DESIGNING A SYNTHETIC TUMOUR SUPPRESSOR PROTEIN SEE HAI YUN (B.Sc with Hons), NUS A THESIS SUBMITTED FOR THE DEGREE OF DOCTOR OF PHILOSOPHY January 2009 Acknowledgments I would like to thank my supervisor Professor Sir David Lane for his guidance and advice It is my honour and pleasure to be able to join his lab where I have made many wonderful friends and experienced at first hand the fun of working with people from different parts of the world I would also like to deeply thank Dr David Coomber for his supervision and for always being there to motivate and encourage me Special thanks go out to the postdocs in both DPL and EBL labs that have helped me tremendously in my project and editing of the thesis It would have been a lot tougher if not for their advice and constant support Thank you very much! I would also like to thank all the friends I have made in IMCB and NGS for their friendship, support and encouragement A huge thank you to all the past and present members of DPL and EBL for making life in the lab so fun, lively and exciting! I will treasure the wonderful memories we all had together I am extremely grateful to all of you who have helped me in one way or another Last but not least, I would like to thank my family and friends for being there for me Thank you so much for your love and support i Abstract The use of protein aptamers for target validation is a relatively new approach whereby the activity of the target is inhibited at protein level The aim of this project was to develop bioactive protein aptamers that bind to eIF4E, a rate limiting translation initiation factor that is essential for the initiation of cap-dependent translation eIF4E has been implicated as a potential anti-cancer target as upregulation of eIF4E has been detected in a variety of cancers and the down-regulation of eIF4E has been shown to result in growth and tumour suppression Validation of the exact functions of eIF4E would therefore serve to further elucidate the suitability and potential of using eIF4E as target for anti-cancer therapy In this project, the potential of two proteins from different organisms (plant and Escherichia coli) as scaffolds for the construction of bioactive eIF4E binding aptamers were evaluated The binding affinities of the aptamers were found to be dependent on the type of scaffold used Rational design of the aptamers was carried out to improve binding in vitro, but the enhanced binding detected in vitro did not translate into bioactivity in cells A comparison was also made between synthetic protein aptamers constructed using scaffold proteins from a foreign origin and protein aptamers that were obtained from the modification of a human eIF4E-binding protein (4EBP1) The modified 4EBP1 aptamer was found to be more effective and stable in cellular based assays This comparison raises the possibility and highlights the potential of using human proteins as scaffolds for the construction of aptamers to circumvent issues with protein stability in vivo and immunogenicity if the aptamers were ever to be used for therapy ii Contents Page Introduction 1.1 Target validation and available techniques 1.2 The protein aptamer approach to target validation 1.2.1 Characteristics of a good scaffold protein 1.2.2 Advantages of constraining peptides in a scaffold protein 1.2.3 Examples of scaffold proteins used for construction of protein aptamers 1.2.4 Scaffold proteins used for the construction of aptamers 1.2.4.1 Chymotrypsin inhibitor 1.2.4.2 Thioredoxin A 13 1.3 Gene regulation by translation 17 1.4 Types of translation involved in protein synthesis 18 1.4.1 Cap dependent translation 19 1.4.2 Cap independent translation 20 1.5 Effects of mRNA structure on protein translation 22 1.6 The function and importance of eIF4E 25 1.6.1 Role of eIF4E in protein translation 25 1.6.2 Outcomes of eIF4E over expression 30 1.6.3 Outcomes of eIF4E inhibition 31 1.7 Endogenous binding proteins of eIF4E 34 1.8 Role of deregulated translation in carcinogenesis: eIF4E as an anti-cancer target 38 Material and methods 40 2.1 General 40 2.1.1 Materials 40 2.1.2 Methods 46 2.2 Cloning and characterization of eIF4E 50 2.3 Affinity-based precipitation of proteins using peptides (peptides pulldowns) 59 2.4 Aptamer Construction: CI2 61 2.5 Alternative aptamer: Thioredoxin 68 iii 2.6 Validation of nature’s own aptamer: 4EBP1 as an aptamer 86 Characterization of starting reagents and verification of eIF4E binding sequence91 3.1 Introduction and aims 91 3.2 Characterization of eIF4E in cells 92 3.3 Cloning of eIF4E into bacterial and mammalian expression vectors 93 3.4 eIF4E protein expression and purification 95 3.5 Characterization of eIF4E commercial antibodies 99 3.6 Affinity-based precipitation of proteins using peptides (peptide pulldown assay) 104 Protein aptamer construction using Chymotrypsin inhibitor as the scaffold 109 4.1 Introduction and aims 109 4.2 Construction of aptamer protein for interaction studies 110 4.2.1 Cloning of CI2 aptamers 110 4.2.2 Protein expression of CI2 aptamers 111 4.2.3 Purification of CI2 aptamers 115 4.3 Validation of the interaction of CI2 aptamers with eIF4E 118 4.3.1 Immunoprecipitation studies 118 4.3.2 Additional attempts at evaluating interaction 121 4.3.2.1 Chemical cross-linking 121 4.3.2.2 Gel filtration assay 124 4.3.3 m7GTP pulldown assays 127 4.4 Rational design to improve binding 132 4.4.1 Removal of extra residues and re-positioning of tag 132 4.4.2 Site-directed mutagenesis in scaffold and peptide 134 4.5 In vitro binding assays: m7GTP and Ni-NTA beads pulldown 