GENETIC APPROACHES TO STUDY LIVER DEVELOPMENT IN ZEBRAFISH −−− CORE COMPONENT SEC13 IN COPII COMPLEX IS ESSENTIAL FOR LIVER DEVELOPMENT IN ZEBRAFISH GAO CHUAN (Bachelor of Science, Wuhan University, P.R. China) A THESIS SUBMITTED FOR THE DEGREE OF DOCTOR OF PHILOSOPHY DEPARTMENT OF BIOLOGICAL SCIENCE NATIONAL UNIVERSITY OF SINGAPORE 2007 Acknowledgement It has been five years since I started my graduate study in Singapore. I am so glad that finally I am about to end this long journey. In the first place, I want to thank my parents, my grandmother and my wife for their love and support. I am grateful to my supervisor, associate professor Peng Jinrong, who introduced me to the fabulous zebrafish research society, and guided me through the very details of my research work in the past years. Meanwhile, I want to express my sincere gratitude to the members of my thesis committee: A/P Hong Yunhan, Dr. Jiang Yun-jin and Dr. Low Boon Chuan. I appreciate their invaluable comments, suggestions and encouragement. Group working and cooperation is very essential in conducting scientific research. I was so lucky here that supportive colleague always surround me. I want to thank all members of the Functional Genomics Laboratory and the Molecular and Developmental Immunology Laboratory (Dr. Chen Jun, Dr. Cheng Wei, Dr. Alamgir Husain, Dr. Huang Mei, Dr. Qian Feng, Dr. Yang Shulan, Aw Meng Yuan, Cao Dongni, Du Linshen, Chang Chang Qing, Cheng Hui, Guo Lin, Huang Honghui, Lo Lijan, Low Swee Ling, Ma Weiping, Ng Sok Meng, Ruan Hua, Soo Hui Meng, Xu Min, Wen Chaoming, Wu Wei and Zhang Zhenhai) for their numerous help. I also want to thank our zebrafish facility, administration department and technical supporting team for their great service. Last but not least, I want to acknowledge National University of Singapore and The Institute of Molecular and Cell Biology, for financially supported my projects as well as myself. I understand that the completion of a Ph.D degree is just the very fundamental stage towards a scientific career. During the course I must always remind myself to be alert, be hard working, be motivated and be passionate. In the end, I want again to i thank all those ever helped me and cared about me. I am setting forth to reward their kindness by letting them be proud of me in the years to come. Gao Chuan July 13, 2008 ii Table of Contents Acknowledgement i Table of Contents iii Summary . ix List of Table xi List of Figure xii List of Abbreviation xiv Chapter 1. Introduction 1.1 Principles of developmental biology 1.2 The structure and functions of the liver . 1.3 Liver organogenesis . 1.3.1 Descriptive overview 1.3.2 Mechanisms controlling early stages of liver development . 1.3.2.1 Inductive signals from surrounding tissues lead to hepatic specification . 1.3.2.2 Transcription factors involved in liver organogenesis . 10 1.4 Zebrafish as a model to study liver organogenesis 15 1.4.1 The advantages of using zebrafish as a liver model . 15 1.4.2 Study of liver development in zebrafish . 16 1.4.2.1 Liver organogenesis in zebrafish . 16 1.4.2.2 Study liver development through genetic approaches in zebrafish . 21 1.5 The study of COPII complex . 21 1.5.1 . The COPII complex is essential for protein transport from ER to Golgi . 21 1.5.2 The recruitment and assembly of COPII transport vesicle 24 1.5.2.1 Assembly of core COPII components 24 1.5.2.2 Transport cargo selection and sorting 26 1.5.3 The structure of COPII coat . 26 1.5.4 Study of COPII complex in whole organism level 31 iii 1.6 Rational and aim of the project 31 Chapter 2. General Materials and Methods . 39 2.1 Fish lines and maintenance conditions . 39 2.2 Chemical solutions and growth medium 39 2.3 Molecular cloning procedures: . 42 2.3.1 . Polymerase chain reaction (PCR) 42 2.3.2 Purification of PCR product/DNA fragments from agarose gel 43 2.3.3 Ligation of DNA insert into plasmid vectors . 43 2.3.3.1 Ligation using pGEM®-T /pGEM®-T Easy vector system 43 2.3.3.2 Insert DNA fragment into other plasmid vectors . 43 2.3.4 Transformation of bacterial with plasmid 43 2.3.4.1 Preparation of DH5α E. coli competent cells . 43 2.3.4.2 Plasmid transformation of E. coli cells via heat-shock method 44 2.3.4.3 Isolation of plasmid DNA from E. coli 44 2.4 DNA sequencing 44 2.5 Zebrafish genomic DNA preparation . 