4:1:5; v/v/v), and destaining by soaking in deionized water overnight. The CO difference spectrum of P450pyr expressed in E. coli (P450pyr) was measured at room temperature (25 ºC) in a Hitachi UV-Vis ratio beam spectrophotometer U-1900, with the use of quartz cuvette with a 1 cm light path. 3 mL CFE (1.7 g protein/L) in KP buffer (50 mM; pH = 7.5) in the quartz cuvette was reduced by addition of a few milligrams of solid dithiothreitol and saturated with CO by bubbling the gas for about 2 min. The UV absorbance at 450 nm of CFE was measured before and after the CO 91 bubbling. A value of 91 cm-1 for the molar extinction increment at 450 nm for cytochrome P450pyr was used to calculate the P450pyr concentration.192 4.2.7 Optimization of biohydroxylation of N-benzyl pyrrolidine-2-one 1 with E. coli (P450pyr) To find out the optimal pH condition for biohydroxylation of N-benzyl pyrrolidine-2-one 1, 400 µL of glucose stock solution (50%, w/v) and 10 mM N-benzyl pyrrolidine-2-one 1 (17.5 mg, 0.1 mmol) were added to suspensions containing freshly harvested cells (5 g cdw/L) in 10 mL KP buffer (50 mM; pH = 6.0 to 8.0) or 10 mL Tris-HCl buffer (50 mM; pH = 8.5 to 8.9). The mixtures were shaken at 300 rpm and 25 ºC. Aliquots (100 µL) were taken out at 30 min and mixed with cold methanol (100 µL), and the cells were removed by centrifugation. The supernatants were analyzed by reverse phase HPLC to determine the product 2 concentrations. To find out the optimal temperature condition for biohydroxylation of Nbenzyl pyrrolidine-2-one 1, 400 µL of glucose stock solution (50%, w/v) and 10 mM N-benzyl pyrrolidine-2-one 1 (17.5 mg, 0.1 mmol) were added to suspensions containing freshly harvested cells (5 g cdw/L) in 10 mL KP buffer (50 mM; pH = 8.0). The mixtures were shaken at 300 rpm and 20 ºC to 35 ºC for 30 min. Analytic samples were prepared using the same method described above, and analyzed by HPLC. 92 4.2.8 Kinetic constants of biohydroxylation of N-benzyl pyrrolidine-2-one 1 and N-benzyloxycarbonyl pyrrolidine 3 with CFE or resting cells of E. coli (P450pyr) To 925 to 933 µL of the CFE (1.5 g protein/L) in KP buffer (50 mM; pH = 8.0), 40 µL of glucose stock solution (50%, w/v), 25 µL of NADH stock solution (0.2 M), and 2 to 10 µL of N-benzyl pyrrolidine-2-one 1 or Nbenzyloxycarbonyl pyrrolidine 3 stock solution (0.2 M or 0.5 M in methanol) were added to a final volume of 1 mL in a 2 mL Eppendorf tube. The mixtures were shaken at 1,200 rpm and 25 ºC with a Bioer mixing block MB-102 for 15 min, and then 1 mL cold methanol was added to quench the reaction. Analytic samples were prepared using the same method described above, and analyzed by HPLC. The initial velocities were calculated from the product 2 and 4 formed within the first 15 min, and they were used to plot 1/[v] vs. 1/[S].171 Freshly harvested cells were resuspended in KP buffer (50 mM; pH = 8.0) to obtain a density of 1.5 g cdw/L. To 950 to 958 µL of the cell suspensions were added 40 µL of glucose stock solution (50%, w/v) and 2 to 10 µL of N-benzyl pyrrolidine-2-one 1 or N-benzyloxycarbonyl pyrrolidine 3 stock solution (0.2 M or 0.5 M in methanol) to a final volume of 1 mL in a 2 mL Eppendorf tube. The initial velocities were calculated by the method described above and then used to plot 1/[v] vs. 1/[S].171 93 4.2.9 General procedure for the biohydroxylation of N-benzyl pyrrolidine2-one 1 to N-benzyl-4-hydroxy-pyrrolidin-2-one 2 with resting cells of E. coli (P450pyr) To suspensions containing freshly harvested cells (5 g cdw/L) in 10 mL KP buffer (50 mM; pH = 8.0) were added 400 µL of glucose stock solution (50%, w/v) and 5 mM (8.8 mg, 0.05 mmol) to 25 mM (43.8 mg, 0.25 mmol) Nbenzyl pyrrolidine-2- one 1. The mixture was shaken at 25 ºC and 300 rpm. Appropriate amount of 1.0 M NaOH solution was added at several time points to keep pH value of the reaction system around 8.0. At different time points, analytic samples were prepared using the same method described above, and analyzed by HPLC. 4.2.10 General procedure for the biohydroxylation of (-)-!-pinene 5 to (1R)-trans-pinocarveol 6 with resting cells of E. coli (P450pyr) For volatile substrates (-)-!-pinene 5, biotransformations were carried out in close systems. To 5 different 100 mL shaking flasks containing 10 mL cell suspensions (5 to 10 g cdw/L) in KP buffer (50 mM; pH = 8.0) were added 400 µL of glucose stock solution (50%, w/v) and 5 mM (6.8 mg, 0.05 mmol) to 10 mM (13.6 mg, 0.1 mmol) (-)-!-pinene 5. Then the flasks were covered with glass stoppers and tightly sealed with parafilm. The mixtures were shaken at 300 rpm and 25 ºC. The flasks were removed from the shaker at different time point, put into ice for 10 min, opened, and mixed with same volume ethyl acetate containing 2 mM n-hexadecane. The flask was kept on ice for another 94 10 min, mixed violently on vortex, and then the organic phase was separated, dried over anhydrous Na2SO4, and used for GC analysis. 4.2.11 General procedure for the biohydroxylation of norbornane 7, tetralin 9, and 6-methoxy-tetralin 11 with E. coli (P450pyr) The biotransformation of norbornane 7 at 5 mM (4.8 mg, 0.05 mmol) to 60 mM (57.6 mg, 0.6 mmol) was performed according to the same procedure for the hydroxylation of (-)-!-pinene 5 described above. To suspensions containing freshly harvested cells (5 to 10 g cdw/L) in 10 mL KP buffer (50 mM; pH = 8.0) were added 400 µL of glucose stock solution (50%, w/v) and 5 mM (6.6 mg, 0.05 mmol) to 10 mM (13.2 mg, 0.1 mmol) tetralin 9 or 5 mM (8.1 mg, 0.05 mmol) to 10 mM (16.2 mg, 0.1 mmol) 6methoxy-tetralin 11. The mixtures were shaken at 300 rpm and 25 ºC. Aliquots (200 µL) were taken out at different time points and extracted with 200 µL ethyl acetate containing 2 mM n-hexadecane as internal standard. All the supernatants were separated, and dried over anhydrous Na2SO4, and the samples were used for GC analysis. 95 4.3 Results and Discussion 4.3.1 Genetic engineering, cell growth, and protein expression of E. coli (P450pyr) To engineer an active recombinant P450pyr, plasmid pCom8-PA7F200R150069 was used as a polymerase chain reaction (PCR) template to amplify the coding region of cytochrome P450pyr (PA7), ferredoxin (F200, Fdx), and ferredoxin reductase (R1500, FdR). PCR amplified genes were digested with their respective enzymes. The digested P450pyr fragment was ligated into the pRSFDuet, while the digested Fdx fragment was ligated into the pETDuet vector, and the resulting plasmids from the ligations were separately transformed into chemical competent E. coli DH5# cells. Subsequently, the digested FdR fragment was ligated into the same pETDuet vector containing the Fdx gene. The resulting plasmid from the ligation was transformed into chemical competent E. coli DH5#. Finally, the purified pRSFDuet P450pyr and pETDuet FdxFdR plasmids were transformed into electrocompetent E. coli BL21 (DE3). The constructed recombinant strain, E. coli (P450pyr), was grown on LB medium containing ampicillin (100 µg/mL) and kanamycin (50 µg/mL) at 37 ºC, and its P450 monooxygenase expression was induced by the addition of IPTG after the lag phase. The optimum induction condition was the followings: addition of IPTG (0.5 mM) at 2 h and then incubation at 30 ºC for 3 h. The typical growth curve under the optimal culture condition is shown in 96 Figure 4.1. Cell density reached its maximum (1.8 g cdw/L) at 6 h decreased Cell Density (g cdw/L) 2.0 1.5 10 9 8 7 6 5 4 3 2 1 0 IPTG 1.0 0.5 0.0 0 2 4 6 Activity (U/g cdw) slowly afterwards. 8 T ime (h) Figure 4.1. Growth (%) and hydroxylation activity for 1 (&) and 3 (') of E. coli (P450pyr). 175 83 62 47.5 P450+FdR 32.5 25 16.5 Kda Fdx Marker 1 2 3 4 5 Figure 4.2. SDS-PAGE of CFE of E. coli (P450pyr). non-induced (lane 1), induced with IPTG for 2 h (lane 2), 3 h (lane 3), 4 h (lane 4), and 5 h (lane 5). Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) of the cell free extracts (CFEs) of E. coli (P450pyr), that was non-induced or induced for 2-5 h, was shown in Figure 4.2. Although P450pyr and FdR have the similar molecular weight and pI and thus cannot be distinguished in SDSPAGE, it was clear that P450pyr/FdR and Fdx were expressed in induced E. coli (P450pyr) by comparing with non-induced cells in Figure 5.2. 97 To examine the percentage of the active P450pyr among all the soluble proteins of IPTG-induced E. coli (P450pyr), CO difference spectra192 were measured with CFEs (1.7 g protein/L) in KP buffer (50 mM; pH = 7.5) at 450 nm. As shown in Figure 4.3, UV absorption difference at 450 nm between the CObound reduced P450pyr and reduced P450pyr was 0.041. The active P450pyr enzyme in the CFE was thus established as 0.033 g protein/L based on the molar extinction increment at 450 nm of 91 cm-1 for P450 enzyme192 This corresponds to 1.92% of all soluble proteins in CFEs of E. coli (P450pyr). For CFE of non-induced E. coli cells, there was no UV absorption difference at 450 nm shown in Figure 4.3. 0.05 0.04 Abs 0.03 0.02 0.01 0 -0.01 350 400 450 500 550 -0.02 nm Figure 4.3. CO difference spectra of CFEs of E. coli (P450pyr): (() non-induced; (---) induced with IPTG for 3 h. 4.3.2 Biohydroxylation of N-benzyl pyrrolidine-2-one 1 and Nbenzyloxycarbonyl pyrrolidine 3 with E. coli (P450pyr) During cell growth shown in Figure 4.1, the specific hydroxylation activity of cells at different time points was measured by taking cell culture and harvesting cells, resuspending cells to 1.5 g cdw/L in potassium phosphate 98 (KP) buffer containing 2% glucose and 2 mM N-benzyl pyrrolidine-2-one 1 or N-benzyloxycarbonyl pyrrolidine 3, incubating at 30 ºC for 30 min, and finally analyzing the formation of 2 or 4 by HPLC. As shown in Figure 4.1, the highest specific hydroxylation activity was 3.8 U/g cdw for substrate 1 and 9.9 U/g cdw for substrate 3, both with cells taken at 5 h. At this time point, cell growth reached late exponential phase. The high hydroxylation activities of E. coli (P450pyr) demonstrated that the cloned and expressed P450pyr in the recombinant was catalytically functional. These activities are nearly as high as those achieved with wild-type Sphingomonas sp. HXN-200 grown on n-octane vapor,66 and the cells of the recombinant was much more easily and economically prepared than the wild-type strain. Moreover, the specific hydroxylation activities are also outstanding in comparison with other wellknown recombinant P450: P. Putida GPo12 (pGEc47!B) (pCom8-PFR1500) showed 3 U/g cdw for the hydroxylation of L-limonene,193 while E. coli JM103 (pUC13 BM3-1)194 and E. coli BL21 (DE3) (pETDuet- P450cam/Pdx)(pACYCDuet-PdR/GLD)195 gave 2.4 U/g cdw and 0.05 U/g cdw for the hydroxylation of myristate and camphor, respectively, calculated with the reported data. OH HO O N CH2Ph 1 E. coli (P450pyr) E. coli (P450pyr) O N CH2Ph (S)-2 99% ee N CO2CH2Ph 3 N CO2CH2Ph (R)-4 75% ee Crystalization: 98% ee Scheme 4.1 Biohydroxylation of N-benzyl pyrrolidine-2-one 1 and N-benzyloxycarbonyl pyrrolidine 3 with E. coli (P450pyr). 99 The biohydroxylation of 1 with the recombinant E. coli strain was examined at different pH and temperature. pH of 8.0 and 25 ºC were found to be the optimum, giving biohydroxylation activity of 4.1 U/g cdw. Table 4.1. Kinetic constants of hydroxylation of 1 and 3 with CFE and resting cells of E. coli (P450pyr), respectively Biohydroxylation a) Biocat. (g prot L-1) or (g cdw L1 b) ) K m, Vmax, app app ()mol/min-1 g(mM) 1 c) ) Vmax/Km, app ()mol min-1g-1 mM1 c) ) CFE 2.5 11 4.4 1.5 b) Cells From 1 to 2 2.7 5.1 1.9 1.5 c) CFE From 3 to 4 0.99 19 19 1.5 b) Cells From 3 to 4 1.1 11 10 1.5 c) a) Biohydroxylation was performed with 0.2 to 5.0 mM substrate (1 or 3), 2% (w/v) glucose, 5 mM NADH, and 1.5 g protein/L CFE or 1.5 g cdw/L cell suspension in 1 mL KP buffer (50 mM; pH 8.0) at 25 ºC for 15 min, and product formation was determined by HPLC. b) g protein/L for CFE. c) g cdw/L for resting cell suspension. From 1 to 2 The kinetics of biohydroxylation of pyrrolidine-2-one 1 and pyrrolidine 3 with resting cells and CFE of E. coli (P450pyr) was investigated, respectively. A set of activity assays were performed with substrate 1 and 3 at different concentrations in the CFE (1.5 g protein/L) or cell suspensions (1.5 g cdw/L) in KP buffer (50 mM; pH = 8.0) containing glucose (2%, w/v) at 25 ºC for 15 min. The initial velocities at different substrate concentration were used to give the plot of 1/[v] vs. 1/[S],171 and the apparent Km and apparent Vmax were obtained from the plot. The kinetic data were summarized in Table 4.1. For either substrate, the apparent Km for CFE was nearly the same as that for resting cells, suggesting that there are nearly no barrier for substrate 1 or 3 to cross the cell membrane. Since 1 g cdw contains ca. 0.5 g protein, the apparent Vmax based on the protein amount for resting cells is nearly the same as that for 100 CFE for either hydroxylation. Thus, resting cells showed nearly the same catalytic efficiency as CFE for these hydroxylations. The catalytic efficiency (Vmax/Km) of hydroxylation of pyrrolidine 3 is about 5 times higher than that for the hydroxylation of pyrrolidin-2-one 1, with either resting cells or CFE as catalysts. This was the result of the lower Km and higher Vmax values of substrate 3. 4.3.3 Preparation of (S)-N-benzyl-4-hydroxy-pyrrolidin-2-one 2 by biohydroxylation of N-benzyl pyrrolidine-2-one 1 with E. coli (P450pyr) To explore the potential of using E. coli (P450pyr) for the production of (S)-Nbenzyl-4-hydroxy-pyrrolidin-2-one 2, a set of reactions were performed at 25 ºC for 25 h with N-benzyl pyrrolidine-2-one 1 as substrate at different concentrations and resting cells as biocatalyst (5 g cdw/L) in KP buffer (50 mM; pH 8.0) containing glucose (2%, w/v). Since the apparent Km of the recombinant whole cells for N-benzyl pyrrolidine-2-one 1 was 2.7 mM, 5.0 mM and higher substrate concentrations were tested for the hydroxylation. As shown in Figure 4.4, the reaction rate was high within the first 3 h and decreased afterwards for initial substrate concentration of 5 mM. This is possibly due to the relatively low substrate concentration in the biotransformation mixture after 3 h. Increase of the initial substrate concentration to 10, 15, 20, and 25 M led to longer initial period for fast conversion and higher final product concentration, In the case of using 15, 20, and 25 mM substrates, the reaction rates at the first 6 h were nearly the same, since these concentration are much higher than the apparent Km. Afterwards, 101 the biohydroxylation of 25 mM substrate still showed good reaction rate from 6 h to 21 h, giving (S)-2 in 10.8 mM at 25 h. This is a 2.6 times increase of product concentration comparing with the use of wild-type strain (4.08 mM).66 These results demonstrated also that the recombinant P450pyr monooxygenase in E. coli cells is relatively stable, keeps activity for a relatively long period, and can survive from high concentration of substrate and product. The conversions in these examples amounted to 76%-43%. Nevertheless, higher conversion could be achieved by adding smaller portions of substrate at different reaction time points instead of adding much more substrate at the beginning of biohydroxylation. Currently, we are also investigating the use of liquid-liquid biphasic system as well as growing cells as catalyst to further improve the productivity for biohydroxylation of N-benzyl pyrrolidine-2-one 1. 