139 4.6 In vivo assay: mammalian cell transfection 144 4.6.1 Low expression levels 145 iv Reconstruction of protein aptamers using Thioredoxin A as an alternative scaffold 151 5.1 Introduction and aims 151 5.2 Construction of aptamer protein for interaction studies 152 5.2.1 Cloning of Trx aptamers 152 5.2.2 Expression of Trx aptamers 154 5.2.3 Purification of Trx aptamers 155 5.3 In vitro assays for validation of the interaction between Trx aptamers and eIF4E and the stability of the aptamers 159 5.3.1 Pulldown assays using m7GTP beads and Ni-NTA beads 159 5.3.2 Fluorescence polarization assay 162 5.3.2.1 Validation of the fluorescein-conjugated peptide 163 5.3.2.2 Aptamer competition assays 166 5.3.3 Investigation of protein stability using thermal unfolding 169 5.4 Validation of aptamer activity in cellular based assays 171 5.4.1 Mammalian cell transfections and optimization of protein expression levels 173 5.4.2 Contact inhibition test: soft agar assay 174 Aptamer testing: tumourigenesis inhibition 182 6.1 Introduction and aims 182 6.2 Generation of transformed NIH3T3 cells 183 6.2.1 Transformation of NIH3T3 cells with eIF4E and Ras 183 6.2.2 Screening for genomic integration of transfected gene 185 6.2.3 Screening for protein over-expression 185 6.3 Transfection of transformed NIH3T3 cells with aptamers 188 6.3.1 Soft agar assay as an anchorage independence test for tumourigenicity 188 6.3.2 Foci formation assay as a contact inhibition test for tumourigenicity 190 6.4 Generation of the aptamers with new tags and in new vectors using Gateway technology 191 6.4.1 Antibiotic selection for integrated aptamers to investigate the effect of aptamer expression on cell growth 194 6.4.2 Streptavidin binding peptide (SBP) tag pulldowns for validation of protein interaction 197 v Validation of nature’s own aptamer: 4EBP1 as an aptamer 200 7.1 Introduction and aims 200 7.2 Construction of eIF4E binding aptamer using 4EBP1: modification of 4EBP1 to remove known regulation sites 201 7.2.1 Non-phosphorylable 4EBP1 aptamer 202 7.2.2 Non-eIF4E binding 4EBP1 aptamer controls 203 7.3 Transfection of mammalian cells with aptamers and observations of effects on GFP translation 204 7.4 In vivo cellular-based assays 207 7.4.1 Flow cytometry analysis of the cell cycle profile of aptamer transfected cells 207 7.4.2 Soft agar assay as an anchorage independence test for tumourigenicity 208 7.4.3 Foci formation assay as a contact inhibition test for tuourigenicity 210 7.4.3.1 Foci formation assay with Ras transformed NIH3T3 cells 210 7.4.3.2 Foci formation assay with eIF4E and E1A transformed NIH3T3 cells 211 7.5 Generation of WT 4EBP1 and non-phosphorylable 4EBP1 aptamer with new tags and in new vectors using Gateway technology 214 7.5.1 Antibiotic selection for integrated aptamer to investigate the effect of aptamer expression on cell growth 217 7.5.2 Generation of inducible cell lines with aptamer genes stably integrated 220 7.5.3 Streptavidin binding peptide pulldown 225 Discussion 229 References 234 10 Appendix 251 vi List of illustrations Chapter 1: Introduction 11 Diagram Three dimensional molecular structure of CI2 Diagram Stabalization of the reactive site loop by arginine residues extending towards the loop 12 Diagram Crystal structure of thioredoxin A 15 Diagram Simplified illustration of the translation initiation complex binding to other initiation factors to form the translation machinery required for unwinding and scanning of the mRNA for a start codon 20 Diagram Simplified diagram of cap-independent translation initiation at the IRES 21 Diagram Simplified illustration of the structure of an mRNA 22 Diagram 5’ UTR structures modeled for mRNA transcripts encoding proteins involved in proliferation and cell survival 24 Diagram The regulation of eIF4E translation initiation activity by signaling cascades activated by growth factors and mitogens 27 Diagram Differential translation preferences of mRNAs with increasing levels of eIF4E and therefore eIF4F activity 29 Diagram 10 Alignment of eIF4E binding sequences: YXXXXL∅ (where x is any residue and ∅ is a hydrophobic residue) is conserved for eIF4E binding proteins from mammalian to yeast and plants 35 Chapter 2: Materials and methods Diagram 11 Picture of pET19b plasmid with eIF4E gene insertion between XhoI and BamHI at the multiple cloning site (MCS) 52 Diagram 12 Picture of pcDNA3 plasmid with eIF4E gene insertion between BamHI and XhoI at the multiple cloning site (MCS) 54 Diagram 13 Insertion of annealed oligos into the RsrII cleaved pET32a vector The thioredoxin aptamers were constructed in frame with the C-terminal His tag available in the vector 71 Diagram 14 Layout of the cells plated for the measurement and construction of the growth curve for 4EBP1 aptamers stably transfected inducible cell lines 90 Chapter 3: Characterization of starting reagents and verification of eIF4E binding sequence Diagram 15 Sequences of peptides designed and fused at the N–terminus to biotin 105 vii Chapter 4: Protein aptamer construction using Chymotrypsin inhibitor as the scaffold Diagram 16 Construction of Chymotrypsin inhibitor (CI2) aptamers 111 Diagram 17 Crystal structure of Chymotrypsin inhibitor 121 Diagram 18 Expected results of the cross-linking experiment between CI2 and eIF4E on a coomassie stained gel 122 Diagram 19 The crystal structure of eIF4E bound to m7GTP cap, demonstrating the binding site for eIF4G and 4E-BP1 132 Diagram 20 Removal of the extra N-terminal amino acids and shifting of the FLAG tag from C-terminal to N-terminal from