45 2.5.1 Prepare genomic DNA from adult zebrafish 45 2.5.2 Prepare genomic DNA from zebrafish embryos 46 2.6 RNA extraction 47 2.7 Northern blot analysis 47 2.7.1 Probe Preparation . 47 2.7.2 RNA sample preparation 47 2.7.3 Hybridization analysis 48 2.8 5’ and 3’ RACE 49 2.9 RT-PCR 49 2.10 Sectioning of zebrafish embryo 49 2.10.1 Wax-embedded sectioning . 49 2.10.2 Cryosectioning . 49 2.11 Cell culture . 50 iv 2.11.1 Cell lines and growth condition . 50 2.11.2 Subculturing cells . 50 2.11.3 Cell transfection . 51 2.12 Immunofluorescence 51 2.13 Western blot . 52 2.13.1 Protein sample preparation . 52 2.13.2 SDS PAGE gel running and membrane transfer 53 2.13.3 Signal detection of target protein . 53 2.14 In situ hybridization . 55 2.14.1 . Preparation of labeled RNA probes by in vitro transcription . 55 2.14.2 Whole mount in situ hybridization for phenotype characterization . 55 2.14.3 High throughput whole mount in situ hybridization for genetic screening . 57 2.15 Microinjection 57 2.15.1 Preparation of mRNA, morpholino, and needles . 57 2.15.2 Microinjection 58 2.16 Alkaline phosphatase staining 58 2.17 Alcian blue staining 59 2.18 Transmission Electron Microscopy (TEM) 59 Chapter 3. Genetic screening for zebrafish mutants with liver defects . 60 3.1 Introduction 60 3.2 Materials and Methods . 63 3.3 Results 63 3.4 3.3.1 67 out of 71 putative mutant lines were reconfirmed . 63 3.3.2 Preliminary characterization of mutants in group A and B 67 Discussion 72 Chapter 4. Positional cloning of sec13sq198 73 4.1 Introduction 73 4.2 Materials and methods . 75 4.2.1 Preparation of mapping pairs . 75 v 4.2.2 Mapping genomic DNA preparation 75 4.2.3 Strategy for mapping 76 4.2.3.1 Rough mapping 76 4.2.3.2 Intermediate mapping . 79 4.2.3.3 Fine mapping 79 4.2.3.4 Candidate gene approach . 81 4.3 Results 81 4.3.1 Genome scanning to identify SSLP markers flanking the mutation in m198 . 81 4.3.2 Intermediate mapping . 84 4.3.3 Fine mapping located the m198 mutation to a genomic DNA region of ~54 kb 85 4.3.4 m198 carries a point mutation in sec13 gene . 87 4.3.5 The mutation in sec13 gene caused the phenotype in mutant line 198 91 4.3.5.1 Mutant phenotype can be rescued by wild-type sec13 mRNA injection . 91 4.3.5.2 Mutant Phenotype can be mimicked by morpholino injection 93 4.4 Discussion 95 Chapter 5. Phenotype characterization of sec13sq198 mutant 97 5.1 Introduction 97 5.2 Materials and methods . 97 5.3 Results 98 5.3.1 General appearance of the sec13sq198 mutant . 98 5.3.2 Phenotype in digestive organs 100 5.3.2.1 Liver specification and budding are not affected in the homozygous mutant . 100 5.3.2.2 sec13sq198 Mutant has normal endoderm differentiation 100 5.3.2.3 Mutant is arrested at expansion growth in digestive organs at dpf 104 5.3.3 Phenotype in other tissues and organs 109 vi 5.3.3.1 The sec13sq198 is also impaired in formation of the skeleton cartilage 109 5.3.3.2 Blood vessel and pronephric duct are not obviously affected by the mutation . 110 5.4 Discussion 111 Chapter 6. Study of the Sec13sq198 mutant protein at the cellular and biochemical levels 113 6.1 Introduction 113 6.2 Materials and methods . 114 6.3 Results 114 6.3.1 Sec13sq198 is a carboxyl-terminal truncated protein . 114 6.3.2 Expression pattern of sec13 and sec31A in zebrafish 116 6.3.3 Sec13 and Sec31A co-localized in a variety of cell types in zebrafish120 6.3.4 Sec13sq198 fails to form a complex with Sec31A 124 6.3.4.1 Sec13sq198 fails to co-localize with Sec31A in vivo 126 6.3.4.2 Sec13sq198 fails to be immunoprecipitated with Sec31A 128 6.3.5 6.4 sec13sq198 mutation disrupted the secretory pathway . 129 Discussion 133 Chapter 7. Phenotype characterization of the defhi429 mutant 135 7.1 Introduction 135 7.2 Materials and methods . 135 7.3 Results 135 7.3.1 Major digestive organs in the defhi429 mutant are severely hypoplastic. 135 7.4 7.3.2 defhi429 mutant has normal digestive organ specification . 138 7.3.3 defhi429 mutant is arrested at expansion growth of the digestive organs . 140 Discussion 145 Chapter 8. General Conclusions and Future Prospects 146 Appendix Molecular probes used in the in situ hybridization 149 Appendix Mapping panel 150 vii Appendix Methods for sec13sq198 mutant genotyping . 