12 (S)-2 conc. (mM) 10 8 6 4 2 0 0 5 10 15 20 25 T ime (h) Figure 4.4. Time course of the formation of (S)-N-benzyl-4-hydroxy-pyrrolidin-2-one 2 in biohydroxylation of N-benzyl pyrrolidine-2-one 1 with resting cells of E. coli (P450pyr) (5 g cdw/L) in KP buffer (50 mM; pH 8.0) containing glucose (2%, w/v) at 25 ºC and at different substrate concentrations. 5 mM ("); 10 mM (%); 15 mM (-); 20 mM ($); 25 mM (△). 102 4.3.4 Regio- and stereo-selective allylic biohydroxylation of (-)-!-pinene 5 to (1R)-trans-pinocarveol 6 with E. coli (P450pyr) OH E. coli (P450pyr) 5 6 Scheme 4.2 Regio- and stereo-selective allylic biohydroxylation of (-)-!-pinene 5 to (1R)trans-pinocarveol 6 with E. coli (P450pyr). Pinocarveol is a metabolite of !-pinene and is widely used in fragrance and flavour industry.196 It is produced by the isolation from essence oils of natural sources, but its availability is rather limited. Therefore, the development of chemical and enzymatic methods to produce pinocarveol from easily available and low-price !-pinene has drawn increasing attention. As chemical methods often produce mixtures of different products, the development of green and selective enzymatic method is desirable since it may produce pinocarveol in high purity and natural identical form. Thus far, only two biocatalytic systems have been reported to directly hydroxylate !-pinene into pinocarveol.197,198 The better result was achieved by biotransformation of (-)-!-pinene 5 with a Picea abies suspension culture to give (1R)-trans-pinocarveol 6. However, the product concentration was very low and the reaction is slow and not clean: only 0.32 mg 6 was formed, together with other products, in 100 mL plant culture suspension after 8 days.198 The recombinant E. coli (P450pyr) turned out to be a good biocatalyst for the biohydroxylation of !-pinene 5 to (1R)-trans-pinocarveol 6 with much higher productivity. Since !-pinene 5 is a volatile compound, the biotransformation 103 Table 4.2. Regio- and stereo-selective hydroxylation of (-)-!-pinene 5 with E. coli (P450pyr) to (1R)-trans-pinocarveol 6 Entrya) Sub 5 conc. Cell density Prod 6 at 5 h (mM) (g cdw/L) Conc. (mM) Conv. (%) 1 5.0 5.0 3.4 68 2 10 5.0 2.9 29 3 5.0 10 4.1 82 a) Biotransformation was performed with substrate 5 in cell suspension of E. coli (P450pyr) in 10 mL KP buffer (50 mM; pH = 8.0) containing glucose (2%, w/v) at 300 rpm and 25 ºC for 5 h. Figure 4.5. GC chromatograms of samples taken from biohydroxylation of (-)-!-pinene 5 (5 mM) in 10 mL cell suspension (10 g cdw/L) in KP buffer (50 mM; pH 8.0) containing glucose (2%, w/v) at 300 rpm and 25 ºC . A) 0 min; B) 5 h. of 5 with resting cells of E. coli (P450pyr) was carried out in shaking flask with glass stopper and sealed by parafilm without taking samples during the reaction. Parallel experiments were performed with several flasks and stopped at different time points. As shown in Table 4.2, hydroxylation of 5 mM !-pinene 5 with 5 g cdw/L of resting cells gave 3.4 mM of (1R)-trans-pinocarveol 6 at 5 h, and the specific hydroxylation activity was 5.3 U/g cdw within the first 30 min. Further increase the substrate concentration to 10 mM did not increase the final product concentration. Instead, better result was achieved by incubating 5 mM substrate in a cell suspension of 10 g 104 cdw/L. 4.1 mM trans-pinocarveol 6 was formed within 5 h, with a yield of 82%. This product concentration is over 200 times higher than that obtained with the best biocatalyst system known thus far.198 As shown in Figure 4.5, there is only one product peak at 12.6 min in the GC chromatogram for the sample taken at 5 h. This result demonstrated clean biohydroxylation of !-pinene 5. E. coli (P450pyr) is thus definitely much better than any other known catalysts for the biohydroxylation of pinene to trans-pinocarveol, regarding the high yield, high product concentration, and clean reaction. 4.3.5 Stereoselective biohydroxylation of norbornane 7 to exo- norbornaneol 8 with E. coli (P450pyr) E. coli (P450pyr) 7 OH 8 Scheme 4.3 Stereoselective biohydroxylation of norbornane 7 to exo-norbornaneol 8 with E. coli (P450pyr). Both endo- and exo-norbornaneol are high-value compounds. While the former is a key synthon for the preparation of novel cannabionoid analogs199 and potassium-channel openers,200 the latter serves as an intermediate for the production of A1 adenosine receptor agonists.201 The synthesis of norbornaneol has been widely studied in recent years,202-206 mainly via the reduction of 2-norbornanone.202-206 Only iron (###) porphyrin207 and a purified liver P450208 were reported with the possibility of direct hydroxylation of the cheaper norbornane 7 into norbornaneol, but giving mixtures of endo- and exo-norbornaneol and norbornanone. 105 We examined the potential of biohydroxylation of norbornane 7 with E. coli (P450pyr). Here again, the biotransformation was performed with resting cells in closed system with several parallel shaking flasks. As shown in Table 4.3 (entry 1), 1.2 mM exo-norbornaneol 8 was formed within 5 h by incubating 5 mM norbornane 7 in a cell suspension of 5 g cdw/L, with an exo/endoselectivity of 95%. When increasing the cell density to 10 g cdw/L (entry 5), 1.6 mM exo-norbornaneol 8 was obtained with an exo/endo-selectivity of 95%. Increasing initial substrate concentration resulted in increase of catalytic activity and final product concentration: biohydroxylation of 60 mM 7 (entry 4) gave a specific activity within the first 30 min of 6.0 U/g cdw and final product concentration of 3.2 mM at 5 h. Once again, E. coli (P450pyr) is a much better catalyst than any other known catalytic systems for the hydroxylation of norbornane 7 to norbornaneol 8, with very good exo/endoselectivity. 4.3.6 Regioselective hydroxylation of tetralin 9 and 11 with E. coli (P450pyr) to 2- tetralol 10 and 12, respectively 2-Tetralols 10 and 12 are useful synthetic intermediates. For instance, they can be used to prepare pharmacologically active 2-aminotetralins which show affinity to the melatonin receptor.209 Several synthetic routes have been developed via the reduction of 2-tetralone210-212 or cyclialkylation of arylalkyl epoxide.213 However, no direct hydroxylation of the easily accessible and much cheaper tetralins has been reported for the preparation of 2-tetralols, either by chemical or enzymatic methods. 106 OH E. coli (P450pyr) 10 9 MeO E. coli (P450pyr) MeO OH 12 11 Scheme 4.4 Regioselective hydroxylation of tetralin 9 and 11 with E. coli (P450pyr) to 2tetralol 10 and 12. Table 4.3. Selective biohydroxylation of norbornane 7, tetralin 9, and 6-methoxy-tetralin 11 with E. coli (P450pyr) Entry a) Sub. Sub. Conc. Cell density Prod. Prod. Conc. at 5h (mM) ( g cdw/L) (mM) Conv. at 5h (%) Hydroxylation selectivity (%) 1 7 5.0 5.0 8 1.2 24 95b) 2 7 10 5.0 8 1.9 19 95b) 3 7 20 5.0 8 3.0 15 95b) 4 7 5.0 10 8 1.6 32 95b) 5 9 5.0 5.0 10 1.1 22 84c) 6 9 10 5.0 10 1.0 10 83c) 7 9 5.0 10 10 1.7 34 84c) 8 11 5.0 5.0 12 1.2 24 83d) 9 11 10 5.0 12 1.2 12 84d) 10 11 5.0 10 12 2.1 42 83d) a) Biotransformation was performed with substrate 7, 9 or 11 in cell suspension of E. coli (P450pyr) in 10 mL KP buffer (50 mM; pH = 8.0) containing glucose (2%, w/v) at 300 rpm and 25 ºC for 5 h. b) The exo/endo selectivity was determined with 5 h sample. c) The 2-tetralol/1-tetralol selectivity was determined with 5 h sample. d) The 7-methoxy-2-tetralol/6-methoxy-2-tetralol selectivity was determined with 5 h sample. The recombinant E. coli (P450pyr) was explored for such type of hydroxylation. Biohydroxylation of tetralin 9 and 6-methoxy-tetralin 11 showed very special regio-selectivity at the non-activated carbon atoms. As shown in Table 4.3 (entry 6 to 11), 2-tetralols were formed as the major product with 83-84% regioselectivity and specific hydroxylation activity of 107 5.1 U/g cdw and 7.3 U/g cdw for 2-tetralols 10 and 12, respectively. Hydroxylation of 5 mM substrate 9 at the cell density of 10 g cdw/L gave 2tetralol 10 in 1.7 mM at 5 h. 2.1 mM 7-methoxy-2 tetralol 12 was formed within 5 h by hydroxylation of 5 mM substrate 11 in a cell suspension of 10 g cdw/L. In all the cases, no ketone was formed according to GC analysis. The identification of bioproduct 10 was straightforward by comparing its retention time in GC chromatogram with that of the commercially available standard 10. On the other hand, the identification of bioproduct from biohydroxylation of 6-methoxy-tetralin 11 was difficult, since the desired product 7-methoxy-2tetralol 12 is not commercially available, and the hydroxylation may create theoretically four different regioisomers. Fortunately, all other three regioisomers are available, and they have different retention time in GC analysis: 21.1 min for 7-methoxy-1-tetralol, 22.5 min for 6-methoxy-1-tetralol, and 22.8 min for 6-methoxy-2-tetralol, respectively. The bioproduct from biohydroxylation of 11 has a retention time of 21.3 min, which is different from those of the three known isomers, thus it is a different compound. In addition, GC-MS analysis of the bioproduct showed a M of 178, corresponding to the mass of a hydroxylated 6-methoxy-tetralin. Therefore, the structure of the bioproduct was deduced to be 7-methoxy-2-tetralol 12. Although the product concentrations and conversions of these biohydroxylations are relatively low, our results represent the first example of hydroxylation of tetralins on the non-activated carbon atoms at 2-position. Further improvement of the productivity of P450pyr for these hydroxylations might be achieved by protein engineering as well as process engineering. 108 4.4 Summary and Conclusions We have engineered a recombinant E. coli expressing cytochrome P450pyr monooxygenase from Sphingomonas sp. HXN-200, with specific activity of 4.1 U/g cdw and 9.9 U/g cdw for the hydroxylation of N-benzyl pyrrolidine-2one and N-benzyloxycarbonyl pyrrolidine, respectively. E. coli (P450pyr) does not require n-octane as the growth substrate, demonstrates the similar high hydroxylation activity as the wild-type strain, and shows no side reaction. Biohydroxylation of N-benzyl pyrrolidine-2-one with resting cells of E. coli (P450pyr) gave 10.8 mM (S)-N-benzyl-4-hydroxy-pyrrolidin-2-one, a 2.6-fold increase of the product concentration comparing with the wild-type strain. Moreover, hydroxylation of (-)-!-pinene with E. coli (P450pyr) cells showed excellent regio- and stereo-selectivity and gave (1R)- trans-pinocarveol in 82% yield and 4.1 mM, being over 200 times higher than that obtained with the best biocatalysts known thus far. E. coli (P450pyr) was also able to hydroxylate other types of substrates with unique selectivity: biohydroxylation of norbornane gave exo-norbornaeol with exo/endo-selectivity of 95%; tetralin and 6-methoxy-tetralin were hydroxylated, for the first time, at the nonactivated 2-position with regioselectivities of 83-84%. 109 CHAPTER 5 GREEN AND SELECTIVE TRANSFORMATION OF METHYLENE TO KETONE VIA TANDEM BIOOXIDATIONS IN ONE POT 110 5.1 Introduction Tandem biocatalysis with multiple biocatalysts in one pot enables multi-step sequential reactions in the same mild conditions, thus avoiding the timeconsuming, yield-decreasing, and waste-producing isolation and purification of intermediates.150,151,214-216 In the past two decades, the development of tandem biocatalysis is regarded as an important direction for sustainable chemical and pharmaceutical synthesis.45-53 In nature, it is quite common that microbial cells containing multiple enzymes can uptake and metabolize nature compound via sequential bioconversions54-59. However, it is not easy to find and array appropriate multiple biocatalysts to carry out sequential biocatalysis with non-natural substance to achieve full conversion. To date, only scarce examples have been reported for sequential transformations with tandem biocatalysis in organic synthesis. One type of tandem biocatalysis is sequential oxidation-reduction for deracemization of secondary alcohol60,61 or !-hydroxy acid62 with oxidase and reductase; another one is sequential oxidationhydrolysis for asymmetric dihydroxylation of aryl olefins with styrene monooxygenase and epoxide hydrolase.70 H R1 H O Monooxygenase/O2 R2 Alcohol dehydrogenase NAD(P)+ Acetone Monooxygenase O2 HO H R1 R2 R1 R2 Alcohol dehydrogenase NAD(P)+ OH NAD(P)H O Scheme 5.1 Selective sequential oxidations of methylene group into ketone via tandem biocatalysis with cofactor recycling in one pot. 111 Selective oxidation of methylene group (C-H bonds) into ketone is a useful synthetic method to generate many crucial chemical and pharmaceutical compounds. However, methylene groups, abundant in chemical structures, are the most challenging chemical groups to be selectively functionalized, since they are inert to most chemical reagents. Although many transition metal catalysts (Co, Ru, Cu, Pd, Mn, W,)68-77 and few other catalysts78,79 were reported to catalyze selectiveconversion of aryl and allylic secondary C-H into C=O, all of them gave a mixture of product with substrate, alcohol,71,78 acid,71,78 or other ketone byproducts due to the low regioselectivity.70,72-77 Moreover, those processes also suffered from the use of large amount of organic reagent,76,79 toxic metal catalyst,70-76 high temperature,70,71,75,78 increased pressure,71,78 low conversion75,77,78. Furthermore, it has thus far remained impossible to oxidize non-activated C-H into C=O with high selectivity.80-83 Some microorganisms were able to transform methylene group of non-natural compounds into ketone via secondary. However, the yield and activity were low, the reaction time was long, and the product was a mixture of alcohol, ketone and unreacted substrate.217-222 Here, we aim to develop novel tandem biocatalysis as the first example for selective sequential oxidations of methylene group into ketone by the use of a monooxygenase and an alcohol dehydrogenase (ADH) in one pot (Scheme 5.1). The suitable biocatalysts for each step were selected from different microorganisms and arrayed in an appropriate ratio for efficient tandem catalysis, leading to the practical synthesis of useful ketone directly from low-cost hydrocarbon. 