FL-CI2-eIF4G 133 Diagram 21 Rational redesign of Chymotrypsin inhibitor (CI2) aptamers 136 Diagram 22 (I) Diagram of the structure of Chymotrypsin inhibitor aptamer with the two arginine residues protruding and interacting with the peptide presentation loop (II) Diagram of modified CI2 aptamer (CI2-R(65,67)A-eIF4G) after site directed mutagenesis to remove the arginines interfering with peptide presentation 137 Diagram 23 Re-construction of Chymotrypsin inhibitor by site-directed mutagenesis 145 Chapter 5: Reconstruction of protein aptamers using Thioredoxin A as an alternative scaffold Diagram 24 Structure of eIF4GI peptide in the binding grove of eIF4E 153 Diagram 25 Peptide sequences inserted into the active site loop of thioredoxin A (TrxA) 154 Chapter 6: Aptamer testing: tumourigenesis inhibition Diagram 26 A simplified illustration of the GW destination vectors used for cloning of the thioredoxin aptamers 192 Chapter 7: Validation of nature’s own aptamer: 4EBP1 as an aptamer Diagram 27 Site directed mutagenesis of the phosphorylation sites on wild type 4EBP1 (WT 4EBP1) that leads to the dissociation of 4EBP1 from eIF4E 202 Diagram 28 Construction of modified 4EBP1 aptamers and its non-binding controls 203 Diagram 29 Cloning of the 4EBP1 aptamers into gateway destination vectors 215 viii List of Tables Chapter 1: Introduction Table Examples of successful applications of using Thioredoxin A as the scaffold for construction of binding aptamers (Modified from Woodman R et al, 2005) 16 Chapter 2: Materials and methods Table List of antibodies used 43 Table List of enzymes used 45 Table Reagents for setting up a sequencing reaction 49 Table Cycle conditions for sequencing reaction 49 Table Reagents added to PCR mixture 50 Table PCR conditions for amplification of eIF4E from a pool of cDNA 51 Table Reaction mixture for double digestion of eIF4E PCR product 51 Table Reagents required for ligation of eIF4E into pET19b vector 53 Table 10 Restriction enzyme screening reaction mixture for pET19b with eIF4E insert 53 Table 11 PCR mutagenesis reaction mixture 66 Table 12 Cycling conditions for PCR mutagenesis 67 Table 13 Restriction enzyme digestion of thioredoxin with Rsr II 68 Table 14 Alkaline phosphatase treatment of digested pET32a vetor to remove the 5’phosphate 69 Table 15 PCR reaction mixture to screen for integrated eIF4E gene in the genomic DNA of isolated stable clones 79 Table 16 PCR conditions for screening genomic DNA for integrated eIF4E in pcDNA3 vector 79 Table 17 PCR reaction mixture for Gateway cloning amplification 83 Table 18 PCR conditions for amplifying thioredoxin with GW specific primers and for introducing the GW recombination sites using adaptor primers 83 ix Chapter References 71 Clemens,M.J & Bommer,U.A Translational control: the cancer connection Int J Biochem Cell Biol 31, 1-23 (1999) 72 Merrick,W.C Cap-dependent and cap-independent translation in eukaryotic systems Gene 332, 1-11 (2004) 73 Jackson,R.J Alternative mechanisms of initiating translation of mammalian mRNAs Biochem Soc Trans 33, 1231-1241 (2005) 74 Kozak,M Structural features in eukaryotic mRNAs that modulate the initiation of translation J Biol Chem 266, 19867-19870 (1991) 75 Gray,N.K & Wickens,M Control of translation initiation in animals Annu Rev Cell Dev Biol 14, 399-458 (1998) 76 van der Velden,A.W & Thomas,A.A The role of the 5' untranslated region of an mRNA in translation regulation during development Int J Biochem Cell Biol 31, 87-106 (1999) 77 Pain,V.M Initiation of protein synthesis in eukaryotic cells Eur J Biochem 236, 747-771 (1996) 78 Gingras,A.C., Raught,B & Sonenberg,N eIF4 initiation factors: effectors of mRNA recruitment to ribosomes and regulators of translation Annu Rev Biochem 68, 913-963 (1999) 79 Sonenberg,N., Morgan,M.A., Merrick,W.C & Shatkin,A.J A polypeptide in eukaryotic initiation factors that crosslinks specifically to the 5'-terminal cap in mRNA Proc Natl Acad Sci U S A 75, 4843-4847 (1978) 80 Prevot,D., Darlix,J.L & Ohlmann,T Conducting the initiation of protein synthesis: the role of eIF4G Biol Cell 95, 141-156 (2003) 81 Morley,S.J., Curtis,P.S & Pain,V.M eIF4G: translation's mystery factor begins to yield its secrets RNA 3, 1085-1104 (1997) 82 Rogers,G.W., Jr., Richter,N.J., Lima,W.F & Merrick,W.C Modulation of the helicase activity of eIF4A by eIF4B, eIF4H, and eIF4F J Biol Chem 276, 3091430922 (2001) 83 Rogers,G.W., Jr., Richter,N.J & Merrick,W.C Biochemical and kinetic characterization of the RNA helicase activity of eukaryotic initiation factor 4A J Biol Chem 274, 12236-12244 (1999) 84 Bi,X., Ren,J & Goss,D.J Wheat germ translation initiation factor eIF4B affects eIF4A and eIFiso4F helicase activity by increasing the ATP binding affinity of eIF4A Biochemistry 39, 5758-5765 (2000) 239 Chapter References 85 Pestova,T.V et al Molecular mechanisms of translation initiation in eukaryotes Proc Natl Acad Sci U S A 98, 7029-7036 (2001) 86 Kozak,M The scanning model for translation: an update J Cell Biol 108, 229241 (1989) 87 Hellen,C.U & Sarnow,P Internal ribosome entry sites in eukaryotic mRNA molecules Genes Dev 15, 1593-1612 (2001) 88 Pelletier,J & Sonenberg,N Internal initiation of translation of eukaryotic mRNA directed by a sequence derived from poliovirus RNA Nature 334, 320-325 (1988) 89 Fernandez-Miragall,O & Martinez-Salas,E Structural organization of a viral IRES depends on the integrity of the GNRA motif RNA 9, 1333-1344 (2003) 90 Martinez-Salas,E., Lopez,d.Q., Ramos,R & Fernandez-Miragall,O IRES elements: features of the RNA structure contributing to