152 References 154 viii Summary The liver is one of the most essential organs in human body. However, the embryonic development of the liver has not been well understood. In this project we utilized zebrafish, Danio rerio, as a model organism to study genes which are involved in liver organogenesis via genetic approach. Firstly, forward genetic screening was applied to identify zebrafish mutants with smaller or invisible liver, which could be signs of defects in hepatogenesis or hepatic outgrowth. 71 putative liver defect mutants, which came from 54 F2 families, were obtained initially. Subsequently, outcross and preliminary characterization narrowed our scope to 15 individual lines which have no major general defects except for small-liver or no-liver phenotype. These mutant lines are valuable resources for the cloning of genes important for liver development. Secondly, one of the small-liver mutant sec13sq198 was selected for positional cloning of the mutated gene. The mutation site was identified to be within the sec13 gene in linkage group 22. It is an intronic thymine to adenine transition, which creates a new splicing receptor site and results in a carboxyl-terminal truncated protein as confirmed by western blot. Thirdly, detailed phenotype characterization of the mutant phenotype was performed. Whole mount mRNA in situ hybridization with organ specific as well as pan-endoderm probe suggested that the liver specification, budding and initial growth is not affected in the homozygous mutant. However, the expansion growth of the liver, as well as other digestive organs such as the intestine and pancreas, is arrested after dpf. Furthermore, impaired development of skeleton cartilage was also observed as revealed by alcian blue staining. Finally, functional study of the truncated gene product, Sec13sq198, was carried out in both zebrafish and human cell line. Sec13 was known to interact with Sec31A to form the out layer of the COPII complex, which is essential for the protein and lipid transport from ER to Golgi. Sectioning immuno-staining revealed that Sec13 and Sec31A express at high level in zebrafish liver, intestine, exocrine pancreas and skeleton cartilage cells. Cellular localization study in Hela cells and co-immunoprecipitation analysis in 293T cells indicated that Sec13sq198 failed to interact with Sec31A. In addition, although Sec13 level is constant in all embryonic ix 148 Appendix Molecular probes used in the in situ hybridization The EST project in our lab (Lo et al., 2003) provided most of the molecular probes used in our in situ hybridization. The prox1 plasmid was kindly provided by Dr. Liu Yiwen and the rest of the plasmids were obtained via molecular cloning approach. Probe Vector Source Antisense promoter foxa1 PKS PJR EST collection Z1 T3 foxa3 pGEM® T-Easy molecular cloning T7 gata6 PSK PJR EST collection Z2 SP6 hex pGEM® T-Easy molecular cloning SP6 ifabp pGEM® T-Easy molecular cloning SP6 insulin pGEM® T molecular cloning SP6 lfabp PKS PJR EST collection Z1 T3 pdx1 pGEM® T-Easy molecular cloning SP6 prox1 pGEM® T-Easy molecular cloning SP6 shh PKS PJR EST collection Z1 T3 surfactant PSK PJR EST collection Z2 T7 transferrin pGEM® T-Easy molecular cloning SP6 trypsin PKS PJR EST collection Z1 T3 149 Appendix Mapping panel 150 To construct the Mapping Panel, 451 SSLP markers were selected from the Zon Lab (http://zon.tchlab.org/) and the MGH zebrafish server (http://zebrafish.mgh.harvard.edu/). They were tested by PCR method on AB and WIK genomic DNA as introduced in Chapter 4. Those 226 that indicated polymorphism were selected to make the mapping panel. As indicated in the table, the Mapping Panel primers are arrayed in four 96-well plates with their names, origin and relative position recorded. The detailed mapping information of these markers can be retrieved from the Zebrafish Microsatellite Map Server (http://zebrafish.mgh.harvard.edu/zebrafish/index.htm) by inputting in their names respectively. 