112 5.2 Experimental Section 5.2.1 Chemicals Tetralin 1a (> 99%), (R)-1-tetralol 2a (> 97%), (S)-1-tetralol 2a (> 97%), 1tetralone 3a (> 99%), indan 1b (> 99%), (R)-1-indanol 2b (! 99%), (S)-1indanol 2b (! 99%), 1-indanone 3b (! 99%), 1-benzyl-4-hydroxy-piperidine 5 (96%), 1-benzyl-4-piperidone 6 (99%), ampicillin (> 99%), kanamycin solution (50 mg/ml), NAD+ (> 99%), NADH (> 99%), NADP+ (> 99%) and NADPH (> 99%) were purchased from Sigma-Aldrich. Isopropyl "-Dthiogalactopyranoside (ITPG, > 99%) was bought from 1st BASE. Tryptone and yeast extract were purchased from Biomed Diagnostics. N-benzylpeperidine 4 was prepared according to the published procedures with 59.5% yield and >99.8% purity (GC).160 5.2.2 Biocatalysts LKADH (~0.4 units/mg) was purchased from Sigma-Aldrich. Pseudomonas monteilii TA-5,89 E. coli BL21 (DE3) - pRSFDuet P450pyr - pETDuet Fdx FdR1500221, and E. coli pET28a histag-RDR161 were obtained from the collections of our laboratories. 113 5.2.3 Analytical methods The concentrations of tetralin 1a , (R)-1-tetralol 2a, (S)-1-tetralol 2a, 1tetralone 3a, indan 1b, (R)-1-indanol 2b, (S)-1-indanol 2b, 1-indanone 3b, and ee values of 1-tetralol 2a, 1-indanol 2b were analyzed by Shimadzu Prominence HPLC on a Chiralcel OB-H column (150 mm " 2.1 mm) at 25 ºC. UV detection: 210 nm; eluent: n-hexane/2-propanol (95:5); flow rate: 1 ml/min; retention time: 3.8 min for tetralin 1a, 4.1 min for indan 1b, 7.3 min for (R)-1-tetralol 2a, 8.6 min for (R)-1-indanol 2b, 11.1 min for (S)-1-tetralol 2a, 11.7 min for benzyl alcohol, 13.3 min for 1-tetralone 3a, 13.6 min for (S)1-indanol 2b, and 20.5 min for 1-indanone 3b. The concentrations of N-benzyl-piperidine 4, 1-benzyl-4-hydroxy-piperidine 5 and 1-benzyl-4-piperidone 6 were analyzed by Shimadzu Prominence HPLC on a ZORBAX Eclipse plus C18 column (150 mm " 4.6 mm) at 25 ºC. UV detection: 210 nm; eluent: acetonitrile/10 mM KP buffer pH 7.7 (20:80); flow rate: 1 ml/min; retention time: 5.8 min for 1-benzyl-4-hydroxy-piperidine 5, 10.0 min for 1-phenylethanol as internal standard, 18.6 min for N-benzylpiperidine 4, and 27.5 min for 1-benzyl-piperidon 6. 5.2.4 Cultivation of microorganisms Pseudomonas monteilii TA-5 was inoculated on M9 agar plate containing trace element, and grown at room temperature for 2 days with toluene vapor as carbon source. A single colony from the M9 agar plate was inoculated into 10 mL of LB medium, and the cells were grown at 300 rpm and 30 ºC for 7 h. 2 114 mL of the above preculture was added in 100 ml M9 medium containing trace element in a 250 mL shaking flask with ventilated plastic stopper. 15 mL plastic tube with length of 9 cm containing 1 mL toluene was put into the flask, and the vapor of toluene was used as carbon source. The mixture was incubated at 250 rpm and 30 ºC for 18 h. Then the cells were harvested by centrifugation at 10,375 g for 10 min and the cells were directly used for biotransformation.89 E. coli BL21 (DE3) - pRSFDuet P450pyr - pETDuet Fdx FdR1500 was inoculated on LB agar plate containing ampicillin (100 #g/mL) and kanamycin (50 ug/mL), and grown overnight at 37 ºC. A single colony from the LB agar plate was inoculated into 10 mL of LB medium with ampicillin (100 #g/mL) and kanamycin (50 ug/mL), and the cells were grown at 300 rpm and 37 ºC for 12 h. 2 mL of the above preculture was added in 100 mL LB medium containing ampicillin (100 #g/mL) and kanamycin (50 ug/mL), and the mixture was shaken at 300 rpm and 37 ºC. IPTG (0.5 mM) was added when OD600 reached around 0.8~1.0 at 2 h, and then the mixture was shifted to 300 rpm, 30 ºC, and shaken for another 3 h. Then the cells were harvested by centrifugation at 10,375 g for 10 min and the cells were directly used for biotransformation. E. coli pET28a histag-RDR was inoculated on LB agar plate containing kanamycin (50 ug/mL), and grown overnight at 37 ºC. A single colony from the LB agar plate was inoculated into 10 mL of LB medium with kanamycin (50 ug/mL), and the cells were grown at 250 rpm and 37 ºC for 12 h. 1 mL of the above preculture was added in 100 mL TB medium (12 g Bacto tryptone, 24 g Bacto yeast extract, 4 mL glycerol, KH2PO4 2.3 g, K2HPO4 12.54 g in 1 115 liter deionized water) containing kanamycin (50 ug/mL), and the mixture was shaken at 250 rpm and 37 ºC. IPTG (0.25 mM) was added when OD600 reached around 0.6~0.8 at 2 h, and then the mixture was shifted to 250 rpm, 25 ºC, and shaken for another 16~20 h. Then the cells were harvested by centrifugation at 10,375 g for 10 min and the cells were directly used for biotransformation or enzyme purification. 5.2.5 Purification of histag-RDR The above freshly harvested E. coli pET28a histag-RDR cells were resuspended in 10 mM imidazole buffer to a cell density of 20 g cdw/L, and passed through a homogenizer twice (Constant cell disruption system) at 20 kpsi. The cell debris was removed by centrifugation at 14,000 g for 30 minutes. The supernatant (i.e., lysate) was reserved for further purification. The above cell lysate was filtrated through 0.2 #M membrane filter. 5 mL (6 g protein/L) cell lysate was incubated with 0.5 mL Ni-NTA at 4 ºC for 1 h. The incubated mixture was loaded to column and filtrated. Droplets were collected. The column was washed with 10 mM (10 mL), 20 mM (10 mL), 30 mM (10 mL), 50 mM (0.5mL) imidazole buffer; and then eluted with 250 mM imidazole buffer 5 " 0.5 mL. All filtrates were separately collected. The protein concentration of each fraction was determined by Bradford protein content assay170 with bovine serum albumin (BSA) as standard. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) was performed by loading on a gel containing 0.1% SDS and 12% acrylamide, staining the gel with a 0.1% solution of Coomassie brilliant blue R-250 in 116 methanol-acetic acid-water (4:1:5, vol/vol/vol), and destaining the gel by soaking it in deionized water overnight (Figure 5.1). 250 148 98 64 50 36 RDR (28 KDa) (28kDa) 25 16 KD Marker a r 1 2 3 4 5 6 7 8 9 Figure 5.1. SDS-PAGE of cell lysate (lane 1); loading filtrate (lane 2); 10 mM imidazole buffer wash sample (lane 3); 50 mM imidazole buffer wash sample (lane 4); 250 mM imidazole buffer wash fraction one (lane 5); 250 mM imidazole buffer wash fraction two (lane 6); 250 mM imidazole buffer wash fraction three (lane 7); 250 mM imidazole buffer wash fraction four (lane 8); 250 mM imidazole buffer wash fraction five (lane 9). The five fractions of 250 mM imidazole buffer wash were collect together, exchanged with potassium phosphate (KP) buffer (100 mM; pH = 8.0), and directly used for biotransformation. 5.2.6 Selective hydroxylation of tetralin 1a and indan 1b with P. monteilli TA-5 To 990 #l 1.5 g/L P. monteilii TA-5 cell suspension in Tris-HCl buffer (100 mM; pH = 7.0) was added 2 mM (10 #l 0.2 M stock solution in methanol) 1a. The mixture was shaken at 1000 rpm and 30 ºC for 15 min on benchtop thermomixer. At 15 min, 1 mL ethyl acetate containing 1 mM benzyl alcohol 117 was added and mixed. The organic phase was separated after centrifugation, dried over anhydrous Na2SO4, and followed by the analysis of normal phase HPLC. To 990 #l 1.5 g/L P. monteilii TA-5 cell suspension in Tris-HCl buffer (100 mM; pH = 7.0) was added 2 mM (10 #l 0.2 M stock solution in methanol) 1b. The mixture was shaken at 1000 rpm and 30 ºC for 15 min on benchtop thermomixer. At 15 min, 1 mL ethyl acetate containing 1 mM benzyl alcohol was added and mixed. The organic phase was separated after centrifugation, dried over anhydrous Na2SO4, and followed by the analysis of normal phase HPLC. 5.2.7 Oxidation of (R)-1-tetralin 2a and (R)-1-indan 2b with LKADH To 980 #l Tris-HCl buffer (100 mM; pH = 7.0) was added 4 mM (R)-2a, 4 mM (20 #l 0.2 M stock solution in deionized water) NADP+ and 2 mg LKADH. The mixture was shaken at 1000 rpm and 30 ºC for 15 min on benchtop thermomixer. At 15 min, 1 mL ethyl acetate containing 1 mM benzyl alcohol was added and mixed. The organic phase was separated after centrifugation, dried over anhydrous Na2SO4, and followed by the analysis of normal phase HPLC. To 980 #l Tris-HCl buffer (100 mM; pH = 7.0) was added 4 mM (R)-2b, 4 mM (20 #l 0.2 M stock solution in deionized water) NADP+ and 2 mg LKADH. The mixture was shaken at 1000 rpm and 30 ºC for 15 min on benchtop thermomixer. At 15 min, 1 mL ethyl acetate containing 1 mM benzyl alcohol was added and mixed. The organic phase was separated after 118 centrifugation, dried over anhydrous Na2SO4, and followed by the analysis of normal phase HPLC. 5.2.8 Reduction of acetone to iso-propanol with NADPH as cofactor To 2.975 mL Tris-HCl buffer (100 mM; pH = 7.0) was added 10 mM acetone, 1 mM (15 #l 0.2 M stock solution in deionized water) NADPH, and 1 mg LKADH. The decrease of NADH was monitored by determining the UV absorption at 340 nm at 30 °C, and the concentration was calculated by using a $340 of 6.22 liters mmol-1. The specific activity was expressed in units/g protein, and 1 U was defined as the decrease of 1 #mol NADPH/min. 5.2.9 Selective hydroxylation of N-benzyl-piperidine 4 with E. coli (P450pyr) To 950 #l 1.5 g/L cell suspension in KP buffer (100 mM; pH = 8.0) was added 2% (w/v) glucose (40 #l 50% stock solution) and 2 mM (10 #l 0.2 M stock solution in methanol) 4. The mixtures were shaken at 1000 rpm and 30 ºC for 15 min on benchtop thermomixer. At 15 min, 1 mL methanol with 2 mM 1phenylethanol was added, mixed, centrifuged, and the supernatant was taken and analyzed by reverse phase HPLC. 5.2.10 Oxidation of 1-benzyl-4-hydroxy-piperidine 5 with RDR To 980 #l 0.2 g protein/L solution in KP buffer (100 mM; pH = 8.0) was added 2 mM (10 #l 0.2 M stock solution in methanol) 5 and 2 mM (10 #l 0.2 119 M stock solution in deionized water) NAD+. The mixtures were shaken at 1000 rpm and 30 ºC for 15 min on benchtop thermomixer. At 15 min, 1 mL methanol with 2 mM 1-phenylethanol was added, mixed, centrifuged, and the supernatant was taken and analyzed by reverse phase HPLC. 5.2.11 Reduction of acetone to iso-propanol with NADH as cofactor To 2.975 mL 0.2 g protein/L solution in KP buffer (100 mM; pH = 8.0) was added 10 mM acetone, and 1 mM (15 #l 0.2 M stock solution in deionized water) NADH. The decrease of NADH was monitored by determining the UV absorption at 340 nm at 30 °C, and the concentration was calculated by using a $340 of 6.22 liters mmol-1. The specific activity was expressed in units/g protein, and 1 U was defined as the decrease of 1 #mol NADH/min. 5.2.12 Typical procedure for selective sequential oxidations of tetralin 1a to 1-tetralone 3a via tandem biocatalysis with NADP+ recycling in one pot To 5 mL P. monteilii TA-5 cell suspension (10 g cdw/L) in Tris-HCl buffer (100 mM; pH 7.0) was added 3 g protein/L (15 mg) LKADH, 0.002 mM NADP+ (5 #l 0.002 M stock solution), 0.5% (v/v, 25 #l) acetone, 1 mM MgCl2 (50 #l 0.1 M stock solution), and 6 mM (4.0 mg, 0.03 mmol) tetralin 1a. The mixture was shaken at 250 rpm and 30 ºC. At 2 h, cell pellets (24 mg cdw) of P. monteilii TA-5 were directly added to reaction system. Aliquots (100 #l) were taken out at different time points and mixed with 100 #l ethyl acetate containing 1 mM benzyl alcohol as internal standard. The cells were removed 120 by centrifugation, and organic phase was separated and dried over anhydrous Na2SO4. The samples were analyzed by normal phase HPLC. 5.2.13 Typical procedure for selective sequential oxidations of tetralin 1a and indan 1b to 1-tetralone 3a and 1-indanone 3b via tandem biocatalysis with NADP+ recycling in one pot To 5 mL P. monteilii TA-5 cell suspension (10 g cdw/L) in Tris-HCl buffer (100 mM; pH 7.0) was added 3 g protein/L (15 mg) LKADH, 0.002 mM NADP+ (5 #l 0.002 M stock solution), 0.5% (v/v, 25 #l) acetone, 1 mM MgCl2 (50 #l 0.1 M stock solution), and 6 mM (3.9 mg, 0.03 mmol) indan 1b. The mixture was shaken at 250 rpm and 30 ºC. At 2 h, cell pellets (24 mg cdw) of P. monteilii TA-5 were directly added to reaction system. Aliquots (100 #l) were taken out at different time points and mixed with 100 #l ethyl acetate containing 1 mM benzyl alcohol as internal standard. The cells were removed by centrifugation, and organic phase was separated and dried over anhydrous Na2SO4. The samples were analyzed by normal phase HPLC. 5.2.14 Typical procedure for selective sequential oxidations of N-benzylpiperidine 4 to 1-benzyl-4-piperidone 6 via tandem biocatalysis with NAD+ recycling in one pot To 5 mL E. coli BL21 (DE3) - pRSFDuet P450pyr - pETDuet Fdx FdR1500 cell suspension (10 g cdw/L) in KP buffer (100 mM; pH 8.0) was added 4 g protein/L purified histag-RDR, 0.002 mM NAD+ (5 #l 0.002 M stock solution), 121 0.5% (v/v, 25 #l) acetone, 0.5 % (w/v, 50 #l 50% stock solution), and 5 mM (4.4 mg, 0.025 mmol) N-benzyl-piperidine 4. The mixture was shaken at 250 rpm and 30 ºC. Aliquots (100 #l) were taken out at different time points and mixed with 100 #l methanol containing 2 mM 1-phenylethanol as internal standard. The cells were removed by centrifugation. The samples were analyzed by reverse phase HPLC. 5.3 Results and Discussion 5.3.1 Tandem biocatalysts system for the selective sequential oxidations of tetralin 1a to 1-tetralone 3a with NADP+ recycling To prove the novel concept of combining a monooxygenase and an ADH for tandem oxidations, the transformation of tetralin 1a to 1-tetralone 3a via 1tetralol 2a was chosen as model reaction (Scheme 5.2). 