their activity Biochimie 84, 755-763 (2002) 91 Baird,S.D., Turcotte,M., Korneluk,R.G & Holcik,M Searching for IRES RNA 12, 1755-1785 (2006) 92 Lomakin,I.B., Hellen,C.U & Pestova,T.V Physical association of eukaryotic initiation factor 4G (eIF4G) with eIF4A strongly enhances binding of eIF4G to the internal ribosomal entry site of encephalomyocarditis virus and is required for internal initiation of translation Mol Cell Biol 20, 6019-6029 (2000) 93 Pestova,T.V., Shatsky,I.N & Hellen,C.U Functional dissection of eukaryotic initiation factor 4F: the 4A subunit and the central domain of the 4G subunit are sufficient to mediate internal entry of 43S preinitiation complexes Mol Cell Biol 16, 6870-6878 (1996) 94 Kolupaeva,V.G., Pestova,T.V & Hellen,C.U An enzymatic footprinting analysis of the interaction of 40S ribosomal subunits with the internal ribosomal entry site of hepatitis C virus J Virol 74, 6242-6250 (2000) 95 Otto,G.A & Puglisi,J.D The pathway of HCV IRES-mediated translation initiation Cell 119, 369-380 (2004) 96 Pestova,T.V., Lomakin,I.B & Hellen,C.U Position of the CrPV IRES on the 40S subunit and factor dependence of IRES/80S ribosome assembly EMBO Rep 5, 906-913 (2004) 97 Pestova,T.V & Hellen,C.U Translation elongation after assembly of ribosomes on the Cricket paralysis virus internal ribosomal entry site without initiation factors or initiator tRNA Genes Dev 17, 181-186 (2003) 240 Chapter References 98 Mignone,F., Gissi,C., Liuni,S & Pesole,G Untranslated regions of mRNAs Genome Biol 3, REVIEWS0004 (2002) 99 Grudzien,E., Kalek,M., Jemielity,J., Darzynkiewicz,E & Rhoads,R.E Differential inhibition of mRNA degradation pathways by novel cap analogs J Biol Chem 281, 1857-1867 (2006) 100 Pelletier,J & Sonenberg,N The involvement of mRNA secondary structure in protein synthesis Biochem Cell Biol 65, 576-581 (1987) 101 Svitkin,Y.V et al The requirement for eukaryotic initiation factor 4A (elF4A) in translation is in direct proportion to the degree of mRNA 5' secondary structure RNA 7, 382-394 (2001) 102 Shimogori,T., Suzuki,T., Kashiwagi,K., Kakinuma,Y & Igarashi,K Enhancement of helicase activity and increase of eIF-4E phosphorylation in ornithine decarboxylase-overproducing cells Biochem Biophys Res Commun 222, 748-752 (1996) 103 Zimmer,S.G., DeBenedetti,A & Graff,J.R Translational control of malignancy: the mRNA cap-binding protein, eIF-4E, as a central regulator of tumor formation, growth, invasion and metastasis Anticancer Res 20, 1343-1351 (2000) 104 De Benedetti,A & Harris,A.L eIF4E expression in tumors: its possible role in progression of malignancies Int J Biochem Cell Biol 31, 59-72 (1999) 105 Stoneley,M., Paulin,F.E., Le Quesne,J.P., Chappell,S.A & Willis,A.E C-Myc 5' untranslated region contains an internal ribosome entry segment Oncogene 16, 423-428 (1998) 106 Vagner,S et al Alternative translation of human fibroblast growth factor mRNA occurs by internal entry of ribosomes Mol Cell Biol 15, 35-44 (1995) 107 Stein,I et al Translation of vascular endothelial growth factor mRNA by internal ribosome entry: implications for translation under hypoxia Mol Cell Biol 18, 3112-3119 (1998) 108 Holcik,M., Sonenberg,N & Korneluk,R.G Internal ribosome initiation of translation and the control of cell death Trends Genet 16, 469-473 (2000) 109 Spriggs,K.A., Stoneley,M., Bushell,M & Willis,A.E Re-programming of translation following cell stress allows IRES-mediated translation to predominate Biol Cell 100, 27-38 (2008) 110 Raught,B & Gingras,A.C eIF4E activity is regulated at multiple levels Int J Biochem Cell Biol 31, 43-57 (1999) 241 Chapter References 111 Hiremath,L.S., Webb,N.R & Rhoads,R.E Immunological detection of the messenger RNA cap-binding protein J Biol Chem 260, 7843-7849 (1985) 112 Duncan,R., Milburn,S.C & Hershey,J.W Regulated phosphorylation and low abundance of HeLa cell initiation factor eIF-4F suggest a role in translational control Heat shock effects on eIF-4F J Biol Chem 262, 380-388 (1987) 113 Fahrenkrug,S.C., Dahlquist,M.O., Clark,K.J & Hackett,P.B Dynamic and tissue-specific expression of eIF4E during zebrafish embryogenesis Differentiation 65, 191-201 (1999) 114 Salaun,P et al eIF4E/4E-BP dissociation and 4E-BP degradation in the first mitotic division of the sea urchin embryo Dev Biol 255, 428-439 (2003) 115 Clemens,M.J Translational regulation in cell stress and apoptosis Roles of the eIF4E binding proteins J Cell Mol Med 5, 221-239 (2001) 116 Li,S et al Translation factor eIF4E rescues cells from Myc-dependent apoptosis by inhibiting cytochrome c release J Biol Chem 278, 3015-3022 (2003) 117 Polunovsky,V.A et al Translational control of programmed cell death: eukaryotic translation initiation factor 4E blocks apoptosis in growth-factorrestricted fibroblasts with physiologically expressed or deregulated Myc Mol Cell Biol 16, 6573-6581 (1996) 118 Ptushkina,M., von der,H.T., Karim,M.M., Hughes,J.M & McCarthy,J.E Repressor binding to a dorsal regulatory site traps human eIF4E in a high capaffinity state EMBO J 18, 4068-4075 (1999) 119 Petroulakis,E., Mamane,Y., Le Bacquer,O., Shahbazian,D & Sonenberg,N mTOR signaling: implications for cancer and anticancer therapy Br J Cancer 94, 195-199 (2006) 120 Mamane,Y et al eIF4E from translation to transformation Oncogene 23, 31723179 (2004) 121 Raught,B et al Phosphorylation of eucaryotic translation initiation factor 4B Ser422 is modulated by S6 kinases EMBO J 23, 1761-1769 (2004) 122 Hay,N & Sonenberg,N Upstream and downstream of mTOR Genes Dev 18, 1926-1945 (2004) 123 Pyronnet,S Phosphorylation of the cap-binding