151 Appendix Methods for sec13sq198 mutant genotyping 1. Genotyping via PCR and sequencing Zebrafish genomic DNA samples were firstly amplified by PCR using two primers (M5A and M3A) flanking the intron of the sec13 gene. Then the PCR product was used as the template in sequencing reaction with a nested primer (M3C). The genotype can be easily confirmed by analyzing the sequencing trace files as indicated in Figure 4-10-B. The sequence information of the genotyping primers are listed below Name Sequence M5A 5’ AGTGGAAAGAGGACCAGAAG 3’ M3A 5’ GATGGGCTCCTTCTATTGGT 3’ M3C 5’ GGACCAGCTCACGTGCCA 3’ 2. Genotyping via Mapping PCR and electrophoresis During the positional cloning work, several tightly linked genetic markers, such as 257D, 257H, and 257E has been identified as introduced in Chapter 4. Among these markers, 257D was eventually selected to use in the genotyping of embryos generated from mapping pairs via PCR and electrophoresis. 257D produces clear and consistent polymorphism between AB and WIK lines in all our mapping families. The primer sequences and PCR amplification condition was optimized as following: Name 257D-forward 257D-reverse Sequence 5’ AAACGCAGGAATTTGTCCAG 3’ 5’ GAGGTTGAATTTGCAGTTTGC 3’ Optimized PCR conditions Cycles Condition Comments 1X 94 ℃, minutes Initial denaturation 10X 94 ℃, 30 seconds Denaturation Starting at 60 ℃ with ℃ decrease per cycle, 30 seconds Touch-down annealing 152 30X 10X 72 ℃, 45 seconds Extension 94 ℃, 30 seconds Denaturation 55 ℃, 30 seconds Annealing 72 ℃, 45 seconds Extension 72 ℃, 10 minutes Final extension The PCR product was run on high resolution gel (3.5% MS-8 agarose in 0.5X TBE) at 8-10 V / cm in 0.5X TBE for hour and 30 minutes. The result was interpreted as showed in the image below. The mutant genomic DNA can only produce the AB band and the homozygous WIK wildtype genomic DNA only produces the WIK band. The heterozygous genomic DNA will produce both the AB and the WIK band. 153 References Allende,M.L., Amsterdam,A., Becker,T., Kawakami,K., Gaiano,N., and Hopkins,N. (1996). Insertional mutagenesis in zebrafish identifies two novel genes, pescadillo and dead eye, essential for embryonic development. Genes Dev. 10, 3141-3155. Ang,S.L. and Rossant,J. (1994). HNF-3 beta is essential for node and notochord formation in mouse development. Cell 78, 561-574. Antonny,B. (2006). Membrane deformation by protein coats. Curr. Opin. Cell Biol. 18, 386-394. Antonny,B., Gounon,P., Schekman,R., and Orci,L. (2003). Self-assembly of minimal COPII cages. EMBO Rep. 4, 419-424. Bahary,N., Davidson,A., Ransom,D., Shepard,J., Stern,H., Trede,N., Zhou,Y., Barut,B., and Zon,L.I. (2004). The Zon laboratory guide to positional cloning in zebrafish. Methods Cell Biol. 77, 305-329. Barlowe,C. (2003). Signals for COPII-dependent export from the ER: what's the ticket out? Trends Cell Biol. 13, 295-300. Barlowe,C., Orci,L., Yeung,T., Hosobuchi,M., Hamamoto,S., Salama,N., Rexach,M.F., Ravazzola,M., Amherdt,M., and Schekman,R. (1994). COPII: a membrane coat formed by Sec proteins that drive vesicle budding from the endoplasmic reticulum. Cell 77, 895-907. Barlowe,C. and Schekman,R. (1993). SEC12 encodes a guanine-nucleotide-exchange factor essential for transport vesicle budding from the ER. Nature 365, 347-349. Bi,X., Corpina,R.A., and Goldberg,J. (2002). Structure of the Sec23/24-Sar1 pre-budding complex of the COPII vesicle coat. Nature 419, 271-277. Bielli,A., Haney,C.J., Gabreski,G., Watkins,S.C., Bannykh,S.I., and Aridor,M. (2005). Regulation of Sar1 NH2 terminus by GTP binding and hydrolysis promotes membrane deformation to control COPII vesicle fission. J. Cell Biol. 171, 919-924. Biemar,F., Argenton,F., Schmidtke,R., Epperlein,S., Peers,B., and Driever,W. (2001). Pancreas development in zebrafish: early dispersed appearance of endocrine hormone expressing cells and their convergence to form the definitive islet. Dev. Biol. 230, 189-203. Boehmer,T., Enninga,J., Dales,S., Blobel,G., and Zhong,H. (2003). Depletion of a single nucleoporin, Nup107, prevents the assembly of a subset of nucleoporins into the nuclear pore complex. Proc. Natl. Acad. Sci. U. S. A 100, 981-985. Bonfanti,L., Mironov,A.A., Jr., Martinez-Menarguez,J.A., Martella,O., Fusella,A., Baldassarre,M., Buccione,R., Geuze,H.J., Mironov,A.A., and Luini,A. (1998). Procollagen traverses the Golgi stack without leaving the lumen of cisternae: evidence for cisternal maturation. Cell 95, 993-1003. 154 Bossard,P. and Zaret,K.S. (1998). GATA transcription factors as potentiators of gut endoderm differentiation. Development 125, 4909-4917. Boyadjiev,S.A., Fromme,J.C., Ben,J., Chong,S.S., Nauta,C., Hur,D.J., Zhang,G., Hamamoto,S., Schekman,R., Ravazzola,M., Orci,L., and Eyaid,W. (2006). Cranio-lenticulo-sutural dysplasia is caused by a SEC23A mutation leading to abnormal endoplasmic-reticulum-to-Golgi trafficking. Nat Genet. 