1-tetralone 3a is an important pharmaceutical intermediate to prepare contraceptive 18-methyl norethisterone, antidepressant sertaline, and insecticide carboryl.223,224 All reported syntheses of 1-tetralone 3a from tetralin 1a resulted in a mixture of 3a together with 2a, 1a, 2-tetralone,225 1,4-naphthaquinone,226 1-naphthol,227 naphtahalene227. Moreover, those methods involved the use of large amount of organic reagent,227-229 toxic metal catalyst,221,226,227,230-232 high pressure,221,230 and gave low conversion225,231. Several microorganisms were also reported to catalyze the conversion of tetralin 1a into 1-tetralone 3a, but with a mixture of products in low concentration.155,233,234 In our study, the whole cell of Pseudomonas monteilii TA-5 was chosen as the first-step biocatalyst, since it 122 could selectively hydroxylate tetralin 1a at benzylic position to (R)-1-tetralol with 60% yield and 99% ee.89 The commercially available Lactobacillus kefir alcohol dehydrogenase (LKADH) was selected as the second-step biocatalyst, since it is a versatile ADH accepting a broad variety of substrates.235,236 Meanwhile, excess amount of acetone was supplied as “coupled substrate”8,9,119,123 to regenerate the expensive cofactor NADP+, in order to make the whole process more economical. OH P. monteilii TA-5 O2 n 1a n=2 1b n=1 12 U/g cdw 14 U/g cdw O LKADH n NADP+ recycling (R)-2a n=2 (R)-2b n=1 4.5 U/g protein 3.5 U/g protein n 3a n=2 3b n=1 83-87% yield TTN=4100-4200 Scheme 5.2 Selective sequential oxidations of benzylic C-H into C=O via tandem biocatalysis with NADP+ recycling in one pot. The activity of biocatalyst for each step reactions in the whole tandem biocatalysis was tested at the beginning. Freshly harvested whole cells of P. monteilii TA-5 showed an activity of 12 U/g cdw to hydroxylate tetralin 1a to (R)-2a with 99% regioselectivity. While LKADH oxidized (R)-1-tetralol 2a to 1-tetralone 3a with an activity of 4.5 U/g protein, it also reduced acetone to iso-propanol with a much higher activity (250 U/g protein), thus being beneficial to NADP+ recycling. Possible side reactions were also examined. P. monteilii TA-5 cells oxidized (R)-2a to 3a with an activity of 0.41 U/g cdw, possibly due to the existence of dehydrogenase in the whole cell. This activity is very low compared to that of LKADH. Like most ADH, LKADH also reduced ketone 3a to alcohol 2a with an activity of 0.80 U/g protein, which is much lower than the reduction of acetone. Such reductive activity was 123 successfully annihilated by adding excess amount of acetone (0.5% v/v). We also found that LKADH lost oxidative activity easily in Tris-HCl buffer, and 1 mM MgCl2 was thus added to maintain its activity in the reactions involving LKADH.236 A B A mu C B A D C B A Time (min) Figure 5.2. Selective sequential oxidations of tetralin 1a to 1-tetralone 3a via tandem biocatalysis with NADP+ recycling in one pot. A: 1-tetralone 3a standard, BA is internal standard benzyl alcohol; B: 1 h sample; C: 5 h sample; D: 30 h sample. Reaction conditions: 6 mM 1a, 10+5 g cdw/L TA-5, 3.5 g protein/L LKADH, and 0.001 mM NADP+. In the initial explorative experiments of selective sequential oxidationoxidation, the reaction was performed with 10 g cdw/L of P. monteilii TA-5, 2 g protein/L of LKADH, 6 mM tetralin 1a, 0.002 mM NADP+ and 0.5% (v/v) acetone in 5 ml Tris-HCl buffer (Table 5.1, entry 2). Compared to the control reaction (Table 5.1, entry 1), much more 1-tetralone 3a was produced within 30 h with over 99% regioselectivity and a TTN of 1300 for NADP+ recycling. 124 Table 5.1. Selective sequential oxidations of tetralin 1a and indan 1b to 1-tetralone 3a and 1indanone 3b via tandem biocatalysis with NADP+ recycling in one pot. Entrya Substrate NADP+ Acetone 3b [g/L] [g/L] [mM] [v/v %] [mM] 0.002 0.5 0.80 3.46 2.76 0.12 1.72 1.76 > 99 > 99 13 58 1300 0.5e 3.00 0.25 1.65 > 99 50 1100 0.5 0.5 0.5+0.5 +0.5g 0.5 0.5 0.5 0.5 0.5 0.92 5.06 5.25 3.92 0.16 0 0.36 0 0 > 99 > 99 > 99 15 84 88 2100 2200 5.12 0.15 0 > 99 85 2100 4.07 4.75 4.98 0.98 5.41 5.20 0.53 0.20 0 4.32 0 0 0 0 0 0 0 0 > 99 > 99 > 99 > 99 > 99 > 99 68 79 83 16 90 87 3200 3800 4100 2200 4200 1a 1a 10 10 2 3 1a 10 2e 4 5 6 1a 1a 1a 10+5f 10+5f 10+5f 2 3 0.002e 0.002 0.002 7 1a 10+5f 2 0.002 1a 1a 1a 1b 1b 1b f 2 3 3.5 - 0.001 0.001 0.001 0.002 0.001 10+5 10+5f 10+5f 10+5f 10+5f 10+5f 3 3.5 [mM] 1b Regio- LKADH 1 2 8 9 10 11 12 13 (R)2b TA-5 [mM] selectivityc [%] Yield [%] TTNd a) All reactions were carried out with 6 mM 1 in Tris-HCl (100 mM, pH = 7.0) buffer containing 1 mM MgCl2 at 30 ºC and 250 rpm. b) Concentrations of different compounds in the reaction mixture at 30 h. c) The regioselectivity is referred to the ratio between 1-tetralone 3a to 2-tetralone or the ratio between 1-indanone 3b to 2-indanone. d) The concentration of 3 produced by TA-5 cells alone in control reaction (entry 1, 4 and 11) was deducted in the calculation of TTN. e) LKADH, NADP+ and acetone were added at 2 h instead of at the beginning. f) Additional TA-5 cell pellets were added at 2 h to increase the cell density to 15 g/L. g) Additional acetone was added at 7 h and 20 h, respectively. However, there was still certain amount of 1a and (R)-2a left. Adding LKADH, NADP+ and acetone at later stage did not help to improve the whole conversion (Table 5.1, entry 3). In fact, P. monteilii TA-5 only showed high hydroxylation activity at the first two hours, and the activity dropped quickly afterwards. In order to fully convert 1a to 3a, more P. monteilii TA-5 was added at 2 h which increased the final concentration of 3a to 5.06 mM (Table 5.1, entry 5). Increasing LKADH to 3 g/L gave rise to complete conversion. At 30 h, pure 3a was produced in 5.25 mM with 87.5% yield, 99% regioselectivity, and a TTNof 2200 for NADP+ recycling (Table 5.1, entry 6). To increase TTN, 0.001 mM NADP+ was used to carry out the biotransformation (Table 5.1, entries 8 to 10). As shown in Figure 5.3, when 125 3.5 g/L LKADH was used, the accumulative concentration of 2a reached maximum at 3 h, and the concentration of 3a increased very fast in the first 20 h. At 30 h, pure 3a was produced in 4.98 mM with 83.0% yield, 99% regioselectivity, and a TTN of 4100 for NADP+ recycling (Table 5.1, entry 10). Such high TTN meets the widely accepted cofactor recycling criteria for practical application. This is the first example of utilizing tandem biocatalyst system for selective sequential oxidations with cofactor recycling. 5.3.2 Tandem biocatalysts system for the selective sequential oxidations of indan 1b to 1-indanone 3b with NADP+ recycling Indan 1b with similar chemical structure to tetralin 1a was also examined for the same sequential oxidations (Scheme 5.2). The desired product 1-indanone 3b is an important intermediate in the synthesis of serotonin reuptake inhibitors.237 P.monteilii TA-5 hydroxylated indan 1b to (R)-1-indanol 2b with an activity of 14 U/g cdw, 99% regioselectivity. LKADH oxidized (R)- 6.00 5.00 4.00 3.00 conc./mM 2.00 1.00 0.00 0 5 10 15 20 25 30 t/h Figure 5.3. Time course of selective sequential oxidations of tetralin 1a and indan 1b to 1tetralone 3a and 1-indanone 3b via tandem biocatalysis with NADP+ recycling in one pot. 3a (%), (R)-2a (△), 3b (&) and (R)-2b ('). Reaction conditions: 6 mM 1a or 1b, 10+5 g cdw/L TA-5, 3.5 g protein/L LKADH, and 0.001 mM NADP+. 126 A B mu C D Time (min) Figure 5.4. Selective sequential oxidations of indan 1b to 1-indanone 3b via tandem biocatalysis with NADP+ recycling in one pot. A: 1-tetralone 3b standard, BA is internal standard benzyl alcohol; B: 1 h sample; C: 5 h sample; D: 30 h sample. Reaction conditions: 6 mM 1b, 10+5 g cdw/L TA-5, 3.5 g protein/L LKADH, and 0.001 mM NADP+. 2b to 1-indanone 3b with an activity of 3.5 U/g protein, and could not reduce 3b back to 2b in the presence of excess amount of acetone. Tandem catalyses were carried out in the similar conditions to using tetralin 1a as substrate (Table 5.1, entries 11 to 13). By coupling P. monteilii TA-5 with LKADH, much more 3b was produced than using P. monteilii TA-5 alone. Initially adding 0.002 mM NADP+ led to the preparation of 5.41 mM 3b at 30 h, with 90.2% yield, 99% regioselectivity, and a TTN of 2200 for NADP+ recycling. When lowering the initial NADP+ concentration to 0.001 mM and increasing the amount of LKADH, final TTN was enhanced to 4200. 127 5.3.3 Tandem biocatalysts system for the selective sequential oxidations of N-benzyl-piperidine 4 to 1-benzyl-4-piperidone 6 with NAD+ recycling OH N E. coli (P450pyr) N 8.0 U/g cdw RDR N NAD+ recycling O2 4 O 5 54 U/g protein 6 80% yield TTN=4000 Scheme 5.3 Selective sequential oxidations of non-activated C-H into C=O via tandem biocatalysis with NAD+ recycling in one pot. The novel concept of utilizing tandem biocatalysis for selective sequential oxidations with cofactor recycling was also proved by sequential oxidationoxidation of N-benzyl-piperidine 4 to 1-benzyl-4-piperidone 6 via 1-benzyl-4hydroxy-piperidine 5 with two different biocatalysts (Scheme 5.3). The target compound 6 is an important intermediate for the production of drugs for the treatment of asthma, hypertension or depression.238 So far, 6 is mainly produced from phenylmethanamine and acrylic acid methyl ester through multi-step reactions with low yield.239 In our study, E. coli BL21 (DE3) pRSFDuet P450pyr - pETDuet Fdx FdR1500 [E. coli (P450pyr)] was chosen as the first-step biocatalyst, since the P450pyr was known to selectively hydroxylate the non-active carbon atom of 4 at 4-position.68 E. coli pET28a histag-RDR [E. coli (RDR)] was selected as the second-step biocatalyst, since the RDR could catalyze the conversion between hydroxypiperidine and piperidone.240 At the beginning, we used the whole cells of the two microorganisms for both oxidative reactions with the potential recycling of 128 intracellular cofactor by adding 0.5% (v/v) acetone and 0.5% (w/v) glucose. However, 1-benzyl-4-piperidone 6 was obtained at low concentration. Table 5.2. Selective sequential oxidations of N-benzyl-piperidine 4 to 1-benzyl-4-piperidone 6 via tandem biocatalysis with NAD+ recycling in one pot. Entrya 1 2 3 4 P450pyr RDR NAD+ Acetone 6b 5b 4b Regioselectivityc Yield [g/L] [g/L] [mM] [v/v %] [mM] [mM] [mM] [%] [%] 5 5 10 10 4 4 4 0.002 0.002 0.001 0.5 0.5 0.5 0 3.61 4.28 4.02 4.52 0.12 0 0 0 0.72 0 0 >99 >99 >99 >99 0 72 86 80 TTNd 1800 2100 4000 a) All reactions were carried out with 5 mM 4 in KP (100 mM, pH = 8.0) buffer containing 0.5 % (w/v) glucose at 30 ºC and 250 rpm. b) Concentrations of different compounds in the reaction mixture at 25 h. c) The regioselectivity is referred to the ratio between 1-benzyl-4-piperidone 6 to 1-benzyl-3piperidone or 1-benzyl-2-piperidone. d) The concentration of 6 produced by P450pyr cells alone in control reaction (entry 1) was deducted in the calculation of TTN. A B mu C D Time (min) Figure 5.5. Selective sequential oxidations of N-benzyl-piperidine 4 to 1-benzyl-4-piperidone 6 via tandem biocatalysis with NAD+ recycling in one pot. A: 1-benzyl-4-piperidone 6, PA is internal standard 1-phenylethanol; B: 1 h sample; C: 5 h sample; D: 25 h sample. Reaction conditions: 5 mM N-benzyl-piperidine 4, 10 g cdw/L P450pyr, 4 g protein/L RDR, and 0.001 mM NAD+. 129 Further study found that E. coli (RDR) lost its oxidative activity from 5 to 6 in the presence of trace amount of glucose. There might be glucose dehydrogenase in the cells which also consumes cofactor NAD+, thus inhibiting the oxidation of 5 to 6. This problem was solved by using purified histag-RDR as biocatalyst. Purified histag-RDR oxidized 5 to 6 at an activity of 54 U/g protein, while reducing acetone to iso-propanol at an activity of 480 U/g protein for NAD+ recycling. In the presence of 0.5% (v/v) of acetone, the activity of purified histag-RDR for reducing 6 to 5 was also inhibited. E. coli (P450pyr) hydroxylated N-benzyl-piperidine 4 with an activity of 8.0 U/g cdw, and was not able to further oxidize 1-benzyl-4-hydroxy-piperidine 5 to 1benzyl-4-piperidone 6. Sequential catalyses were carried out in the similar ways as above. At the beginning, 5 g/L cdw of E. coli (P450pyr) was coupled with 4 g protein/L of purified histag-RDR (Table 5.2, entry 2). However, compared with control reaction (Table 5.2, entry 1), the conversion of 4 only reached 85%, which means that purified histag-RDR influenced the hydroxylation activity. 10 g/L of E. coli (P450pyr) were then used. Initially adding 0.002 mM NAD+ led to the formation of 4.28 mM 6 at 25 h, with 85.6% yield, 99% regioselectivity, and a TTN of 2100 for NAD+ recycling. When lowering the initial NAD+ concentration to 0.001 mM, final TTN increased to 4000 (Table 5.2, entry 4). 130 5.4 Summary and Conclusions Herein, we have demonstrated the first examples of selective sequential oxidations of methylene group into ketone via tandem biocatalysis with cofactor recycling in one pot. In one case, valuable ketones were prepared via selective oxidation-oxidation of hydrocarbon at benzylic position with NADP+ recycling with monooxygenase containing wild-type strain and LKADH; in the other case, useful ketone were prepared through selective oxidationoxidation of non-activated C-H into C=O with NAD+ recycling by the use of recombinant strain expressing P450pyr monooxygenase and RDR. While this type of transformation is still extremely challenging in classical chemistry, the use of tandem biocatalysis enables the efficient sequential oxidations and gives the desired ketones in pure form with high yield, high regioselectivity and high TTN for cofactor recycling. The strategy demonstrated here is also generally applicable to other sequential oxidations of methylene group into ketone by selecting and combining the appropriate enzymes in a similar way. 131 CHAPTER 6 CONCLUSION AND RECOMMENDATION 132 6.1 Conclusion In this thesis, several novel and efficient biocatalytic systems for oxidoreductions in pharmaceutical synthesis was developed, including bioreduction with efficient recycling of NADPH by coupled permeabilized microorganisms, regio- and stereo-selective biohydroxylations with a recombinant Escherichia coli expressing P450pyr monooxygenase of Sphingomonas sp. HXN-200, and the green and selective transformation of methylene to ketone via tandem biooxidations in one pot. Firstly, a novel and efficient biocatalytic system for bioreduction with efficient recycling of NADPH was successfully developed by the coupling of two permeabilized microorganisms. The method is a useful extension of our previous novel concept for efficient bioreduction with cofactor recycling by two coupled permeabilized microorganisms. In the original approach, the TTN for cofactor recycling and final product concentration were not high enough for practical application, due to the relative low activity of the cofactor recycling biocatalyst. Here, a recombinant strain was constructed to improve the activity of the cofactor recycling. The GDH of B. subtilis BGSC 1A1 was cloned and functionally expressed in E. coli BL21 (pGDH1), showing an activity much higher than its wild-type strain B. subtilis BGSC 1A1. The recombinant strain was successfully permeabilized with EDTA/toluene to give a high activity for cofactor recycling. Such permeabilized