protein eIF4E by the MAPKactivated protein kinase Mnk1 Biochem Pharmacol 60, 1237-1243 (2000) 124 Silva,R.L & Wendel,H.G MNK, EIF4E and targeting translation for therapy Cell Cycle 7, 553-555 (2008) 242 Chapter References 125 Scheper,G.C & Proud,C.G Does phosphorylation of the cap-binding protein eIF4E play a role in translation initiation? Eur J Biochem 269, 5350-5359 (2002) 126 Lachance,P.E., Miron,M., Raught,B., Sonenberg,N & Lasko,P Phosphorylation of eukaryotic translation initiation factor 4E is critical for growth Mol Cell Biol 22, 1656-1663 (2002) 127 McKendrick,L., Morley,S.J., Pain,V.M., Jagus,R & Joshi,B Phosphorylation of eukaryotic initiation factor 4E (eIF4E) at Ser209 is not required for protein synthesis in vitro and in vivo Eur J Biochem 268, 5375-5385 (2001) 128 Lazaris-Karatzas,A et al Ras mediates translation initiation factor 4E-induced malignant transformation Genes Dev 6, 1631-1642 (1992) 129 Koromilas,A.E., Lazaris-Karatzas,A & Sonenberg,N mRNAs containing extensive secondary structure in their 5' non-coding region translate efficiently in cells overexpressing initiation factor eIF-4E EMBO J 11, 4153-4158 (1992) 130 Manni,A et al Influence of polyamines on in vitro and in vivo features of aggressive and metastatic behavior by human breast cancer cells Clin Exp Metastasis 19, 95-105 (2002) 131 Wang,T.C et al Mammary hyperplasia and carcinoma in MMTV-cyclin D1 transgenic mice Nature 369, 669-671 (1994) 132 Guo,S.S et al Frequent overexpression of cyclin D1 in sporadic pancreatic endocrine tumours J Endocrinol 179, 73-79 (2003) 133 Toyo-oka,K et al Mnt-deficient mammary glands exhibit impaired involution and tumors with characteristics of myc overexpression Cancer Res 66, 55655573 (2006) 134 Culjkovic,B., Topisirovic,I., Skrabanek,L., Ruiz-Gutierrez,M & Borden,K.L eIF4E promotes nuclear export of cyclin D1 mRNAs via an element in the 3'UTR J Cell Biol 169, 245-256 (2005) 135 Rousseau,D., Kaspar,R., Rosenwald,I., Gehrke,L & Sonenberg,N Translation initiation of ornithine decarboxylase and nucleocytoplasmic transport of cyclin D1 mRNA are increased in cells overexpressing eukaryotic initiation factor 4E Proc Natl Acad Sci U S A 93, 1065-1070 (1996) 136 Kerekatte,V et al The proto-oncogene/translation factor eIF4E: a survey of its expression in breast carcinomas Int J Cancer 64, 27-31 (1995) 137 Rosenwald,I.B et al Upregulation of protein synthesis initiation factor eIF-4E is an early event during colon carcinogenesis Oncogene 18, 2507-2517 (1999) 243 Chapter References 138 Rosenwald,I.B., Hutzler,M.J., Wang,S., Savas,L & Fraire,A.E Expression of eukaryotic translation initiation factors 4E and 2alpha is increased frequently in bronchioloalveolar but not in squamous cell carcinomas of the lung Cancer 92, 2164-2171 (2001) 139 Franklin,S et al Detection of the proto-oncogene eIF4E in larynx and hypopharynx cancers Arch Otolaryngol Head Neck Surg 125, 177-182 (1999) 140 Matthews-Greer,J et al eIF4E as a marker for cervical neoplasia Appl Immunohistochem Mol Morphol 13, 367-370 (2005) 141 Crew,J.P et al Eukaryotic initiation factor-4E in superficial and muscle invasive bladder cancer and its correlation with vascular endothelial growth factor expression and tumour progression Br J Cancer 82, 161-166 (2000) 142 Wang,S et al Expression of the eukaryotic translation initiation factors 4E and 2alpha in non-Hodgkin's lymphomas Am J Pathol 155, 247-255 (1999) 143 Miyagi,Y et al Elevated levels of eukaryotic translation initiation factor eIF-4E, mRNA in a broad spectrum of transformed cell lines Cancer Lett 91, 247-252 (1995) 144 Lazaris-Karatzas,A., Montine,K.S & Sonenberg,N Malignant transformation by a eukaryotic initiation factor subunit that binds to mRNA 5' cap Nature 345, 544-547 (1990) 145 Lazaris-Karatzas,A & Sonenberg,N The mRNA 5' cap-binding protein, eIF-4E, cooperates with v-myc or E1A in the transformation of primary rodent fibroblasts Mol Cell Biol 12, 1234-1238 (1992) 146 Li,B.D., Liu,L., Dawson,M & De Benedetti,A Overexpression of eukaryotic initiation factor 4E (eIF4E) in breast carcinoma Cancer 79, 2385-2390 (1997) 147 Sorrells,D.L et al Competitive PCR to detect eIF4E gene amplification in head and neck cancer Head Neck 21, 60-65 (1999) 148 Nathan,C.O et al Detection of the proto-oncogene eIF4E in surgical margins may predict recurrence in head and neck cancer Oncogene 15, 579-584 (1997) 149 Nathan,C.O et al Analysis of surgical margins with the molecular marker eIF4E: a prognostic factor in patients with head and neck cancer J Clin Oncol 17, 2909-2914 (1999) 150 Seki,N et al Expression of eukaryotic initiation factor 4E in atypical adenomatous hyperplasia and adenocarcinoma of the human peripheral lung Clin Cancer Res 8, 3046-3053 (2002) 244 Chapter References 151 Li,S et al Translation factor eIF4E rescues cells from Myc-dependent apoptosis by inhibiting cytochrome c release J Biol Chem 278, 3015-3022 (2003) 152 Wendel,H.G et al Survival signalling by Akt and eIF4E in oncogenesis and cancer therapy Nature 428, 332-337 (2004) 153 Wendel,H.G et al Determinants of sensitivity and resistance to rapamycinchemotherapy drug combinations in vivo Cancer Res 66, 7639-7646 (2006) 154 Hanahan,D & Weinberg,R.A The hallmarks of cancer Cell 100, 57-70 (2000) 155 Kentsis,A., Topisirovic,I., Culjkovic,B., Shao,L & Borden,K.L Ribavirin suppresses eIF4E-mediated oncogenic transformation by physical mimicry of the 7-methyl guanosine mRNA cap Proc Natl Acad Sci U S A 101, 18105-18110 (2004) 156 Yan,Y., Svitkin,Y., Lee,J.M., Bisaillon,M & Pelletier,J Ribavirin is not a