38, 1192-1197. Bulla,G.A. (1997). Hepatocyte nuclear factor-4 prevents silencing of hepatocyte nuclear factor-1 expression in hepatoma x fibroblast cell hybrids. Nucleic Acids Res. 25, 2501-2508. Bulla,G.A. and Fournier,R.E. (1994). Genetic analysis of a transcriptional activation pathway by using hepatoma cell variants. Mol. Cell Biol. 14, 7086-7094. Cereghini,S. (1996). Liver-enriched transcription factors and hepatocyte differentiation. FASEB J. 10, 267-282. Chen,J., Ruan,H., Ng,S.M., Gao,C., Soo,H.M., Wu,W., Zhang,Z., Wen,Z., Lane,D.P., and Peng,J. (2005). Loss of function of def selectively up-regulates Delta113p53 expression to arrest expansion growth of digestive organs in zebrafish. Genes Dev. 19, 2900-2911. Chen,W.S., Manova,K., Weinstein,D.C., Duncan,S.A., Plump,A.S., Prezioso,V.R., Bachvarova,R.F., and Darnell,J.E., Jr. (1994). Disruption of the HNF-4 gene, expressed in visceral endoderm, leads to cell death in embryonic ectoderm and impaired gastrulation of mouse embryos. Genes Dev. 8, 2466-2477. Cirillo,L.A., Lin,F.R., Cuesta,I., Friedman,D., Jarnik,M., and Zaret,K.S. (2002). Opening of compacted chromatin by early developmental transcription factors HNF3 (FoxA) and GATA-4. Mol. Cell 9, 279-289. Clark,K.L., Halay,E.D., Lai,E., and Burley,S.K. (1993). Co-crystal structure of the HNF-3/fork head DNA-recognition motif resembles histone H5. Nature 364, 412-420. Clotman,F., Lannoy,V.J., Reber,M., Cereghini,S., Cassiman,D., Jacquemin,P., Roskams,T., Rousseau,G.G., and Lemaigre,F.P. (2002). The onecut transcription factor HNF6 is required for normal development of the biliary tract. Development 129, 1819-1828. Coffinier,C., Gresh,L., Fiette,L., Tronche,F., Schutz,G., Babinet,C., Pontoglio,M., Yaniv,M., and Barra,J. (2002). Bile system morphogenesis defects and liver dysfunction upon targeted deletion of HNF1beta. Development 129, 1829-1838. Deutsch,G., Jung,J., Zheng,M., Lora,J., and Zaret,K.S. (2001). A bipotential precursor population for pancreas and liver within the embryonic endoderm. Development 128, 871-881. Donovan,A., Brownlie,A., Zhou,Y., Shepard,J., Pratt,S.J., Moynihan,J., Paw,B.H., Drejer,A., Barut,B., Zapata,A., Law,T.C., Brugnara,C., Lux,S.E., Pinkus,G.S., Pinkus,J.L., Kingsley,P.D., Palis,J., Fleming,M.D., Andrews,N.C., and Zon,L.I. 155 (2000). Positional cloning of zebrafish ferroportin1 identifies a conserved vertebrate iron exporter. Nature 403, 776-781. Douarin,N.M. (1975). An experimental analysis of liver development. Med. Biol. 53, 427-455. Duncan,S.A. (2003). Mechanisms controlling early development of the liver. Mech. Dev. 120, 19-33. Duncan,S.A., Manova,K., Chen,W.S., Hoodless,P., Weinstein,D.C., Bachvarova,R.F., and Darnell,J.E., Jr. (1994). Expression of transcription factor HNF-4 in the extraembryonic endoderm, gut, and nephrogenic tissue of the developing mouse embryo: HNF-4 is a marker for primary endoderm in the implanting blastocyst. Proc. Natl. Acad. Sci. U. S. A 91, 7598-7602. Espenshade,P., Gimeno,R.E., Holzmacher,E., Teung,P., and Kaiser,C.A. (1995). Yeast SEC16 gene encodes a multidomain vesicle coat protein that interacts with Sec23p. J. Cell Biol. 131, 311-324. Fath,S., Mancias,J.D., Bi,X., and Goldberg,J. (2007). Structure and organization of coat proteins in the COPII cage. Cell 129, 1325-1336. Field,H.A., Ober,E.A., Roeser,T., and Stainier,D.Y. (2003). Formation of the digestive system in zebrafish. I. Liver morphogenesis. Dev. Biol. 253, 279-290. Fukuda-Taira,S. (1981). Hepatic induction in the avian embryo: specificity of reactive endoderm and inductive mesoderm. J. Embryol. Exp. Morphol. 