cells demonstrated much higher GDH activity and no NADPH or NADH oxidase activity, being advantageous over the wild-type strain. They were suitable for the recycling of both NADPH and NADH. Coupling of permeabilized cells of B. pumilus Phe- 133 C3 and E. coli BL21 (pGDH1) for the reduction of ethyl 3-keto-4triflurobutyrate 1 gave a TTN of 4200 for NADPH recycling, which is 2.6 times of the TTN obtained by using B. subtilis BGSC 1A1. The high TTN value is in the practical range for the synthesis of fine chemicals. Bioreduction of 3-ketoester via coupled permeabilized cells with the addition of 0.005 mM NADP+ for 3 times gave 50.5 mM of 3-hydroxyester in 95% ee and 84% conversion with an overall TTN of 3400 for NADPH recycling. These results demonstrated the high stability and productivity of the new biocatalysts system and a practical synthesis of (R)-ethyl 3-hydroxy-4-trifluorobutanoate. Our method could be applicable to other microbial reductions with cofactor recycling. Secondly, a recombinant Escherichia coli expressing P450pyr monooxygenase of Sphingomonas sp. HXN-200 was successfully constructed with high activity and applied for regio- and stereo-selective biohydroxylations of different type of substrates. The genes of cytochrome P450pyr from Sphingomonas sp. HXN-200 were cloned and functionally expressed in the E. coli BL21 - pRSFDuet P450pyr - pETDuet Fdx FdR1500, and the specific hydroxylation very close to those achieved with its wild-type strain. The recombinant P450pyr represents the high specific hydroxylation activities among all the recombinant P450 reported so far. 10.8 mM (S)-N-benzyl-4hydroxy-pyrrolidin-2-one was obtained under the optimized biohydroxylation conditions, a 2.6-fold increase of the product concentration in comparison with the wild-type strain. This recombinant E. coli was the only strain reported to produce exo-norbornaneol, 2-tetralol and 7-methoxy-2-tetralol through direct biohydroxylation of the non-activated carbon atoms of their corresponding 134 substrates. It also gave the most practical biohydroxylation example to produce (1R)-trans-pinocarveol with high conversion and product concentration. The hydroxylation of (-)-!-pinene with E. coli (P450pyr) cells showed excellent regio- and stereo-selectivity and gave (1R)- transpinocarveol in 82% yield and 4.1 mM, being over 200 times higher than that obtained with the best biocatalysts known thus far. Lastly, the first practical examples of selective sequential oxidations of methylene group into ketone via tandem biocatalysis with cofactor recycling in one pot were demonstrated. Valuable 1-tetralone and 1-indanone were prepared via selective oxidation-oxidation of tetralin and indan at benzylic position with NADP+ recycling by coupling whole-cell biocatalyst P. monteilii TA-5 containing monooxygenase with a commercially available enzyme Lactobacillus kefir alcohol dehydrogenase (LKADH). With the initial addition of 0.002 mM NADP+, pure 1-tetralone was produced in 5.25 mM with 87.5% yield, 99% regioselectivity, and a TTN of 2200 for NADP+ recycling; pure 1indanone was produced in 5.41 mM with 90.2% yield, 99% regioselectivity, and a TTN of 2200 for NADP+ recycling. By lowering initial amount of NADP+ to 0.001 mM and adding appropriate amount LKADH, 1-tetralone and 1-indanone were also directly produced from tetralin and indan through clean tandem catalysis, and with increased TTN of 4100 and 4200, respectively. Useful 1-benzyl-4-piperidone was prepared through selective oxidationoxidation of non-activated C-H into C=O with NAD+ recycling by the use of recombinant strain expressing P450pyr monooxygenase and RDR. While this type of transformation is still extremely challenging in classical chemistry, the use of tandem biocatalysis enables the efficient sequential oxidations and 135 gives the desired ketones in pure form with high yield, high regioselectivity and high TTN for cofactor recycling. Initial addition of 0.002 mM NAD+ led to the formation of 4.28 mM 1-benzyl-4-piperidone at 25 h, with 85.6% yield, 99% regioselectivity, and a TTN of 2100 for NAD+ recycling. When lowering the initial NAD+ amount to 0.001 mM, final TTN was increased to 4000. The strategy demonstrated here is also generally applicable to other sequential oxidations of methylene group into ketone by selecting and combining the appropriate enzymes in a similar way. 6.2 Recommendation The further development of novel and efficient biocatalytic systems for oxidoreductions in pharmaceutical synthesis may focus on the following aspects. The application of permeabilized cells for efficient cofactor recycling is a totally novel and promising method. We have successfully coupled two permeabilized microorganisms for efficient bioreduction of ethyl 3-keto-4triflurobutyrate with cofactor recycling. For the future work, our established system may apply to other substrates, and general application. Moreover, we can also apply the coupled permeabilized microbial cells concept for enzymatic oxidations with cofactor recycling, which is much more challenging than bioreductions. For example, cells of E. coli BL21 - pRSFDuet P450pyr pETDuet Fdx FdR1500 containing cytochrome P450pyr could be permeabilized by chemical incubation or other permeabilization method, and then coupled with permeabilized cells of E. coli BL21 (pGDH1). Such novel 136 system could be used for the efficient biooxidation with cofactor recycling, and all the compounds previously explored for E. coli (P450pyr) biohydroxyation will be good substrate candidate, such as N-benzyl pyrrolidine-2-one, N-benzyloxycarbonyl pyrrolidine, (-)-!-pinene (Scheme 6.1). OH R1 R2 * R1 Monooxygenase NAD(P)H Glucose Gluconolactone R2 NAD(P)+ Permeabilized E. coli (P450pyr) glucose dehydrogenase NAD(P)+ NAD(P)H Permeabilized E. coli BL21 (pGDH1) Scheme 6.1 Coupling of permeabilized microorganisms for efficient enantioselective hydroxylation with cofactor recycling. We have demonstrated the first practical examples of selective sequential oxidations of methylene group into ketone via tandem biocatalysis with cofactor recycling in one pot, which is a key challenge in traditional chemistry. To enhance the performance of our current tandem biocatalysts systems, we could construct recombinant cells of our current wild-type stains to improved the whole cell activity, and even can utilize directed evolution to further improve enzyme activity and stability. For example, in the tandem catalysis of tetralin and indan into 1-tetralone and 1-indanone, P. monteilii TA-5 containing monooxygenase was wide-type strain, which was shown to be the limiting factor to achieve better productivity. If we can identify, characterize the monooxygenase enzyme in the wild type strain, and engineer and express it in E. coli with increased activity and stability, then the performance of the whole tandem catalytic system will be much improved. Furthermore, we also 137 can explore other kinds of biocatalysis combination, such as selective oxidation from alkane to alcohol, then to aldehyde, which is also very challenging to classic chemical synthesis (Scheme 6.2). Monooxygenase/O2 R CH3 R CH=O Alcohol dehydrogenase NAD(P)+ Acetone Monooxygenase R CH2-OH O2 Alcohol dehydrogenase NAD(P)+ NAD(P)H O OH Scheme 6.2 Selective sequential oxidations of methyl group into aldehyde via tandem biocatalysis with cofactor recycling in one pot. R1 R2 Monooxygenase NAD(P)H Gluconolactone GDH OH * R1 R2 NAD(P)+ Glucose Scheme 6.3 Engineering of two enzymes into one host cell for efficient biohydroxylaiton with cofactor recycling. Another possible way to develop tandem biocatalysts system for efficient oxidoreductions is to engineer two enzymes necessary for the tandem biocatalysis into one host cell, and tune the expression ratio of the two enzymes according to the needs of the tandem biocatalysis. For instance, we can engineer and express P450pyr monooxygenase and glucose dehydrogenase (GDH) in one E. coli host cell for efficient biohydroxylation with practical 138 cofactor recycling (Scheme 6.3). The recombinant microorganism coexpressing two necessary enzymes might be more convenient and efficient for tandem catalysis, but it is very difficult to achieve this point. We could also immobilize necessary enzymes onto one or separate carriers for economical bioreduction with efficient recycling of cofactor (Scheme 6.4). O O F3C OH F3C Gluconolactone NADPH OEt O OEt Ketoreductase NADP+ GDH Glucose Scheme 6.4 Coupling two immobilized enzymes for efficient bioreduction with cofactor recycling. 139 BIBLIOGRAPHY 1. Http://www.in-pharmatechnologist.com/Industry-Drivers/Chiral technolog y-driven-by-pharma-industry. 2. D. Chang, J. Zhang, B. Witholt, Z. Li, Chemical And Enzymatic Synthetic Methods For Asymmetric Oxidation Of The C-C Double Bond, Biocatal. Biotransform. 2004, 22, 113-131. 3. K. Faber, Biotransformations in organic chemistry 1997, Chp. 2.2, p.160200, Springer, Berlin, Germany. 4. A. Liese, K. Seelbach, C. Wandrey, Industrial Biotransformation 2000, Wiley-VCH, Weinheim. 5. Z. Li, J. B. van Beilen, W. A. Duetz, A. Schmid, A. de Raadt, H. Griengl, B. Witholt, Oxidative Biotransformations Using Oxygenases, Curr. Opin. Chem. Biol. 2002, 6, 136-144. 6. K. Nakamura, T. Matsuda, Enzyme catalysis in organic synthesis (Eds.: K. Drauz, H. Waldmann) 2002, Vol. III, Chp.15, p.991-1047, Wiley-VCH, Weinheim. 7. W. Hummel, Large-Scale Application Of NAD(P)-Dependent Oxidoreductases: Recent Developments, TIBTECH. 1999, 17, 487-492. 8. H. K. Chenault, G. M. Whitesides, Regeneration Of Nicotinamide Cofactors For Use In Organic Synthesis, Appl. Biochem. Biotechnol. 1987, 14, 147-197. 9. P. Adlercreutz, Cofactor Regeneration In Biocatalysis In Organic Media, Biocatal. Biotransform. 1996, 14, 1-30. 10. W. A. van der Donk, H. Zhao, Recent Developments In Pyridine Nucleotide Regeneration, Curr. Opin. Biotechnol. 2003, 14, 421-426. 140 11. F. Hollmann, A. Schmid, Electrochemical Regeneration Of Oxidoreductases For Cell-Free Biocatalytic Redox Reactions, Biocatal. Biotransform. 2004, 22, 63-88. 12. M. Eckstein, T. Daussmann, U. Kragl, Recent Developments In NAD(P)H Regeneration For Enzymatic Reductions In One- And Two-Phase Systems, Biocatal. Biotransform. 2004, 22, 89-96. 13. K. Goldberg, K. Schroer, S. Lütz, A. Liese, Biocatalytic Ketone Reduction—A Powerful Tool For The Production Of Chiral Alcohols. Part I. Processes With Isolated Enzymes, Appl. Microbiol. Biotechnol. 2007, 76, 237248. 14. W. Kroutil, H. Mang, K. Edegger, K. Faber, Recent Advances In The Biocatalytic Reduction Of Ketones And Oxidation Of Sec-Alcohols, Curr. Opin. Chem. Biol. 2004, 8, 120-126. 15. T. W. Johannes, R. D. Woodyer, H. M. Zhao, Efficient Regeneration of NADPH Using an Engineered Phosphate Dehydrogenase, Biotechnol. Bioeng. 2007, 96, 18-26. 16. C.-H. Wong, D. G. Drueckhammer, H. M. Sweers, Enzymatic vs. Fermentative Synthesis: Thermostable Glucose Dehydrogenase Catalyzed Regeneration Of NAD(P)H For Use In Enzymatic Synthesis, J. Am. Chem. Soc. 1985, 107, 4028-4031. 17. W. Hummel, K. Abokitse, K. Drauz, C. Rollmann, H. Groger, Towards A Large-Scale Asymmetric Reduction Process With Isolated Enzymes: Expression Of An (S)-Alcohol Dehydrogenase In E. coli And Studies On The Synthetic Potential Of This Biocatalyst, Adv. Synth. Catal. 2003, 345, 153-159. 141 18. H. Groeger, W. Hummel, C. Rollmann, F. Chamouleau, H. Husken, H. Werner, C. Wunderlich, K. Aboktise, K. Drauz, S. Buchholz, Preparative Asymmetric Reduction Of Ketones In A Biphasic Medium With An (S)Alcohol Dehydrogenase Under in situ-Cofactor-Recycling With A Formate Dehydrogenase, Tetrahedron 2004, 60, 633-640. 19. V. J. Shorrock, M. Chartrain, J. M. Woodley, An Alternative Bioreactor Concept For Application Of An Isolated Oxidoreductase For Asymmetric Ketone Reduction, Tetrahedron 2004, 60, 781-788. 20. H. Groeger, C. Rollmann, F. Chamouleau, I. Sebastien, O. May, W. Wienand, K. Drauz, Enantioselective Reduction Of 4-Fluoroacetophenone At High Substrate Concentration Using A Tailor-Made Recombinant Wholecell Catalyst, Adv. Synth. Catal. 2007, 349, 709-712. 21. M. Kataoka, K. Yamamoto, H. Kawabata, M. Wada, K. Kita, H. Yanase, S. Shimizu, Stereoselective Reduction Of Ethyl 4-Chloro-3-Oxobutanoate By Escherichia coli Transformant Cells Coexpressing The Aldehyde Reductase And Glucose Dehydrogenase Genes, Appl. Microbiol. Biotechnol. 1999, 51, 486-490. 22. N. Kizaki, Y. Yasohara, J. Hasegawa, M. Wada, M. Kataoka, S. Shimizu, Synthesis Of Optically Pure Ethyl (S)-4-Chloro-3-Hydroxybutanoate By Escherichia coli Transformant Cells Coexpressing The Carbonyl Reductase And Glucose Dehydrogenase Genes, Appl. Microbiol. Biotechnol. 2001, 55, 590-595. 23. C. H. Wong, G. M. Whitesides, Enzyme-Catalyzed Organic Synthesis: NAD(P)H Cofactor Regeneration By Using Glucose-6-Phosphate And The 142 Glucose-5-Phosphate Dehydrogenase From Leuconostoc mesenteroides, J. Am. Chem. Soc. 1981, 103, 4890-4899. 24. M. W. Peters, P. Meinhold, A. Glieder, F. H. Arnold, Regio- And Enantioselective Alkane Hydroxylation With Engineered Cytochromes P450 BM-3, J. Am. Chem. Soc. 2003, 125, 13442-13450. 25. T. L. Poulos, B. C. Finzel, A. J. Howard, High-Resolution Crystal Structure Of Cytochrome P450cam, J. Mol. Biol. 1987, 195, 687-700. 26. K. G. Ravichandran, S. S. Boddupalli, C. A. Hasemann, J. A. Peterson, J. Deisenhofer, Crystal Structure Of Hemoprotein Domain Of P450BM-3, A Prototype For Microsomal P450's, Science 1993, 261, 731-736. 27. L. O. Narhi, A. J. Fulco, Characterization Of A Catalytically SelfSufficient 119,000-Dalton Cytochrome P-450 Monooxygenase Induced By Barbiturates In Bacillus Megaterium, J. Biol. Chem. 1986, 261, 7160-7169. 28. A. C. Rosenzweig, C. A. Frederick, S. J. Lippard, P. Nordlung, Crystal Structure Of A Bacterial Non-Haem Iron Hydroxylase That Catalyses The Biological Oxidation Of Methane, Nature 1993, 366, 537-543. 29. R. Bernhardt, Cytochromes P450 As Versatile Biocatalysts, J. Biotechnol. 2006, 124, 128-145. 30. L. L. Wong, Cytochrome P450 Monooxygenases, Curr. Opin. Chem. Biol. 1998, 2, 263-268. 31. D. Werck-Reichhart, R. Feyereisen, Cytochromes P450: A Success Story, Genome Biol. 2000, 1, 3003. 32. H. Koga, B. Rauchfuss, I. C. Gunsalus, P450cam Gene Cloning And Expression In Pseudomonas Putida And Escherichia coli, Biochem. Biophys. Res. Commun. 1985, 130, 412-417. 143 33. O. Narhi, L. P. Wen, A. J. Fulco, Characterization Of The Protein Expressed In Escherichia Coli By A Recombinant Plasmid Containing The Bacillus megaterium Cytochrome P450BM-3 Gene, Mol. Cell. Biochem. 1988, 79, 63-71. 