functional mimic of the 7-methyl guanosine mRNA cap RNA 11, 1238-1244 (2005) 157 Kentsis,A et al Further evidence that ribavirin interacts with eIF4E RNA 11, 1762-1766 (2005) 158 Westman,B et al The antiviral drug ribavirin does not mimic the 7methylguanosine moiety of the mRNA cap structure in vitro RNA 11, 15051513 (2005) 159 Jacobson,B.A et al Repression of cap-dependent translation attenuates the transformed phenotype in non-small cell lung cancer both in vitro and in vivo Cancer Res 66, 4256-4262 (2006) 160 Herbert,T.P., Fahraeus,R., Prescott,A., Lane,D.P & Proud,C.G Rapid induction of apoptosis mediated by peptides that bind initiation factor eIF4E Curr Biol 10, 793-796 (2000) 161 Moerke,N.J et al Small-molecule inhibition of the interaction between the translation initiation factors eIF4E and eIF4G Cell 128, 257-267 (2007) 162 Low,W.K et al Inhibition of eukaryotic translation initiation by the marine natural product pateamine A Mol Cell 20, 709-722 (2005) 163 Bordeleau,M.E et al RNA-mediated sequestration of the RNA helicase eIF4A by Pateamine A inhibits translation initiation Chem Biol 13, 1287-1295 (2006) 164 Rinker-Schaeffer,C.W., Graff,J.R., De Benedetti,A., Zimmer,S.G & Rhoads,R.E Decreasing the level of translation initiation factor 4E with antisense RNA 245 Chapter References causes reversal of ras-mediated transformation and tumorigenesis of cloned rat embryo fibroblasts Int J Cancer 55, 841-847 (1993) 165 Graff,J.R et al Reduction of translation initiation factor 4E decreases the malignancy of ras-transformed cloned rat embryo fibroblasts Int J Cancer 60, 255-263 (1995) 166 Graff,J.R et al Translation of ODC mRNA and polyamine transport are suppressed in ras-transformed CREF cells by depleting translation initiation factor 4E Biochem Biophys Res Commun 240, 15-20 (1997) 167 DeFatta,R.J., Nathan,C.O & De Benedetti,A Antisense RNA to eIF4E suppresses oncogenic properties of a head and neck squamous cell carcinoma cell line Laryngoscope 110, 928-933 (2000) 168 Soni,A et al eIF4E knockdown decreases breast cancer cell growth without activating Akt signaling Mol Cancer Ther 7, 1782-1788 (2008) 169 Graff,J.R., Konicek,B.W., Carter,J.H & Marcusson,E.G Targeting the eukaryotic translation initiation factor 4E for cancer therapy Cancer Res 68, 631-634 (2008) 170 Graff,J.R et al Therapeutic suppression of translation initiation factor eIF4E expression reduces tumor growth without toxicity J Clin Invest 117, 2638-2648 (2007) 171 Gradi,A et al A novel functional human eukaryotic translation initiation factor 4G Mol Cell Biol 18, 334-342 (1998) 172 Tsukiyama-Kohara,K et al Tissue distribution, genomic structure, and chromosome mapping of mouse and human eukaryotic initiation factor 4Ebinding proteins and Genomics 38, 353-363 (1996) 173 Armengol,G et al 4E-binding protein 1: a key molecular "funnel factor" in human cancer with clinical implications Cancer Res 67, 7551-7555 (2007) 174 Rojo,F et al 4E-binding protein 1, a cell signaling hallmark in breast cancer that correlates with pathologic grade and prognosis Clin Cancer Res 13, 81-89 (2007) 175 Peterson,R.T., Desai,B.N., Hardwick,J.S & Schreiber,S.L Protein phosphatase 2A interacts with the 70-kDa S6 kinase and is activated by inhibition of FKBP12-rapamycinassociated protein Proc Natl Acad Sci U S A 96, 4438-4442 (1999) 246 Chapter References 176 Fadden,P., Haystead,T.A & Lawrence,J.C., Jr Identification of phosphorylation sites in the translational regulator, PHAS-I, that are controlled by insulin and rapamycin in rat adipocytes J Biol Chem 272, 10240-10247 (1997) 177 Shah,O.J., Anthony,J.C., Kimball,S.R & Jefferson,L.S 4E-BP1 and S6K1: translational integration sites for nutritional and hormonal information in muscle Am J Physiol Endocrinol Metab 279, E715-E729 (2000) 178 Gingras,A.C et al Hierarchical phosphorylation of the translation inhibitor 4EBP1 Genes Dev 15, 2852-2864 (2001) 179 Gingras,A.C et al Regulation of 4E-BP1 phosphorylation: a novel two-step mechanism Genes Dev 13, 1422-1437 (1999) 180 Richter,J.D & Sonenberg,N Regulation of cap-dependent translation by eIF4E inhibitory proteins Nature 433, 477-480 (2005) 181 Dostie,J., Ferraiuolo,M., Pause,A., Adam,S.A & Sonenberg,N A novel shuttling protein, 4E-T, mediates the nuclear import of the mRNA 5' cap-binding protein, eIF4E EMBO J 19, 3142-3156 (2000) 182 Shih,J.W., Tsai,T.Y., Chao,C.H & Wu Lee,Y.H Candidate tumor suppressor DDX3 RNA helicase specifically represses cap-dependent translation by acting as an eIF4E inhibitory protein Oncogene 27, 700-714 (2008) 183 Graff,J.R., Konicek,B.W., Carter,J.H & Marcusson,E.G Targeting the eukaryotic translation initiation factor 4E for cancer therapy Cancer Res 68, 631-634 (2008) 184 Graff,J.R., Konicek,B.W., Carter,J.H & Marcusson,E.G Targeting the eukaryotic translation initiation factor 4E for cancer therapy Cancer Res 68, 631-634 (2008) 185 Brown,C.J., McNae,I., Fischer,P.M & Walkinshaw,M.D Crystallographic and mass spectrometric characterisation of eIF4E with N7-alkylated cap derivatives J Mol Biol 372, 7-15 (2007) 186 Pantoliano,M.W et al High-density miniaturized thermal shift assays as a general strategy for drug discovery J Biomol Screen 6, 429-440 (2001) 187 Mamane,Y., Petroulakis,E., LeBacquer,O & Sonenberg,N mTOR, translation initiation and cancer Oncogene 25, 6416-6422 (2006) 188 Mader,S., Lee,H., Pause,A & Sonenberg,N The translation initiation factor eIF4E binds to a common motif shared by the translation factor eIF-4 gamma and the translational repressors 4E-binding proteins Mol Cell Biol 15, 4990-4997 (1995) 