63, 111-125. Gaiano,N., Amsterdam,A., Kawakami,K., Allende,M., Becker,T., and Hopkins,N. (1996). Insertional mutagenesis and rapid cloning of essential genes in zebrafish. Nature 383, 829-832. Geissmann,F., Cameron,T.O., Sidobre,S., Manlongat,N., Kronenberg,M., Briskin,M.J., Dustin,M.L., and Littman,D.R. (2005). Intravascular immune surveillance by CXCR6+ NKT cells patrolling liver sinusoids. PLoS. Biol. 3, e113. Ghaemmaghami,S., Huh,W.K., Bower,K., Howson,R.W., Belle,A., Dephoure,N., O'Shea,E.K., and Weissman,J.S. (2003). Global analysis of protein expression in yeast. Nature 425, 737-741. Gilbert,S.F. (2000). Developmental Biology. Sinauer Associates, Inc). Gimeno,R.E., Espenshade,P., and Kaiser,C.A. (1995). SED4 encodes a yeast endoplasmic reticulum protein that binds Sec16p and participates in vesicle formation. J. Cell Biol. 131, 325-338. Giraudo,C.G. and Maccioni,H.J. (2003). Endoplasmic reticulum export of glycosyltransferases depends on interaction of a cytoplasmic dibasic motif with Sar1. Mol. Biol. Cell 14, 3753-3766. Golling,G., Amsterdam,A., Sun,Z., Antonelli,M., Maldonado,E., Chen,W., Burgess,S., Haldi,M., Artzt,K., Farrington,S., Lin,S.Y., Nissen,R.M., and Hopkins,N. (2002). 156 Insertional mutagenesis in zebrafish rapidly identifies genes essential for early vertebrate development. Nat. Genet. 31, 135-140. Gurkan,C., Stagg,S.M., LaPointe,P., and Balch,W.E. (2006). The COPII cage: unifying principles of vesicle coat assembly. Nat. Rev. Mol. Cell Biol. 7, 727-738. Haffter,P., Granato,M., Brand,M., Mullins,M.C., Hammerschmidt,M., Kane,D.A., Odenthal,J., van Eeden,F.J., Jiang,Y.J., Heisenberg,C.P., Kelsh,R.N., Furutani-Seiki,M., Vogelsang,E., Beuchle,D., Schach,U., Fabian,C., and Nusslein-Volhard,C. (1996). The identification of genes with unique and essential functions in the development of the zebrafish, Danio rerio. Development 123, 1-36. Her,G.M., Chiang,C.C., Chen,W.Y., and Wu,J.L. (2003). In vivo studies of liver-type fatty acid binding protein (L-FABP) gene expression in liver of transgenic zebrafish (Danio rerio). FEBS Lett. 538, 125-133. Herbst,R.S., Nielsch,U., Sladek,F., Lai,E., Babiss,L.E., and Darnell,J.E., Jr. (1991). Differential regulation of hepatocyte-enriched transcription factors explains changes in albumin and transthyretin gene expression among hepatoma cells. New Biol. 3, 289-296. Horne-Badovinac,S., Rebagliati,M., and Stainier,D.Y. (2003). A cellular framework for gut-looping morphogenesis in zebrafish. Science 302, 662-665. Housset,C.N., Rockey,D.C., Friedman,S.L., and Bissell,D.M. (1995). Hepatic lipocytes: a major target for endothelin-1. J. Hepatol. 22, 55-60. Huang,M., Weissman,J.T., Beraud-Dufour,S., Luan,P., Wang,C., Chen,W., Aridor,M., Wilson,I.A., and Balch,W.E. (2001). Crystal structure of Sar1-GDP at 1.7 A resolution and the role of the NH2 terminus in ER export. J. Cell Biol. 155, 937-948. Huh,W.K., Falvo,J.V., Gerke,L.C., Carroll,A.S., Howson,R.W., Weissman,J.S., and O'Shea,E.K. (2003). Global analysis of protein localization in budding yeast. Nature 425, 686-691. Jung,J., Zheng,M., Goldfarb,M., and Zaret,K.S. (1999). Initiation of mammalian liver development from endoderm by fibroblast growth factors. Science 284, 1998-2003. Kaestner,K.H., Hiemisch,H., Luckow,B., and Schutz,G. (1994). The HNF-3 gene family of transcription factors in mice: gene structure, cDNA sequence, and mRNA distribution. Genomics 20, 377-385. Kaestner,K.H., Hiemisch,H., and Schutz,G. (1998). Targeted disruption of the gene encoding hepatocyte nuclear factor 3gamma results in reduced transcription of hepatocyte-specific genes. Mol. Cell Biol. 18, 4245-4251. Kaestner,K.H., Katz,J., Liu,Y., Drucker,D.J., and Schutz,G. (1999). Inactivation of the winged helix transcription factor HNF3alpha affects glucose homeostasis and islet glucagon gene expression in vivo. Genes Dev. 13, 495-504. Keng,V.W., Yagi,H., Ikawa,M., Nagano,T., Myint,Z., Yamada,K., Tanaka,T., Sato,A., Muramatsu,I., Okabe,M., Sato,M., and Noguchi,T. (2000). Homeobox gene Hex is 157 essential for onset of mouse embryonic liver development and differentiation of the monocyte lineage. Biochem. Biophys. Res. Commun. 276, 1155-1161. Kimmel,C.B., Ballard,W.W., Kimmel,S.R., Ullmann,B., and Schilling,T.F. (1995). Stages of embryonic development of the zebrafish. Dev. Dyn. 203, 253-310. Knapik,E.W. (2000). ENU mutagenesis in zebrafish--from genes to complex diseases. Mamm. Genome 11, 511-519. Kuehn,M.J., Herrmann,J.M., and Schekman,R. (1998). COPII-cargo interactions direct protein sorting into ER-derived transport vesicles. Nature 391, 187-190. Lai,E., Prezioso,V.R., Smith,E., Litvin,O., Costa,R.H., and Darnell,J.E., Jr. (1990). HNF-3A, a hepatocyte-enriched transcription factor of novel structure is regulated transcriptionally. Genes Dev. 4, 1427-1436. Landry,C., Clotman,F., Hioki,T., Oda,H., Picard,J.J., Lemaigre,F.P., and Rousseau,G.G. (1997). HNF-6 is expressed in endoderm derivatives and nervous system of the mouse embryo and participates to the cross-regulatory network of liver-enriched transcription factors. Dev. Biol. 192, 247-257. Lang,M.R., Lapierre,L.A., Frotscher,M., Goldenring,J.R., and Knapik,E.W. (2006). Secretory COPII coat component Sec23a is essential for craniofacial chondrocyte maturation. Nat. Genet. 