34. J. B. van Beilen, R. Holtackers, D. Luscher, U. Bauer, B. Witholt, W. A. Duetz, Biocatalytic Production Of Perillyl Alcohol From Limonene By Using A Novel Mycobacterium sp. Cytochrome P450 Alkane Hydroxylase Expressed In Pseudomonas putida, Appl. Environ. Microb. 2005, 71, 17371744. 35. L. P. Wen, A. J. Fulco, Cloning Of The Gene Encoding A Catalytically Self-Sufficient Cytochrome P-450 Fatty Acid Monooxygenase Induced By Barbiturates In Bacillus megaterium And Its Functional Expression And Regulation In Heterologous (Escherichia coli) And Homologous (Bacillus megaterium) Hosts, J. Biol. Chem. 1987, 262, 6676-1987. 36. T. Mouri, J. Michizoe, H. Ichinose, N. Kamiya, M. Goto, A Recombinant Escherichia Coli Whole Cell Biocatalyst Harboring A Cytochrome P450cam Monooxygenase System Coupled With Enzymatic Cofactor Regeneration, Appl. Microbiol. Biotechnol. 2006, 72, 514-520. 37. E. T. Farinas, U. Schwaneberg, A. Glieder, F. H. Arnold, Directed Evolution Of A Cytochrome P450 Monooxygenase For Alkane Oxidation, Adv. Synth. Catal. 2001, 343, 601-606. 38. J. P. Jones, E. J. O’Hare, L. L. Wong, Oxidation Of Polychlorinated Benzenes By Genetically 8 Engineered CYP101 (Cytochrome P450cam), Eur. J. Biochem. 2001, 268, 1460-1467. 144 39. R. Weis, M. Winkler, M. Schittmayer, S. Kambourakis, M. Vink, J. D. Rozzell, A. Glieder, A Diversified Library Of Bacterial And Fungal Bifunctional Cytochrome P450 Enzymes For Drug Metabolite Synthesis, Adv. Synth. Catal. 2009, 351, 21402146. 40. M. Landwehr, L. Hochrein, C. R. Otey, A. Kasrayan, J. E. Bäckvall, F. H. Arnold, Enantioselective !-Hydroxylation Of 2-Arylacetic Acid Derivatives And Buspirone Catalyzed By Engineered Cytochrome P450BM-3, J. Am. Chem. Soc. 2006, 128, 6058-6059. 41. T. Kubo, M. W. Peters, P. Meinhold, F. H. Arnold, Enantioselective Epoxidation of Terminal Alkenes to (R)- and (S)-Epoxides by Engineered Cytochromes P450BM-3, Chem. Eur. J. 2006, 12, 1216-1220. 42. A. B. Carmichael, L. L. Wong, Protein Engineering Of Bacillus megaterium CYP102-The Oxidation Of Polycyclic Aromatic Hydrocarbons, Eur. J. Biochem. 2001, 268, 3117-3125. 43. C. F. Harford-Cross, A. B. Carmichael, F. K. Allan, P. A. England, D. A. Rouch, L. L. Wong, Protein Engineering Of Cytochrome P450 (Cam) (CYP101) For The Oxidation Of Polycyclic Aromatic Hydrocarbons, Protein Eng. 2000, 13, 121-128. 44. Q. S. Li, J. Ogawa, R. D. Schmid, S. Shimizu, Engineering Cytochrome P450 BM-3 For Oxidation Of Polycyclic Aromatic Hydrocarbons, Appl. Environ. Microbiol. 2001, 67, 5735-5739. 45. R. A. Sheldon, E factors, Green Chemistry And Catalysis: An Odyssey, Chem. Commun. 2008, 3352-3365. 145 46. E. S. Simon, M. D. Bednarski, G. M. Whitesides, Synthesis Of CMPNeuAc From N-Acetylglucosamine: Generation Of CTP From CMP Using Adenylate Kinase, J. Am. Chem. Soc. 1988, 110, 7159-7163. 47. J. Thiem, T. Wiemann, Galactosyltransferase-Katalysierte Synthese von 2'Desoxy-N-Acetyllactosamin, Angew. Chem., Int. Ed. 1991, 30, 1163-1164. 48. W.-D. Fessner, C. Walter, “Artificial Metabolisms" For The Asymmetric One-Pot. Synthesis Of Branched-Chain Saccharides, Angew. Chem., Int. Ed. 1992, 31, 614-616. 49. H. J. M. Gijsen, C.-H. Wong, Sequential One-Pot Aldol Reactions Catalyzed By 2-Deoxyribose-5-Phosphate Aldolase And Fructose-1,6Diphosphate Aldolase, J. Am. Chem. Soc. 1995, 117, 2947-2948. 50. I. Henderson, K. B. Sharpless, C.-H. Wong, Synthesis Of Carbohydrates via Tandem Use Of The Osmium-Catalyzed Asymmetric Dihydroxylation And Enzyme-Catalyzed Aldol Addition Reactions, J. Am. Chem. Soc. 1994, 116, 558-561. 51. V. Kren, J. Thiem, Multi-Enzyme System For A One-Pot Synthesis Of Sialyl T-Antigen, Angew. Chem., Int. Ed. 1995, 34, 893-895. 52. L. Veum, M. Kuster, S. Telalovic, U. Hanefeld, T. Maschmeyer, EnanTioselective Synthesis Of Protected Cyanohydrins, Eur. J. Org. Chem. 2002, 1516-1522. 53. M. Inagaki, J. Hiratake, T. Nishioka, J. Oda, Lipase-Catalyzed Kinetic Resolution With in situ Racemization: One-Pot Synthesis Of Optically Active Cyanohydrin Acetates From Aldehydes, J. Am. Chem. Soc. 1991, 113, 93609361. 146 54. C. V. Givan, Evolving Concepts In Plant Glycolysis: Two Centuries Of Progress, Biol. Rev. 1999, 74, 277-309. 55. J. Staunton, B. Wilkinson, Biosynthesis Of Erythromycin And Rapamycin, Chem. Rev. 1997, 97, 2611-2629. 56. C. Khosla, Harnessing The Biosynthetic Potential Of Modular Polvketide Synthases, Chem. Rev. 1997, 97, 2577-2590. 57. C. Hertweck, The Biosynthetic Logic Of Polyketide Diversity, Angew. Chem. Int. Ed. 2009, 48, 4688-4716. 58. U. Kaulmann, C. Hertweck, Biosynthesis Of Polyunsaturated Fatty Acids By Polyketide Synthases, Angew. Chem. Int. Ed. 2002, 41, 1866-1869. 59. C. O. Schmidt, H. J. Bouwmeester, J.-W. de Kraker, W. A. König, Biosynthesis Of (+)- And (-)-Germacrene D In Solidago canadensis: Isolation And Characterization Of Two Enantioselective Germacrene D Synthases, Angew. Chem. Int. Ed. 1998, 37, 1400-1402. 60. C. V. Voss, C. C. Gruber, W. Kroutil, Deracemization Of Secondary Alcohols Through A Concurrent Tandem Biocatalytic Oxidation And Reduction, Angew. Chem. Int. Ed. 2008, 47, 741-745. 61. C. V. Voss, C. C. Gruber, K. Faber, T. Knaus, P. Macheroux, W. Kroutil, Orchestration Of Concurrent Oxidation And Reduction Cycles For Stereoinversion And Deracemisation Of Sec-Alcohols, J. Am. Chem. Soc. 2008, 130, 13969-13972. 62. E. Takahashi, K. Nakamichi, M. Furui, R-(")-Mandelic Acid Production From Racemic Mandelic Acids Using Pseudomonas polycolor IFO 3918 And Micrococcus freudenreichii FERM-P 13221, J. Ferment. Bioeng. 1995, 80, 247-250. 147 63. J. Zhang, B. Witholt, Z. Li, Coupling of Permeabilized Microorganisms for Efficient Enantioselective Reduction of Ketone with Cofactor Recycling, Chem. Commun. 2006, 398-400. 64. Z. Li, H. J. Feiten., J. B. van Beilen, W. Duetz, B. Witholt, Preparation Of Optically Active N-Benzyl-3-Hydroxypyrrolidine By Enzymatic Hydroxylation, Tetrahedron: Asymmetry 1999, 10, 1323-1333. 65. Z. Li, H.-J. Feiten, D. Chang, W. A. Duetz, J. B. van Beilen, B. Witholt, Preparation Of (R)- And (S)-N-Protected 3-Hydroxypyrrolidines By Hydroxylation With Sphingomonas Sp. HXN-200, A Highly Active, RegioAnd Stereoselective, And Easy To Handle Biocatalyst, J. Org. Chem. 2001, 66, 8424-8430. 66. D. Chang, B. Witholt, Z. Li, Preparation Of (S)-N-Substituted 4-HydroxyPyrrolidin-2-Ones By Regio- And Stereoselective Hydroxylation With Sphingomonas sp. HXN-200, Org. Lett. 2000, 2, 3949-3952. 67. D. Chang, H. J. Feiten, K. H. Engesser, J. B. van Beilen, B. Witholt, Z. Li, Practical Syntheses Of N-Substituted 3-Hydroxyazetidines And 4- Hydroxypiperidines By Hydroxylation, Org. Lett. 2002, 4, 1859-1862. 68. D. Chang, H.-J. Feiten, B. Witholt, Z. Li, Regio- And Stereoselective Hydroxylation Of N-Substituted Piperidin-2-Ones With Sphingomonas Sp. HXN-200, Tetrahedron: Asymmetry 2002, 13, 2141-2147. 69. J. B. van Beilen, E. G. Funhoff, A. Van Loon, A. Just, L. Kaysser, M. Bouza, R. Holtackers, M. Röthlisberger, Z. Li, B. Witholt, Cytochrome P450 Alkane Hydroxylases Of The CYP153 Family Are Common In AlkaneDegrading Eubacteria Lacking Integral Membrane Alkane Hydroxylases, Appl. Environ. Microb. 2006, 72, 59-65. 148 70. P. Li, W. M. Fong, L. C. F. Chao, S. H. C. Fung, I. D. Williams, A Convenient Synthesis Of #,$-Acetylenic Ketones, J. Org. Chem. 2001, 66, 4087-4090. 71. J. W. Kim, K. Yamaguchi, N. Mizuno, Heterogeneously Catalyzed Efficient Oxygenation Of Primary Amines To Amides By A Supported Ruthenium Hydroxide Catalyst, Angew. Chem. Int. Ed. 2008, 47, 9249-9251. 72. L. L. Ni, J. Ni, Y. Lv, P. Yang, Y. Cao, Photooxygenation Of Hydrocarbons Over Efficient And Reusable Decatungstate Heterogenized On Hydrophobically-Modified Mesoporous Silica, Chem. Commun. 2009, 21712173. 73. X. H. Wu, A. E. V. Gorden, 2-Quinoxalinol Salen Copper Complexes In Oxidation Of Aryl Methylenes, Eur. J. Org. Chem. 2009, 503-509. 74. A. S. Larsen, K. Wang, M. A. Lockwood, G. L. Rice, T.-J. Won, S. Lovell, M. Sadílek, F. Tureek, J. M. Mayer, Hydrocarbon Oxidation By Bis-%-Oxo Manganese Dimers: Electron Transfer, Hydride Transfer, And Hydrogen Atom Transfer Mechanisms, J. Am. Chem. Soc. 2002, 124, 10112-10123. 75. R. L. Brutchey, I. J. Drake, A. T. Bell, T. D. Tilley, Liquid-Phase Oxidation Of Alkylaromatics By A H-Atom Transfer Mechanism With A New Heterogeneous Cosba-15 Catalyst, Chem. Commun. 2005, 3736-3738. 76. J. Q. Yu, E. J. Corey, A Mild, Catalytic, And Highly Selective Method For The Oxidation Of !,&-Enones To 1,4-Enediones, J. Am. Chem. Soc. 2003, 125, 3232-3233. 77. S. I. Murahashi, N. Komiya, Y. Oda, T. Kuwabara, T. Naota, RutheniumCatalyzed Oxidation Of Alkanes With Tert-Butyl Hydroperoxide And Peracetic Acid, J. Org. Chem. 2000, 65, 9186-9193. 149 78. X. L. Tong, J. Xu, H. Miao, Highly Efficient And Metal-Free Aerobic Hydrocarbons Oxidation Process By An O-Phenanthroline-Mediated Organocatalytic System, Adv. Synth. Catal. 2005, 347, 1953-1957. 79. A. J. Catino, R. E. Forslund, M. P. Doyle, Dirhodium(II) Caprolacatamate: An Exceptional Catalyst For Allylic Oxidation, J. Am. Chem. Soc. 2004, 126, 13622-13623. 80. M. S. Chen, M. C. White, Combined Effects On Selectivity In FeCatalyzed Methylene Oxidation, Science 2010, 327, 566-571. 81. F, Li, M. Wang, C. B. Ma, A. P. Gao, H. B. X. L. Tong, J. Xu, H. Miao, Adv. Synth. Catal. 2005, 347, 1953-1957.Chen, L. C. Sun, Mono- And Binuclear Complexes Of Iron(II) And Iron(III) With An N4O Ligand: Synthesis, Structures And Catalytic Properties In Alkane Oxidation, Dalton Trans. 2006, 20, 2427-2434. 82. J. Kaizer, E. J. Klinker, N. Y. Oh, J.-U. Rohde, W. J. Song, A. Stubna, J. Kim, E. Muenck, W. Nam, L. Jr. Que, Nonheme FeIVO Complexes That Can Oxidize The C"H Bonds Of Cyclohexane At Room Temperature, J. Am. Chem. Soc. 2004, 126, 472-473. 83. J. K. Tang, P. Gamez, J. Reedijk, Effcient [Bis(Imino) Pyridine-Iron]Catalyzed Oxidation Of Alkanes, Dalton Trans. 2007, 41, 4644-4646. 84. Http://en.wikipedia.org/wiki/Biocatalysis. 85. K. Faber, Biotransforamtions In Organic Chemistry 1997, Springer. 86. A. Liese, K. Seelbach, C. Wandrey, Industrial Biotransformations 2006, Wiley-VCH. 87. K. M. Koeller, C. H. Wong, Enzymes For Chemical Synthesis, Nature 2001, 409, 232-240. 150 88. F. Li, J. N. Cui, X. H. Qian, R. Zhang, Y. Xiao, Highly Chemoselective Reduction Of Aromatic Nitro Compounds To The Corresponding Hydroxylamines Catalysed By Plant Cells From A Grape, Chem. Commun. 2005, 1901-1903. 89. F. Lie, Y. Z. Chen, Z. S. Wang, Z. Li, Enantioselective Benzylic Hydroxylation Of Indan And Tetralin With Pseudomonas monteilii TA-5, Tetrahedron: Asymmetry 2009, 20, 1206-1211. 90. Http://www.epa.gov/greenchemistry/. 91. M. A. Wegman, M. H. A. Janssen, F. van Rantwijk, R. A. Sheldon, Towards Biocatalytic Synthesis Of !-Lactain Antibiotics, Adv. Synth. Catal. 2001, 343, 559-576. 92. R. M. Verhaert A. M. Riemens, J. M. van der Laan, J. van Duin, W. J. Quax, Molecular Cloning And Analysis Of The Gene Encoding The Thermostable Penicillin G Acylase From Alcaligenes Faecalis, Appl. Environ. Microbiol. 1997, 63, 3412-3418. 93. J. T. Sime, Applications Of Biocatalysis To Industrial Processes, J. Chem. Educ. 1999, 76, 1658-1661. 94. H. E. Schoemaker, D. Mink, M. G. Wubbolts, Dispelling The MythsBiocatalysis In Industrial Synthesis, Science 2003, 299, 1694-1697. 95. M. A. Rouchi, Chiral Roundup, Chem. Eng. News 2002, 80, 43. 96. A. Schmid, J. S. Dordick, B. Hauer, A. Kiener, M. Wubbolts, B. Witholt, Industrial Biocatalysis Today And Tomorrow, Nature 2001, 409, 258-268. 97. S. Elza, G. Gerhardb, W. Schunack, Histamine Analogues. 32nd Communication: Synthesis And Pharmacology Of Sopromidine, A Potent And 151 Stereoselective Isomer Of The Achiral H2-Agonist Impromidine, Eur. J. Med. Chem. 1989, 24, 259-262. 98. R. N. Patel, Biocatalysis: Synthesis Of Chiral Intermediates For Pharmaceuticals, Curr. Org. Chem. 2006, 10, 1289-1321. 99. N. M. Shaw, K. T. Robins, A. Kiener, Lonza: 20 Years Of Biotransformations, Adv. Synth. Catal. 2003, 345, 425-435. 100. S. C. Davis, J. H. Grate, D. R. Gray, J. M. Gruber, G. W. Huisman, S. K. Ma, L. M. Newman, R. A. Sheldon, L. A. Wang, Enzymatic Processes For The Production Of 4-Substituted 3-Hydroxybutyric Acid Derivatives, WO/2004/015132, 2004. 101. H. Yamamoto, A. Matsuyama, and Y. Kobayashi, Synthesis Of Ethyl (S)4-Chloro-3-hydroxybutanoate Using fabG Homologues, Appl. Microbiol. Biotechnol. 2003, 61, 133-139. 102. C. H. Lu, Y. C. Cheng, S. W. Tsai, Integration Of Reactive Membrane Extraction With Lipase-Hydrolysis Dynamic Kinetic Resolution Of Naproxen 2,2,2-Trifluoroethyl Thioester In Isooctane, Biotechnol. Bioeng. 2002, 79, 200-210. 103. H. Masayasu, O. Shigetaka, H. Nobutake, S. Kiyofumi, H. You, Processes For Production Of Optically Active 4-Halo-3-Hydroxybutyric Acid Esters, US4933282, 1990. 104. E. Garcia-Junceda, Multi-step Enzyme Catalysis: Biotransformations and Chemoenzymatic Synthesis 2008, WILEY-VCH, Weinheim. 105. Z. Li, D. L. Chang, Recent Advances In Regio- And Stereoselective Biohydroxylation Of Non-Activated Carbon Atoms, Curr. Org. Chem. 2004, 8, 1647-1658. 152 106. J. Zhang, W. A. Duetz, B. Witholt, Z. Li, Rapid Identification Of New Bacterial Alcohol Dehydrogenases For (R)- And (S)-Enantioselective Reduction Of &-Ketoesters, Chem. Commun. 2004, 2120-2121. 107. K. J. Xiang, Y. Qiao, C. B. Ching, C. M. Li, E. Coli As Superior Electrocatalyst For Microbial Fuel Cells, Electrochem. Commun. 2009, 11, 1593-1595. 108. W. P. Stemmer, Rapid Evolution Of A Protein In Vitro By DNA Shuffling, Nature 1994, 370, 389-391. 109. L. G. Otten, W. J. Quax, Directed Evolution: Selecting Today's Biocatalysts, Biomolecular Engineering 2005, 22, 1-9. 110. P. C. Cirino, F. H. Arnold, Protein Engineering Of Oxygenases For Biocatalysts, Curr. Opin. Chem. Biol. 2002, 6, 130-135. 111. D. F. Munzer, P. Meinhold, M. W. Peters, S. Feichtenhofer, H. Griengl, F. H. Arnold, A. Glieder, A. de. Raadt, Stereoselective Hydroxylation Of An Achiral Cyclopentanecarboxylic Acid Derivative Using Engineered P450s BM-3, Chem. Commun. 2005, 2597-2599. 112. D. R. Boyd, N. D. Sharma, C. C. R. Allen, Aromatic Dioxygenases: Molecular Biocatalysis And Applications, Curr. Opin. Biotechnol. 2001, 12, 564-573. 113. W. Kroutil, H. Mang, K. Edegger, K. Faber, Recent Advances In The Biocatalytic Reduction Of Ketones And Oxidation Of Sec-Alcohols, Curr. Opin. Chem. Biol. 2004, 8, 120-126. 114. H. Jornvall, B. Persson, J. Jeffery, Characteristics Of Alcohol/Polyol Dehydrogenases. The Zinc-Containing Long-Chain Alcohol Dehydrogenases, Eur. J. Biochem. 1987, 167, 195-201. 