247 Chapter References 189 Marcotrigiano,J., Gingras,A.C., Sonenberg,N & Burley,S.K Cap-dependent translation initiation in eukaryotes is regulated by a molecular mimic of eIF4G Mol Cell 3, 707-716 (1999) 190 Stern,B.D., Wilson,M & Jagus,R Use of nonreducing SDS-PAGE for monitoring renaturation of recombinant protein synthesis initiation factor, eIF-4 alpha Protein Expr Purif 4, 320-327 (1993) 191 Slepenkov,S.V., Darzynkiewicz,E & Rhoads,R.E Stopped-flow kinetic analysis of eIF4E and phosphorylated eIF4E binding to cap analogs and capped oligoribonucleotides: evidence for a one-step binding mechanism J Biol Chem 281, 14927-14938 (2006) 192 Rychlik,W., Gardner,P.R., Vanaman,T.C & Rhoads,R.E Structural analysis of the messenger RNA cap-binding protein Presence of phosphate, sulfhydryl, and disulfide groups J Biol Chem 261, 71-75 (1986) 193 Edery,I., Altmann,M & Sonenberg,N High-level synthesis in Escherichia coli of functional cap-binding eukaryotic initiation factor eIF-4E and affinity purification using a simplified cap-analog resin Gene 74, 517-525 (1988) 194 Morino,S et al Crystallization and preliminary X-ray diffraction study of recombinant human eukaryotic initiation factor-4E J Biochem 119, 224-225 (1996) 195 Haghighat,A & Sonenberg,N eIF4G dramatically enhances the binding of eIF4E to the mRNA 5'-cap structure J Biol Chem 272, 21677-21680 (1997) 196 von der,H.T., Ball,P.D & McCarthy,J.E Stabilization of eukaryotic initiation factor 4E binding to the mRNA 5'-Cap by domains of eIF4G J Biol Chem 275, 30551-30555 (2000) 197 Roesler,K.R & Rao,A.G Conformation and stability of barley chymotrypsin inhibitor-2 (CI-2) mutants containing multiple lysine substitutions Protein Eng 12, 967-973 (1999) 198 Tomoo,K et al Structural basis for mRNA Cap-Binding regulation of eukaryotic initiation factor 4E by 4E-binding protein, studied by spectroscopic, X-ray crystal structural, and molecular dynamics simulation methods Biochim Biophys Acta 1753, 191-208 (2005) 199 Radisky,E.S., Lu,C.J., Kwan,G & Koshland,D.E., Jr Role of the intramolecular hydrogen bond network in the inhibitory power of chymotrypsin inhibitor Biochemistry 44, 6823-6830 (2005) 200 Chen,Y., Rodrik,V & Foster,D.A Alternative phospholipase D/mTOR survival signal in human breast cancer cells Oncogene 24, 672-679 (2005) 248 Chapter References 201 Chattopadhyay,A., Tate,S.A., Beswick,R.W., Wagner,S.D & Ko,F.P A peptide aptamer to antagonize BCL-6 function Oncogene 25, 2223-2233 (2006) 202 Beretta,L., Gingras,A.C., Svitkin,Y.V., Hall,M.N & Sonenberg,N Rapamycin blocks the phosphorylation of 4E-BP1 and inhibits cap-dependent initiation of translation EMBO J 15, 658-664 (1996) 203 Chang,S.B., Miron,P., Miron,A & Iglehart,J.D Rapamycin inhibits proliferation of estrogen-receptor-positive breast cancer cells J Surg Res 138, 37-44 (2007) 204 van der Poel,H.G., Hanrahan,C., Zhong,H & Simons,J.W Rapamycin induces Smad activity in prostate cancer cell lines Urol Res 30, 380-386 (2003) 205 Chen,Y., Zheng,Y & Foster,D.A Phospholipase D confers rapamycin resistance in human breast cancer cells Oncogene 22, 3937-3942 (2003) 206 Wiegand,H.L., Lu,S & Cullen,B.R Exon junction complexes mediate the enhancing effect of splicing on mRNA expression Proc Natl Acad Sci U S A 100, 11327-11332 (2003) 207 Keefe,A.D., Wilson,D.S., Seelig,B & Szostak,J.W One-step purification of recombinant proteins using a nanomolar-affinity streptavidin-binding peptide, the SBP-Tag Protein Expr Purif 23, 440-446 (2001) 208 Wang,X., Li,W., Parra,J.L., Beugnet,A & Proud,C.G The C terminus of initiation factor 4E-binding protein contains multiple regulatory features that influence its function and phosphorylation Mol Cell Biol 23, 1546-1557 (2003) 209 Hughes,J.M et al Translational repression by human 4E-BP1 in yeast specifically requires human eIF4E as target J Biol Chem 274, 3261-3264 (1999) 210 Youtani,T., Tomoo,K., Ishida,T., Miyoshi,H & Miura,K Regulation of human eIF4E by 4E-BP1: binding analysis using surface plasmon resonance IUBMB Life 49, 27-31 (2000) 211 Beretta,L., Svitkin,Y.V & Sonenberg,N Rapamycin stimulates viral protein synthesis and augments the shutoff of host protein synthesis upon picornavirus infection J Virol 70, 8993-8996 (1996) 212 Avdulov,S et al Activation of translation complex eIF4F is essential for the genesis and maintenance of the malignant phenotype in human mammary epithelial cells Cancer Cell 5, 553-563 (2004) 213 Elia,A., Constantinou,C & Clemens,M.J Effects of protein phosphorylation on ubiquitination and stability of the translational inhibitor protein 4E-BP1 Oncogene 27, 811-822 (2008) 249 Chapter References 214 Fen,C.X., Coomber,D.W., Lane,D.P & Ghadessy,F.J Directed evolution of p53 variants with altered DNA-binding specificities by in vitro compartmentalization J Mol Biol 371, 1238-1248 (2007) 215 Fletcher,C.M & Wagner,G The interaction of eIF4E with 4E-BP1 is an induced fit to a completely disordered protein Protein Sci 7, 1639-1642 (1998) 216 Fletcher,C.M et al 4E binding proteins inhibit the translation factor eIF4E without folded structure Biochemistry 37, 9-15 (1998) 217 Fawell,S et al Tat-mediated delivery of heterologous proteins into cells Proc Natl Acad Sci U S A 91, 664-668 (1994) 218 Wender,P.A et al The design, synthesis, and evaluation of molecules that enable or enhance cellular uptake: peptoid molecular transporters Proc Natl Acad Sci U S A 97, 13003-13008 (2000) 219 Langer,R Drug delivery and targeting Nature 392, 5-10 (1998) 220 Leung,D., Abbenante,G & Fairlie,D.P Protease inhibitors: current status and future