38, 1198-203. Lederkremer,G.Z., Cheng,Y., Petre,B.M., Vogan,E., Springer,S., Schekman,R., Walz,T., and Kirchhausen,T. (2001). Structure of the Sec23p/24p and Sec13p/31p complexes of COPII. Proc. Natl. Acad. Sci. U. S. A 98, 10704-10709. Lee,C.S., Friedman,J.R., Fulmer,J.T., and Kaestner,K.H. (2005a). The initiation of liver development is dependent on Foxa transcription factors. Nature 435, 944-947. Lee,M.C., Orci,L., Hamamoto,S., Futai,E., Ravazzola,M., and Schekman,R. (2005b). Sar1p N-terminal helix initiates membrane curvature and completes the fission of a COPII vesicle. Cell 122, 605-617. Lemaigre,F. and Zaret,K.S. (2004). Liver development update: new embryo models, cell lineage control, and morphogenesis. Curr. Opin. Genet. Dev. 14, 582-590. Letts,V.A. and Dawes,I.W. (1983). Temperature-sensitive Saccharomyces cerevisiae mutant defective in lipid biosynthesis. J. Bacteriol. 156, 212-221. Li,J., Ning,G., and Duncan,S.A. (2000). Mammalian hepatocyte differentiation requires the transcription factor HNF-4alpha. Genes Dev. 14, 464-474. Lo,J., Lee,S., Xu,M., Liu,F., Ruan,H., Eun,A., He,Y., Ma,W., Wang,W., Wen,Z., and Peng,J. (2003). 15000 unique zebrafish EST clusters and their future use in microarray for profiling gene expression patterns during embryogenesis. Genome Res. 13, 455-466. Lodish,H., Berk,A., Zipursky,S.L., Matsudaira,P., Baltimore,D., and Darnell,J.E. (1999). Molecular Cell Biology. (New York: W. H. Freeman & Co). 158 Loiodice,I., Alves,A., Rabut,G., Van,O.M., Ellenberg,J., Sibarita,J.B., and Doye,V. (2004). The entire Nup107-160 complex, including three new members, is targeted as one entity to kinetochores in mitosis. Mol. Biol. Cell 15, 3333-3344. Lorent,K., Yeo,S.Y., Oda,T., Chandrasekharappa,S., Chitnis,A., Matthews,R.P., and Pack,M. (2004). Inhibition of Jagged-mediated Notch signaling disrupts zebrafish biliary development and generates multi-organ defects compatible with an Alagille syndrome phenocopy. Development 131, 5753-5766. Lowry,J.A. and Atchley,W.R. (2000). Molecular evolution of the GATA family of transcription factors: conservation within the DNA-binding domain. J. Mol. Evol. 50, 103-115. Malkus,P., Jiang,F., and Schekman,R. (2002). Concentrative sorting of secretory cargo proteins into COPII-coated vesicles. J. Cell Biol. 159, 915-921. Maton,A. and Jean Hopkins,C.W.M.S.J.M.Q.W.D.L.J.D.W. (1993). Human Biology and Health. Prentice Hall). Matsumoto,K., Yoshitomi,H., Rossant,J., and Zaret,K.S. (2001). Liver organogenesis promoted by endothelial cells prior to vascular function. Science 294, 559-563. Matthews,R.P., Lorent,K., Russo,P., and Pack,M. (2004). The zebrafish onecut gene hnf-6 functions in an evolutionarily conserved genetic pathway that regulates vertebrate biliary development. Dev. Biol. 274, 245-259. Mayer,A.N. and Fishman,M.C. (2003). Nil per os encodes a conserved RNA recognition motif protein required for morphogenesis and cytodifferentiation of digestive organs in zebrafish. Development 130, 3917-3928. Medlock,E.S. and Haar,J.L. (1983). The liver hemopoietic environment: I. Developing hepatocytes and their role in fetal hemopoiesis. Anat. Rec. 207, 31-41. Michalopoulos,G.K. and DeFrances,M.C. (1997). Liver regeneration. Science 276, 60-66. Michelmore,R.W., Paran,I., and Kesseli,R.V. (1991). Identification of markers linked to disease-resistance genes by bulked segregant analysis: a rapid method to detect markers in specific genomic regions by using segregating populations. Proc. Natl. Acad. Sci. U. S. A 88, 9828-9832. Miller,E.A., Beilharz,T.H., Malkus,P.N., Lee,M.C., Hamamoto,S., Orci,L., and Schekman,R. (2003). Multiple cargo binding sites on the COPII subunit Sec24p ensure capture of diverse membrane proteins into transport vesicles. Cell 114, 497-509. Mossessova,E., Bickford,L.C., and Goldberg,J. (2003). SNARE selectivity of the COPII coat. Cell 114, 483-495. Nakano,A., Brada,D., and Schekman,R. (1988). A membrane glycoprotein, Sec12p, required for protein transport from the endoplasmic reticulum to the Golgi apparatus in yeast. J. Cell Biol. 107, 851-863. 