153 115. W. Hummel, Reduction Of Acetophenone To R(+)-Phenylethanol By A New Alcohol Dehydrogenase From Lactobacillus Kefir, Appl. Microbiol. Biotechnol. 1990, 34, 15-19. 116. B. Kosjek, W. Stampfer, R. van Deursen, K. Faber, W. Kroutil, Efficient Production Of Raspberry Ketone Via 'Green' Biocatalytic Oxidation, Tetrahedron 2003, 59, 9517-9521. 117. M. Sono, M. P. Roach, E. D. Coulter, J. H. Dawson, Heme-Containing Oxygenases, Chem. Rev. 1996, 96, 2841-2888. 118. F. Schulz, F. Leca, F. Hollmann, M. T Reetz, Towards Practical Biocatalytic Baeyer-Villiger Reactions: Applying A Thermostable Enzyme In The Gram-Scale Synthesis Of Optically-Active Lactones In A Two-LiquidPhase System, Beilstein J. Org. Chem. 2005, 1, 1-8. 119. R. Wichmann, D.Vasic-Racki, Cofactor Regeneration At The Lab Scale, Adv. Biochem. Eng. Biotechnol. 2005, 92, 225-260. 120. H. Zhao, W. A. van der Donk, Regeneration Of Cofactors For Use In Biocatalysts, Curr. Opin. Biotechnol. 2003, 14, 583-589. 121. M. D. Leonida, Redox Enzymes Used In Chiral Syntheses Coupled To Coenzyme Regeneration, Curr. Med. Chem. 2001, 8, 345-369. 122. W. Kroutil, H. Mang, K. Edegger, K. Faber, Recent Advances In The Biocatalytic Reduction Of Ketones And Oxidation Of Sec-Alcohols, Curr. Opin. Chem. Biol. 2004, 8, 120-126. 123. M. Eckstein, T. Daubmann, U. Kragl, Recent Developments In NAD(P)H Regeneration For Enzymatic Reductions In One- And Two-Phase Systems, Biocatal. Biotransform. 2004, 22, 89-96. 154 124. K. Goldberg, K. Schroer, S. Lütz, A. Liese, Biocatalytic Ketone Reduction-A Powerful Tool For The Production Of Chiral Alcohols--Part I: Processes With Isolated Enzymes, Appl. Microbiol Biotechnol. 2007, 76, 237248. 125. W. F. Liu, P. Wang, Cofactor Regeneration For Sustainable Enzymatic Biosynthesis, Biotechnol. Adv. 2007, 25, 369-384. 126. M. Andersson, R. Otto, H. Holmberg, P. Adlercreutz, Alcaligenes eutrophus Cells Containing Hydrogenase, A Coenzyme Regenerating Catalyst For NADH-Dependent Oxidoreductases, Biocatal. Biotransform. 1997, 15, 281-296. 127. C. H. Wong, D. G. Drueckhammer, H. M. Sweers, Enzymatic vs. Fermentative Synthesis: Thermostable Glucose Dehydrogenase Catalyzed Regeneration Of NAD(P)H For Use In Enzymatic Synthesis, J. Am. Chem. Soc. 1985, 107, 4028-4031. 128. A. Pollak, H. Blumenfeld, M. Wax, R. L. Baughn, G. M. Whitesides, Enzyme Immobilization By Condensation Copolymer- Ization Into CrossLinked Polyacrylamide Gels, J. Am. Chem. Soc. 1980, 102, 6324-6336. 129. A. Azem, F. Man, S. Omanovic, Direct Regeneration Of NADH On A Ruthenium Modified Glassy Carbon Electrode, J. Mol. Catal. A: Chem. 2004, 219, 283-299. 130. F. Hollmann, A. Schmid, Electrochemical Regeneration Of Oxidoreductases For Cell-Free Biocatalytic Redox Reactions, Biocatal. Biotranform. 2004, 22, 63-88. 155 131. X. Chen, J. M. Fenton, R. J. Fisher, R. A. Peattie, Evaluation Of in situ Electroenzymatic Regeneration Of Coenzyme NADH In Packed Bed Membrane Reactors, J. Electrochem. Soc. 2004, 151, E56-E60. 132. F. Hollmann, B. Witholt, A. Schmid, [Cp*Rh(Bpy)(H20)]2+:Versatile Tool For Efficient And Non-Enzymatic Regeneration Of Nicotinamide And Flavin Coenzymes, J. Mol. Catal. B: Enzym. 2003, 19-20, 167-176. 133. O. Abril, G. M. Whitesides, Hybrid Organometallic/Enzymatic Catalyst Systems: Regeneration Of NADH Using Dihydrogen, J. Am. Chem. Soc. 1982, 104, 1552-1554. 134. S. Bhaduri, P. Mathur, P. Payra, K. Sharma, Coupling Of Catalyses By Carbonyl Clusters And Dehydrogenases : Reduction Of Pyruvate To L-Lactate By Dihydrogen, J. Am. Chem. Soc. 1998, 120, 12127-12128. 135. M. Julliard, J. Le Petit, Regeneration Of NAD+ And NADP+ Cofactors By Photosensitized Electron-Transfer, Photochem. Photobiol. 1982, 36, 283290. 136. W. Stampfer, B. Kosjek, C. Moitzi, W. Kroutil, K. Faber, Biocatalytic Asymmetric Hydrogen Transfer, Angew. Chem. Int. Ed. 2002, 41, 1014-1017. 137. M. V. Filho, T. Stillger, M. Muller, A. Liese, C. Wandrey, Is Logp A Convenient Criterion To Guide The Choice Of Solvents For Biphasic Enzymatic Reactions? Angew. Chem. Int. Ed. 2003, 42, 2993-2996. 138. W. Stampfer, K. Edegger, B. Kosjek, K. Faber, W. Kroutil, Simple Biocatalytic Access To Enantiopure (S)-1-Heteroarylethanols Employing A Microbial Hydrogen Transfer Reaction, Adv. Synth. Catal. 2004, 346, 57-62. 139. M. Eckstein, M. V. Fiho, A. Liese, U. Kragl, Use Of An Ionic Liquid In 156 A Two-Phase System To Improve An Alcohol Dehydrogenase Catalysed Reduction, Chem. Commun. 2004, 1084-1085. 140. C.-H. Wong, G. H. Whitesides, Enzyme-Catalyzed Organic Synthesis: NAD(P)H Cofactor Regeneration Using Glucose-6-Phosphate And The Glucose-6-Phosphate Dehydrogenase From Leuconostoc Mesenteroides, J. Am. Chem. Soc. 1981, 103, 4890-4899. 141. S. P. Denyer, J.-Y. Maillard, Cellular Impermeability And Uptake Of Biocides And Antibiotics In Gram-Negative Bacteria, J. Appl. Microbiol. Symposium Supplement 2002, 92, 35S-45S. 142. M. Canovas, T. Torroglosa, J. L. Iborra, Permeabilization Of Escherichia coli Cells In The Biotransformation Of Trimethylammonium Compounds Into L-Carnitine, Enzyme Microb. Tech. 2005, 25, 300-308. 143. M. Canovas, J. L. Iborra, Whole Cell Biocatalysts Stabilization For LCarnitine Production, Biocatal. Biotransform. 2005, 23, 149-158. 144. M. Cavonas, T. Torroglosa, H. Kleber, J. L. Iborra, Effect Of Osmotic Stress In The Uptake And Biotransformation Of Crotonobetaine And DCarnitine Into L-Carnitine By Resting Cells Of Escherichia coli, J. Basic Microbiol. 2003, 43, 259-268. 145. M. W. Breedveld, L. P. T. M. Zevenhuizen, A. J. B. Zehnder, Synthesis Of Cyclic Beta-(1,2)-Glucans By Rhizobium leguminosarum biovar rrifolii TA-1: Factors Influencing Excretion, J. Bacteriol. 1992, 174, 6336-6342. 146. P. Y. K. Yang, O. Bayraktar, H. T. Pu, Plant Cell Bioreactors With Simultaneous Electropermeabilization And Electrophoresis, J. Biotechnol. 2003, 100, 13-22. 157 147. Y. Ni, R. R. Chen, Accelerating Whole-Cell Biocatalysis By Reducing Outer Membrane Permeability Barrier, Biotechnol. Bioeng. 2004, 87, 804-811. 148. J. Zhang, B. Witholt, Z. Li, Efficient NADPH Recycling In Enantioselective Bioreduction Of A Ketone With Permeabilized Cells Of A Microorganism Containing A Ketoreductase And A Glucose 6-Phosphate Dehydrogenase, Adv. Synth. Catal. 2006, 348, 429-433. 149. C. V. Voss, C. C. Gruber, K. Faber, T. Knaus, P. Macheroux, W. Kroutil, Orchestration Of Concurrent Oxidation And Reduction Cycles For Stereoinversion And Deracemisation Of Sec-Alcohols, J. Am. Chem. Soc. 2008, 130, 13969-13972. 150. A. Bruggink, R. Schoevaart, T. Kieboom, Concepts Of Nature In Organic Synthesis: Cascade Catalysis And Multistep Conversions In Concert, Org. Process Res. Dev. 2003, 7, 622-640. 151. J.-C. Wasilke, S. J. Obrey, R. T. Baker, G. C. Bazan, Concurrent Tandem Catalysis, Chem. Rev. 2005, 105, 1001-1020. 152. B. Breit, S. K. Zahn, Stereoselective Hydroformylation, Cuprate Addition And Domino Reactions With The Aid Of A Catalyst Directing Group, Polyhedron 2000, 19, 513-515. 153. S. Kallstrom, A. Erkkila, P. M. Pihok, R. Sjoholm, R. Sillanpaa, R. Leino, Consecutive Proline-Catalyzed Aldol Reactions And Metal-Mediated Allylations: Rapid Entries To Polypropionates, Synlett. 2005, 751-756. 154. H. M. Jung, J. H. Koh, M.-J. Kim, J. Park, Practical Ruthenium/LipaseCatalyzed Asymmetric Transformations Of Ketones And Enol Acetates To Chiral Acetates, Org. Lett. 2000, 2, 2487-2490. 158 155. R. P. Limberger, C. V. Ursini, P. J. S. Moran, J. A. R. Rodrigues, Enantioselective Benzylic Microbial Hydroxylation Of Indan And Tetralin, J. Mol. Catal. B: Enzym. 2007, 46, 37-42. 156. D. Jung, C. Streb, M. Hartmann, Oxidation Of Indole Using Chloroperoxidase And Glucose Oxidase Immobilized On Sba-15 As Tandem Biocatalyst, Micropor. Mesopor. Mater. 2008, 113, 523-529. 157. K. Seelbach, U. Kragl, Nanofiltration Membranes For Cofactor Retention In Continuous Enzymatic Synthesis, Enzyme Microb. Technol. 1997, 20, 389392. 158. Y. Xu, X. Jia, S. Panke, Z. Li, Asymmetric Dihydroxylation Of Arylolefins By Sequential Enantioselective Epoxidation And Regioselective Hydrolysis With Tandem Biocatalysts, Chem. Commun. 2009, 1481-1483. 159. M. Rueping, M. Albert, D. Seebach, On The Structure Of PHB (poly[(R)3-Hydroxybutanoic Acid]) In Phospholipid Bilayers: Preparation Of Trifluoromethyl-labeled Oligo[(R)-3-Hydroxybutanoic Acid] Derivatives, Helv. Chim. Acta. 2004, 87, 2473-2486. 160. M. Ferrer, F. Sánchez-Baeza, A. Messeguer, Preparation Of Amine NOxides By Using Dioxiranes, Tetrahedron 1997, 53, 15877-15888. 161. M. Miyauchi, R. Endo, M. Hisaoka, H. Yasuda, I. Kawamoto, Synthesis And Structure-Activity Relationships Of A Novel Oral Carbapenem, CS-834, J. Antiobiot. 1997, 50, 429-439. 162. H. Zhao, W. A. van der Donk, Regeneration Of Cofactor For Use In Biocatalysis, Curr. Opin. Biotechnol. 2003, 14, 1-7. 159 163. M. Eckstein, M. V. Filho, A. Liese, U. Kragl, Use Of An Ionic Liquid In A Two-Phase System To Improve An Alcohol Dehydrogenase Catalysed Reduction, Chem. Comm. 2004, 1084-1085. 164. M. V. Filho, T. Stillger, M. Muller, A. Liese, C. Wandrey, Is Log P A Convenient Criterion To Guide The Choice Of Solvents For Biphasic Enzymatic Reactions? Angew. Chem. Int. Ed. 2003, 42, 2993-2996. 165. W. Stampfer, B. Kosjek, C. Moitzi, W. Kroutil, K. Faber, Biocatalytic Asymmetric Hydrogen Transfer, Angew. Chem. Int. Ed. 2002, 41, 1014-1017. 166. M. J. De Smet, J. Kingma, B. Witholt, The Effect Of Toluene On The Structure And Permeability Of The Outer And Cytoplasmic Membranes Of Escherichia coli, Biochim. Biophys. Acta. 1978, 506, 64-80. 167. J. Zhang, W. A. Duetz, B. Witholt, Z. Li, Fast Identification Of (R)- And (S)-Enantioselective Bacterial Alcohol Dehydrogenases For Asymmetric Reduction Of ß-Ketoesters, Chem. Commun. 2004, 2120-2121. 168. G. Emilien, Befloxatone, Befloxatone (Synthelabo), Idrugs 1999, 2, 247253. 169. S. P. Denyer, J.-Y. Maillard, Cellular Impermeability And Uptake Of Biocides And Antibiotics In Gram-Negative Bacteria, J. Appl. Microbiol. Symposium Supplement 2002, 92, 35S- 45S. 170. M. M. Bradford, A Rapid And Sensitive Method For The Quantitation Of Microgram Quantities Of Protein Utilizing The Principle Of Protein-Dye Binding, Anal. Biochem. 1976, 72, 248-254. 171. H. Lineweaver, D. Burk, The Determination Of Enzyme Dissociation Constants, J. Am. Chem. Soc. 1934, 56, 658-666. 160 172. J. A. Labinger, J. E. Bercaw, Understanding And Exploiting C–H Bond Activation, Nature 2002, 417, 507-514. 173. M. Costas, K. Chen, L. Que Jr., Biomimetic Nonheme Iron Catalysts For Alkane Hydroxylation, Coordination Chem. Rev. 2000, 200-202, 517- 544. 174. A. E. Shilov, G. B. Shul’pin, Activation and catalytic reactions of Saturated Hydrocarbons in the presence of Metal Complexes; Kluwer Academic: Dordrecht, 2000. 175. A. Sen, Catalytic Functionalization Of Carbon-Hydrogen And CarbonCarbon Bonds In Protic Media, Acc. Chem. Res. 1998, 31, 550-557. 176. T. G. Traylor, K. W. Hill, W. P. Fann, S. Tsuchiya, B. E. Dunlap, Aliphatic Hydroxylation Catalyzed By Iron(III) Porphyrins, J. Am. Chem. Soc. 1992, 114, 1308-1312. 177. J. T. Groves, G. A. McClusky, R. E. White, M. J. Coon, Aliphatic Hydroxylation By Highly Purified Liver Microsomal Cytochrome P-450. Evidence For A Carbon Radical Intermediate, Biochem. Biophys. Res. Commun. 1978, 81, 154-160. 178. S. Copinga, P. G. Tepper, C. J. Grol, A. S. Horn, M. L. Dubocovich, 2Amido-8-Methoxytetralins: A Series Of Nonindolic Melatonin-Like Agents, J. Med. Chem. 1993, 36, 2891-2898. 179. G. de Gonzalo, I. Lavandera, K. Durchschein, D. Wurm, K. Faber, W. Kroutil, Asymmetric Biocatalytic Reduction Of Ketones Using HydroxyFunctionalised Water-Miscible Ionic Liquids As Solvents, Tetrahedron: Asymmetry, 2007, 18, 2541-2546. 161 180. F. Zaccheria, N. Ravasio, M. Ercolic, P. Allegrini, Heterogeneous CuCatalysts For The Reductive Deoxygenation Of Aromatic Ketones Without Additives, Tetrahedron Lett. 2005, 46, 7743-7745. 181. J. S. Yadav, G. S. K. K. Reddy, G. Sabitha, A. D. Krishna, A. R. Prasad, H. U. R. Rahaman, K. V. Rao, A. B. Rao, Daucus carota And Baker's Yeast Mediated Bio-Reduction Of Prochiral Ketones, Tetrahedron: Asymmetry 2007, 18, 717-723. 182. J. A. Elings, R. S. Downing, R. A. Sheldon, Cyclialkylation Of Aralkyl Epoxides With Solid Acid Catalysts, Eur. J. Org. 1999, 837-846. 183. J. M. Lee, Y. Na, H. Han, S. Chang, Cooperative Multi-Catalyst Systems For One-Pot Organic Transformations, Chem. Soc. Rev. 2004, 33, 302-312. 184. D. Y. Murzin, R. Leino, Sustainable Chemical Technology Through Catalytic Multistep Reactions, Chem. Eng. Res. Des. 2008, 86, 1002-1010. 185. A. Ajamian, J. L. Gleason, Two Birds With One Metallic Stone: Singlepot Catalysis Of Fundamentally Different Transformations, Angew. Chem. Int. Ed. 2004, 43, 3754-3760. 186. K. E. Liu, C. C. Johnson, M. Newcomb, S. J. Lippard, Radical Clock Substrate Probes And Kinetic Isotope Effect Studies Of The Hydroxylation Of Hydrocarbons By Methane Monooxygenase, J. Am. Chem. Soc. 1993, 115, 939-947. 187. M. Merkx, D. A. Kopp, M. H. Sazinsky, J. L. Blazyk, J. Muller, S. J. Lippard, Dioxygen Activation And Methane Hydroxylation By Soluble Methane Monooxygenase: A Tale Of Two Irons And Three Proteins, Angew. Chem. Int. Ed. 2001, 40, 2782-2807. 162 188. J. B. van Beilen, J. Kingma, B. Witholt, Substrate Specificity Of The Alkane Hydroxylase System Of Pseudomonas oleovorans GPo1, Enzyme Microb. Technol. 1994, 16, 904-911. 189. R. T. Ruettinger, G. R. Griffith, M. J. Coon, Characterization Of The Omega-Hydroxylase Of Pseudomonas oleovorans As A Nonheme Iron Protein, Arch. Biochem. Biophys. 1997, 183, 528-533. 190. J. A. Peterson, D. Basu, M. J. Coon, Enzymatic '-Oxidation. I. Electron Carriers In Fatty Acid And Hydrocarbon Hydroxylation, J. Biol. Chem. 1996, 241, 5162-5164. 191. J. F. Almeida, J. Anaya, N. Martin, M. Grande, J. R. Moran, M. C. Caballero, New Enantioselective Synthesis Of 4-Hydroxy-2-OxopyrrolidineN-Acetamide (Oxiracetam) From Malic Acid, Terrahedron: Asymmetry 1992, 3, 1431-1440. 192. T. Omura, R. Sato, The Carbon Monoxide Binding Pigment Of Liver Microsomes. II. Solubilisation, Purification, Properties, J. Biol. Chem. 1964, 239, 2379-2385. 193. J. B. van Beilen, R. Holtackers, D. Luscher, U. Bauer, B. Witholt, W. A. Duetz, Biocatalytic Production Of Perillyl Alcohol From Limonene By Using A Novel Mycobacterium sp. Cytochrome P450 Alkane Hydroxylase Expressed In Pseudomonas putida, Appl. Environ. Microb. 2005, 71, 17371744. 194. L. P. Wen, A. J. Fulco, Cloning Of The Gene Encoding A Catalytically Self-Sufficient Cytochrome P-450 Fatty Acid Monooxygenase Induced By Barbiturates In Bacillus megaterium And Its Functional Expression And 163 Regulation In Heterologous (Escherichia coli) And Homologous (Bacillus megaterium) Hosts, J. Biol. Chem. 1987, 262, 6676-1987. 