prospects J Med Chem 43, 305-341 (2000) 250 Chapter 10 Appendix 10 Appendix E C R 1 P A C X H O GAATTCTTAATTAAGACTCGAGATGAGCAGCGTGGAAAAGAAGCCGGAGGGTGTGAACAC . | . | . | . | . | . | 60 CTTAAGAATTAATTCTGAGCTCTACTCGTCGCACCTTTTCTTCGGCCTCCCACACTTGTG M S C 61 CGGAGCGGGGGATCGCCATAACTTGAAAACGGAGTGGCCAGAACTCGTTGGTAAAAGCGT . | . | . | . | . | . | 120 GCCTCGCCCCCTAGCGGTATTGAACTTTTGCCTCACCGGTCTTGAGCAACCATTTTCGCA GGAAGAAGCAAAAAAGGTTATTTTACAGGATAAACCGGAAGCTCAGATTATCGTTCTGCC 121 . | . | . | . | . | . | 180 CCTTCTTCGTTTTTTCCAATAAAATGTCCTATTTGGCCTTCGAGTCTAATAGCAAGACGG N R U B S P E GGTGGGCACTAAAAAACGCTATGATCGCGAATTTCTGCTGGGCTTCCGGATTGACCGTGT 181 . | . | . | . | . | . | 240 CCACCCGTGATTTTTTGCGATACTAGCGCTTAAAGACGACCCGAAGGCCTAACTGGCACA B S S S ACGTCTGTTTGTAGATAAACTTGACAATATCGCCCAAGTCCCTCGTGTCGGCGACTACAA 241 . | . | . | . | . | . | 300 TGCAGACAAACATCTATTTGAACTGTTATAGCGGGTTCAGGGAGCACAGCCGCTGATGTT B A M B S P L P A C H I N AGATGATGATGACAAATAGTAAGGATCCTTAATTAAAAGCTT 301 . | . | . | . | 342 TCTACTACTACTGTTTATCATTCCTAGGAATTAATTTTCGAA Appendix 1.Gene sequence of codon optimized CI2 synthesized 251 Chapter 10 Appendix MS-Fit Search Results Sample ID (comment): \\Maldi1\Voyager D\Voyager\Yong Chiang spectrum\2005\05June21\eif4e 1_19_0001.dat Database searched: nr050405 Molecular weight search (1000 - 100000 Da) selects 2292213 entries Full pI range: 2408643 entries Species search ( HUMAN RODENT ) selects 218019 entries Combined molecular weight, pI and species searches select 198844 entries MS-Fit search selects 5763 entries (results displayed for top 20 matches) Considered modifications: | Phosphorylation of S, T and Y | Min # Peptides to Match Peptide Mass Tolerance (+/-) 50.000 ppm Peptide Masses are monoiso topic Cysteines Max # Digest Modified Missed Used by Cleavages Trypsin carboxym ethylation Peptide Peptide Input # N terminus C terminus Peptide Hydrogen Free Acid Masses (H) (O H) 50 Result Summary Rank MOWSE Score # (%) Protein Masses MW (Da)/pI Matched Species HOMO SAPIENS MUS 4.31e+003 8/50 (16%) 25037.3 / 5.79 MUSCULUS 1.06e+005 9/50 (18%) 25096.4 / 6.00 4.31e+003 8/50 (16%) 25053.3 / 5.79 RAT MUS MUSCULUS MUS MUSCULUS RATTUS NORVEGICUS MUS MUSCULUS MUS MUSCULUS nr050405 Accession Protein Name # 61363416 Eukaryotic translation initiation factor 4E 31982407 unnamed protein product Eukaryotic translation initiation factor 4E (eIF4E) (eIF-4E) (mRNA cap-binding protein) (eIF-4F 25 16758870 kDa subunit)gi|293334|gb|AAA37545.1| translation initiation factor eIF-4E 29477040 RIKEN cDNA 4933405K07 681 6/50 (12%) 68070.0 / 8.75 680 6/50 (12%) 68097.0 / 8.75 521 6/50 (12%) 83111.1 / 8.12 212 5/50 (10%) 59198.0 / 9.04 203 4/50 (8%) 23589.1 / 8.46 198 6/50 (12%) 91452.1 / 8.03 HOMO SAPIENS hypothetical protein, similar to 5102733 (AC007017) putative RNA helicase A 10 192 6/50 (12%) 93977.0 / 7.87 HOMO SAPIENS 21740289 hypothetical protein 21312718 unnamed protein product 34855773 similar to hypothetical protein FLJ36991 12853462 unnamed protein product 26338129 unnamed protein product 252 Chapter 10 Appendix MUS MUSCULUS MUS MUSCULUS HOMO SAPIENS HOMO SAPIENS HOMO SAPIENS 11 189 5/50 (10%) 64959.4 / 8.13 11 189 5/50 (10%) 64989.4 / 8.04 12 186 7/50 (14%) 73035.7 / 9.22 13 177 7/50 (14%) 78463.0 / 9.22 14 166 4/50 (8%) 93867.4 / 6.99 15 162 MUS 5/50 (10%) 12954.6 / 5.34 MUSCULUS 16 156 5/50 (10%) 68314.1 / 8.93 RAT 14250235 Zinc finger protein 69 29789231 unnamed protein product 34191049 zinc finger protein 555 40788368 KIAA0798 protein 1136428 KIAA0184 similar to Eukaryotic translation initiation factor 4E (eIF4E) (eIF51772083 4E) (mRNA cap-binding protein) (eIF-4F 25 kDa subunit) Serine/threonine-protein kinase PLK1 (Polo-like kinase 1) (PLK25742783 1)gi|497994|gb|AAA18885.1| polo like kinase Detailed Results 9/50 matches (18%) 25096.4 Da, pI = 6.00 Acc # 61363416 HOMO SAPIENS Eukaryotic translation initiation factor 4E m/z submitted 764.4406 882.5036 887.5457 888.4911 997.5446 1348.6136 1503.7914 1758.8350 2299.0797 MH+ matched 764.4167 882.4797 887.5355 888.4692 997.5300 1348.5731 1503.7807 1758.8299 2299.0651 Delta ppm 31.2109 27.0207 11.5413 24.6903 14.6442 30.0065 7.0985 2.9100 6.3081 start end 37 174 113 55 43 96 193 22 42 181 119 61 49 106 206 36 21 Peptide Sequence (Click for Fragment Ions) (K) HPLQNR(W) (R) EAVTHIGR(V) (R) WLITLNK(Q) (K) TWQANLR(L) (R) WALWFFK(N) (K) DGIEPMWEDEK(N) (K) IVIGYQSHADTATK(S) (K) TESNQEVANPEHYIK(H) (-) MATVEPETTPTPNPPTTEEEK(T) 41 unmatched masses: 720.4439 730.8823 747.0692 748.0296 761.4002 764.5510 764.6452 764.8908 765.2895 765.4394 765.5646 766.4380 786.4274 861.1188 877.0871 882.7286 883.5053 889.4914 904.4850 920.4823 1173.6925 1334.6421 1335.6451 1364.5970 1367.6297 1390.6562 1391.6305 1392.6690 1394.6718 1406.6793 1408.6684 1424.6396 1446.6415 1453.6600 1483.7508 1544.6653 1780.8289 2216.9636 2330.0193 2606.1724 2807.2405 The matched peptides cover 44% (96/217 AA's) of the protein Coverage Map for This Hit (MS-Digest index #): 1137568 Appendix Mass spectrometry results for eIF4E 253 ... made on the relevance and importance of eIF4E as an anti-cancer target for validation 1.2 The protein aptamer approach to target validation The aptamer approach to target validation involves the... stimulated by hormones, growth factors and mitogen that activate phosphatidylinositol kinase (PI3K), leading to a signaling cascade that activates mammalian target of rapamycin (mTOR) mTOR, also... that bind to eIF4E, a rate limiting translation initiation factor that is essential for the initiation of cap-dependent translation eIF4E has been implicated as a potential anti-cancer target as