195. T. Mouri, J. Michizoe, H. Ichinose, N. Kamiya, M. Goto, A Recombinant Escherichia Coli Whole Cell Biocatalyst Harboring A Cytochrome P450cam Monooxygenase System Coupled With Enzymatic Cofactor Regeneration, Appl. Microbiol. Biotechnol. 2006, 72, 514-520. 196. J. Nowicki, Claisen, Cope And Related Rearrangements In The Synthesis Of Flavour And Fragrance Compounds, Molecules 2000, 5, 1033-1050. 197. D. Busmann, R. G. Berger, Oxyfunctionalization Of Alpha- And BetaPinene By Selected Basidiomycetes, Z. Naturforsch., C: Biosci. 1994, 49, 545552. 198. M. Lindmark-Henriksson, D. Isaksson, T. Vanek, I. Valterova, H. E. Hogberg, K. Sjodin, Transformation Of Terpenes Using A Picea abies Suspension Culture, J. Biotechnol. 2004, 107, 173-184. 199. R. I. Duclos Jr, D. Lu, J. Guo, A. Makriyannis, Synthesis And Characterization Of 2-Substituted Bornane Pharmacophores For Novel Cannabinergic Ligands, Tetrahedron Lett. 2008, 49, 5587-5589. 200. M. Eda, T. Takemoto, S. Ono, T. Okada, K. Kosaka, M. Gohda, S. Matzno, N. Nakamura, C. Fukaya, Novel Potassium-channel Openers: Preparation And Pharmacological Evaluation Of Racemic And Optically Active N-(6-amino-3-pyridyl)-N'-bicycloalkyl-N"-cyanoguanidine Derivatives, J. Med. Chem. 1994, 37, 1983-1990. 201. T. D. Ashton, S. P. Baker, Sally A. Hutchinson, P. J. Scammells, N6Substituted C5'-modified Adenosines As A1 Adenosine Receptor Agonists, Bioorgan. Med. Chem. 2008, 16, 1861-1873. 164 202. F. Alonso, P. Riente, M. Yus, Hydrogen-Transfer Reduction Of Carbonyl Compounds Catalysed By Nickel Nanoparticles, Tetrahedron Lett. 2008, 49, 1939-1942. 203. A. Clerici, N. Pastori, O. Porta, Reduction Of Aliphatic And Aromatic Cyclic Ketones To Sec-Alcohols By Aqueous Titanium Trichloride/Ammon-ia System. Steric Course And Mechanistic Implications, Eur. J. Org. Chem. 2001, 2235-2243. 204. P. D. de Koning, M. Jackson, I. C. Lennon, Use Of Achiral (Diphosphine)RuCl(Diamine) Precatalysts As A Practical Alternative To Sodium Borohydride For Ketone Reduction, Org. Process Res. Dev. 2006, 10, 1054-1058. 205. I. Kamiya, A. Ogawa, Palladium Catalyzed Reduction Of Ketones With n Bu2SnH2, Tetrahedron Lett. 2002, 43, 1701-1703. 206. F. Yoshizako, A. Nishimura, M. Chubachi, M. Kirihata, Microbial Reduction Of 2-Norbornanone By Chlorella, J. Ferment. Bioeng. 1996, 82, 601-603. 207. A. E. Shilov, G. B. Shul'pin, Activation Of C-H Bonds By Metal Complexes, Chem. Rev. 1997, 97, 2879-2932. 208. D. H. R. Barton, D. Doller, The Selective Functionalization Of Saturated Hydrocarbons: Gif Chemistry, Acc. Chem. Res. 1992, 25, 504-512. 209. S. G. Burton, Oxidizing Enzymes As Biocatalysts, Trends Biotechnol. 2003, 21, 543-549. 210. A. Raadt, H. Griengl, The Use Of Substrate Engineering In Biohydroxylation, Curr. Opin. Biotechnol. 2002, 13, 537-542. 165 211. H. L Holland, H. K Weber, Enzymatic Hydroxylation Reactions, Curr. Opin. Biotechnol. 2000, 11, 547-553. 212. H. L. Holland, Recent Advances In Applied And Mechanistic Aspects Of The Enzymatic Hydroxylation Of Steroids By Whole-Cell Biocatalysts, Steroids 1999, 64, 178-186. 213. Y. Chen, J. Xu, X. Xu, Y. Xia, H. Lin, S. Xia, L. Wang, Enantiocomplementary Preparation Of (S)- And (R)-Mandelic Acid Derivatives Via !-Hydroxylation Of 2-Arylacetic Acid Derivatives And Reduction Of !-Ketoester Using Microbial Whole Cells, Tetrahedron: Asymmetry 2007, 18, 2537-2540. 214. H. L. Holland, T. A. Morris, P. J. Nava, M. Zabic, A New Paradigm For Biohydroxylation By Beauveria bassiana ATCC 7159, Tetrahedron 1999, 55, 7441-7460. 215. G. Braunegg, A. Raadt, S. Feichtenhofer, H. Griengl, I. Kopper, A. Lehmann, H. Weber, The Concept Of Docking/Protecting Groups In Biohydroxylation, Angew. Chem. Int. Ed. 1999, 38, 2763-2765. 216. A. Raadt, H. Griengl, H. J. Weber, The Concept Of Docking And Protecting Groups In Biohydroxylation, Chem. Eur. J. 2001, 7, 27-31. 217. A. Uzura, T. Katsuragi, Y. Tani, Conversion Of Various Aromatic Compounds By Resting Cells Of Fusarium moniliforme Strain MS31, J. Biosci. Bioeng. 2001, 92, 381-384. 218. N. I. Bowers, D. R. Boyd, N. D. Sharma, P. A. Goodrich, M. R. Groocock, A. J. Blacker, P. Goode, H. Dalton, Stereoselective Benzylic Hydroxylation Of 2-Substituted Indanes Using Toluene Dioxygenase As Biocatalyst, J. Chem. Soc., Perkin Trans. 1 1999, 1453-1461. 166 219. D. P. Cox, C. D. Goldsmith, Microbial Conversion Of Ethylbenzene To 1-Phenethanol And Acetophenone By Nocardia Tartaricans ATCC 31190, Appl. Environ. Microbiol. 1979, 38, 514-520. 220. D. A. Klein, J. A. Davis, L. E. Casida, Jr, Oxidation Of N-Alkanes To Ketones By An Arthrobacter Species, Antonie Van Leeuwenhoek 1968, 34, 495-503. 221. A. Shaabani, A. Rahmati, Aerobic Oxidation Of Alkyl Arenes Using A Combination Of N-Hydroxy Phthalimide And Recyclable Cobalt(II) Tetrasulfophthalocyanine Supported On Silica, Catal. Commun. 2008, 9, 1692-1697. 222. W. L. Tang, Z. Li, H. M. Zhao, Inverting the enantioselectivity of P450pyr monooxygenase by directed evolution, Chem. Commun. 2010, 46, 5461-5463. 223. A. Bangó, J. Halász, Oxidation Of Condensed Cyclic Hydrocarbons With H2O2 In The Presence Of Modified MCM-41 And SBA-15 Mesoporous Catalysts, React. Kinet. Catal. Lett. 2009, 96, 413-420. 224. C. Mahendiran, P. Sangeetha, P. Vijayan, S. J. Sardhar Basha, K. Shanthi, Vapour Phase Oxidation Of Tetralin Over Cr And Fe Substituted MCM-41 Molecular Sieves, J. Mol. Catal. A: Chem. 2007, 275, 84-90. 225. R. Neumann, A. M. Khenkin, Alkane Oxidation With Manganese Substituted Polyoxometalates In Aqueous Media With Ozone And The Intermediacy Of Manganese Ozonide Species, Chem. Commun. 1998, 19671968. 167 226. N. A. Noureldin, D. Y. Zhao, D. G. Lee, Heterogeneous Permanganate Oxidation 7. The Oxidation Of Aliphatic Side Chains, J. Org. Chem. 1997, 62, 8767-8772. 227. J. Kim, S. Bhattacharjee, K.-E. Jerong, S.-Y. Jerong, W.-S. Ahn, Selective Oxidation Of Tetralin Over A Chromium Terephthalate Metal Organic Framework, MIL-101, Chem. Commun. 2009, 3904-3906. 228. T. Dohi, N. Takenaga, A. Goto, H. Fujioka, Y. Kita, Clean And Efficient Benzylic C"H Oxidation In Water Using A Hypervalent Iodine Reagent: Activation Of Polymeric Iodosobenzene With Kbr In The Presence Of Montmorillonite-K10, J. Org. Chem. 2008, 73, 7365-7368. 229. K. C. Nicolaou, P. S. Baran, Y. L. Zhong, Selective Oxidation At Carbon Adjacent To Aromatic Systems With IBX, J. Am. Chem. Soc. 2001, 123, 3183-3185. 230. B. Bahramian, F. D. Ardejani, V. Mirkhani, , K. Badii, DiatomiteSupported Manganese Schiff Base: An Efficient Catalyst For Oxidation Of Hydrocarbons, Appl. Catal. A: Gen. 2008, 345, 97-103. 231. S. E. Dapurkar, H. Kawanami, T. Yokoyama, Y. Ikushima, Highly Selective Oxidation Of Tetralin To 1-Tetralone Over Mesoporous Crmcm-41 Molecular Sieve Catalyst Using Supercritical Carbon Dioxide, New J. Chem. 2009, 33, 538-544. 232. B. M. Choudary, A. D. Prasad, V. Bhuma, V. Swapna, ChromiumPillared Clay As A Catalyst For Benzylic Oxidation And Oxidative Deprotection Of Benzyl Ethers And Benzylamines: A Simple And Convenient Procedure, J. Org. Chem. 1992, 57, 5841-5844. 168 233. D. R. Boyd, N. D. Sharma, P. J. Stevenson, J. Chima, D. J. Gray, H. Dalton, Bacterial Oxidation Of Benzocyloalkenes To Yield Monol, Diol And Triol Metabolites, Tetrahedron Lett. 1991, 32, 3887-3890. 234. A. F. Schreiber, U. K. Winkler, Transformation Of Tetralin By Whole Cells Of Pseudomonas stutzeri, Eur. J. Appl. Microbiol. Biotechnol. 1983, 18, 6-10. 235. C. W. Bradshaw, W. Hummel, C. H. Wong, Lactobacillus Kefir Alcohol Dehydrogenase: A Useful Catalyst For Synthesis, J. Org. Chem. 1992, 57, 1532-1536. 236. A. Weckbecker, W. Hummel, Cloning, Expression, And Characterization Of An (R)-Specific Alcohol Dehydrogenase From Lactobacillus kefir, Biocatal. Biotransform. 2006, 24, 380-389. 237. R. J. Cregge, E. R. Wagner, J. Freedman, A. L. Margolin, LipaseCatalyzed Transesterification In The Synthesis Of A New Chiral Unlabeled And Carbon-14 Labeled Serotonin Uptake Inhibitor, J. Org. Chem. 1990, 55, 4237-4238. 238. C. Morrill, N. S. Mani, Synthesis Of 4-Arylpiperidines From 1-Benzyl-4Piperidone: Application Of The Shapiro Reaction And Alkenylsilane CrossCoupling, Org. Lett. 2007, 9, 1505-1508. 239. Y. S. Lee, J. Nyberg, S. Moye, R. S. Agnes, P. Davis, S.-W. Ma, J. Lai, F. Porreca, R. Vardanyan, V. J. Hruby, Understanding The Structural Requirements Of 4-Anilidopiperidine Analogues For Biological Activities At % And ( Opioid Receptors, Bioorg. Med. Chem. Lett. 2007, 17, 2161-2165. 240. N. Kizaki, T. Nishiyama, Y. Yasohara, Novel Carbonyl Reductase, Gene Thereof And Method Of Using The Same, US 2007/0178565 A1, 2007. 169 APPENDICES Pubilication of Journal Papers • Wei Zhang, Weng Lin Tang, Daniel I. C. Wang, and Zhi Li, Concurrent Oxidations with Tandem Biocatalysts in One Pot: Green, Selective and Clean Oxidations of Methylene Groups to Ketones, Chemical Communications, 47, 3284-3286, 2011. • Wei Zhang, Weng Lin Tang, Zunsheng Wang, and Zhi Li, Regio- and Stereoselective Biohydroxylations with a Recombinant Escherichia coli Expressing P450pyr Monooxygenase of Sphingomonas sp. HXN-200, Advanced Synthesis & Catalysis, 352 (18), 3380-3390, 2010. • Wei Zhang, Kevin O' Connor, Daniel I. C. Wang, and Zhi Li, Efficient Recycling of NADPH in Enantioselective Bioreduction with Coupled Permeabilized Microorganisms, Applied and Environmental Microbiology, 75, 687-694, 2009. (Highlight Paper) 170 Conference Presentations • Development of Tandem Biocatalysts Systems for Selective Sequential Oxidations with Cofactor Regeneration, Oral presentation, SMA 11st Annual Symposium, Singapore, 2010. • Novel Tandem Biocatalysts Systems for Practical Selective Sequential Oxidations, Poster presentation, 239th ACS National Meeting & Exposition, San Francisco, USA, 2010. • Bioreduction with Efficient Recycling of NADPH by Coupled Permeabilized Microorganisms, Oral presentation, SMA 10th Anniversary Symposium, Singapore, 2009. • Bioreduction by Coupled Permeabilized Microorganisms, Poster presentation, Biocat 2008, Hamburg, Germany, 2008. • Efficient NADPH Recycling in Enantioselective Bioreduction of a Ketone with Coupled Permeabilized Cells, Oral presentation, 5th International Symposium on Nanomanufacturing, Singapore, 2008. • Efficient NADPH Recycling in Enantioselective Bioreduction of a Ketone with Coupled Permeabilized Cells, Poster presentation, SMA-CPE Minisymposium, Singapore, 2007. 171 [...]... TTN for cofactor recycling and final product concentration in this bioreduction system by enhancing the activity of the cofactor regenerating strain Because nicotinamide cofactor normally has a half-life time about 24 h in reaction system, by increasing the activity of cofactor regenerating strain, more products could be produced before the cofactor completely decomposes, thus leading to higher TTN for. .. vs tandem catalysis 1.2 Objective and Approach The main purpose of this thesis is to develop novel and efficient biocatalytic systems for oxidoreductions in pharmaceutical synthesis More specifically: 1) We aim to develop an efficient bioreduction system with cofactor recycling by coupling two permeabilized microogransims 5 Previously, we developed a novel method for efficient bioreduction with cofactor... reactions in the same mild conditions, thus avoiding the timeconsuming, yield-decreasing, and waste-producing isolation and purification of intermediates (Fig.1.4) Tandem biocatalysis is regarded as an important direction for sustainable chemical and pharmaceutical synthesis, and gaining more and more attention.45-53 Although in nature, it is quite common that a single microorganism that contains multiple... for cofactor recycling Firstly, we construct a recombinant strain for cofactor recycling with improved activity by choosing suitable plasmid, suitable host cell, and expression optimization Then, we permeabilize the new cofactor recycling strain and couple it with permeabilized bioredcution strain in order to achieve higher TTN and increased final product concentration 2) We aim to engineer a recombinant... is greatly demanded in pharmaceutical and chemical industries Green chemistry, also called sustainable chemistry, can be conveniently defined as: the efficient utilization of (preferably renewable) raw materials, elimination of waste and avoiding the use of toxic and/ or hazardous reagents and solvents in the manufacture and application of chemical products 45,90 Furthermore, the use of enzymes generally... of CFE of E coli (P450pyr) non-induced (lane 1), induced with IPTG for 2 h (lane 2), 3 h (lane 3), 4 h (lane 4), and 5 h (lane 5) 97 Figure 4.3 CO difference spectra of CFEs of E coli (P450pyr): (") noninduced; ( -) induced with IPTG for 3 h 98 Figure 4.4 Time course of the formation of (S)-N-benzyl-4-hydroxypyrrolidin-2-one 2 in biohydroxylation of N-benzyl pyrrolidine-2-one 1 with resting... and using tetralin as substrate Moreover, “coupled substrate” acetone and small amount of NADP+ were added for simultaneously cofactor recycling By coupling 10+5 g cdw/L of P monteilii TA-5 with 3 g protein/L LKADH, 6 mM tetralin was completely converted within 30 h At the end point, pure 1-tetralone was produced in 5.25 mM with 87.5% yield, 99% regioselectivity, and a TTN of 2200 for NADP+ recycling... permeabilized cells of B pumilus Phe-C3 and a cofactorregenerating microorganism for bioreduction of ethyl 3-keto-4, 4, 4triflurobutyrate 1 with NADPH recycling 78 Table 3.3 Product formation in bioreduction of ethyl 3-keto-4,4,4-triflurobutyrate 1 with coupled permeabilized cells 81 Table 4.1 Kinetic constants of hydroxylation of 1 and 3 with CFE and resting cells of E coli (P450pyr),... cofactor recycling by coupling two permeabilized microorganisms, one containing keto-reductase, while the other containing glucose dehydrogenase (GDH).63 However, the total turnover number (TTN) for cofactor recycling and final product concentration were not high enough for practical application The main reason is the relative low activity of the whole cell biocatalyst for cofactor recycling We want to... 3a and 1-indanone 3b via tandem biocatalysis with NADP+ recycling in one pot 3a (%), (R)-2a ("), 3b (&) and (R)-2b (#) Reaction conditions: 6 mM 1a or 1b, 10+5 g cdw/L TA-5, 3.5 g protein/L LKADH, and 0.001 mM NADP+ 126 Figure 5.4 Selective sequential oxidations of indan 1b to 1-indanone 3b via tandem biocatalysis with NADP+ recycling in one pot A: 1-tetralone 3b standard, BA is internal standard