159 Nakano,A. and Muramatsu,M. (1989). A novel GTP-binding protein, Sar1p, is involved in transport from the endoplasmic reticulum to the Golgi apparatus. J. Cell Biol. 109, 2677-2691. Ober,E.A., Field,H.A., and Stainier,D.Y. (2003). From endoderm formation to liver and pancreas development in zebrafish. Mech. Dev. 120, 5-18. Ober,E.A., Verkade,H., Field,H.A., and Stainier,D.Y. (2006). Mesodermal Wnt2b signalling positively regulates liver specification. Nature 442, 688-691. Oka,T., Nishikawa,S., and Nakano,A. (1991). Reconstitution of GTP-binding Sar1 protein function in ER to Golgi transport. J. Cell Biol. 114, 671-679. Oliver,G., Sosa-Pineda,B., Geisendorf,S., Spana,E.P., Doe,C.Q., and Gruss,P. (1993). Prox 1, a prospero-related homeobox gene expressed during mouse development. Mech. Dev. 44, 3-16. Pagano,A., Letourneur,F., Garcia-Estefania,D., Carpentier,J.L., Orci,L., and Paccaud,J.P. (1999). Sec24 proteins and sorting at the endoplasmic reticulum. J. Biol. Chem. 274, 7833-7840. Patton,E.E. and Zon,L.I. (2001). The art and design of genetic screens: zebrafish. Nat. Rev. Genet. 2, 956-966. Postlethwait,J.H., Johnson,S.L., Midson,C.N., Talbot,W.S., Gates,M., Ballinger,E.W., Africa,D., Andrews,R., Carl,T., Eisen,J.S., and . (1994). A genetic linkage map for the zebrafish. Science 264, 699-703. Presley,J.F., Cole,N.B., Schroer,T.A., Hirschberg,K., Zaal,K.J., and Lippincott-Schwartz,J. (1997). ER-to-Golgi transport visualized in living cells. Nature 389, 81-85. Rausa,F., Samadani,U., Ye,H., Lim,L., Fletcher,C.F., Jenkins,N.A., Copeland,N.G., and Costa,R.H. (1997). The cut-homeodomain transcriptional activator HNF-6 is coexpressed with its target gene HNF-3 beta in the developing murine liver and pancreas. Dev. Biol. 192, 228-246. Rehorn,K.P., Thelen,H., Michelson,A.M., and Reuter,R. (1996). A molecular aspect of hematopoiesis and endoderm development common to vertebrates and Drosophila. Development 122, 4023-4031. Reiter,J.F., Kikuchi,Y., and Stainier,D.Y. (2001). Multiple roles for Gata5 in zebrafish endoderm formation. Development 128, 125-135. Roberg,K.J., Crotwell,M., Espenshade,P., Gimeno,R., and Kaiser,C.A. (1999). LST1 is a SEC24 homologue used for selective export of the plasma membrane ATPase from the endoplasmic reticulum. J. Cell Biol. 145, 659-672. Rojas,A., De,V.S., Heidt,A.B., Xu,S.M., Bristow,J., and Black,B.L. (2005). Gata4 expression in lateral mesoderm is downstream of BMP4 and is activated directly by Forkhead and GATA transcription factors through a distal enhancer element. Development 132, 3405-3417. 160 Ross,J.J., Shimmi,O., Vilmos,P., Petryk,A., Kim,H., Gaudenz,K., Hermanson,S., Ekker,S.C., O'Connor,M.B., and Marsh,J.L. (2001). Twisted gastrulation is a conserved extracellular BMP antagonist. Nature 410, 479-483. Rossi,J.M., Dunn,N.R., Hogan,B.L., and Zaret,K.S. (2001). Distinct mesodermal signals, including BMPs from the septum transversum mesenchyme, are required in combination for hepatogenesis from the endoderm. Genes Dev. 15, 1998-2009. Sadler,K.C., Amsterdam,A., Soroka,C., Boyer,J., and Hopkins,N. (2005). A genetic screen in zebrafish identifies the mutants vps18, nf2 and foie gras as models of liver disease. Development 132, 3561-3572. Saito-Nakano,Y. and Nakano,A. (2000). Sed4p functions as a positive regulator of Sar1p probably through inhibition of the GTPase activation by Sec23p. Genes Cells 5, 1039-1048. Salama,N.R., Yeung,T., and Schekman,R.W. (1993). The Sec13p complex and reconstitution of vesicle budding from the ER with purified cytosolic proteins. EMBO J. 12, 4073-4082. Sato,K. and Nakano,A. (2007). Mechanisms of COPII vesicle formation and protein sorting. FEBS Lett. 581, 2076-2082. Shin,D., Shin,C.H., Tucker,J., Ober,E.A., Rentzsch,F., Poss,K.D., Hammerschmidt,M., Mullins,M.C., and Stainier,D.Y. (2007). Bmp and Fgf signaling are essential for liver specification in zebrafish. Development 134, 2041-2050. Shiojiri,N., Inujima,S., Ishikawa,K., Terada,K., and Mori,M. (2001). Cell lineage analysis during liver development using the spf(ash)-heterozygous mouse. Lab Invest 81, 17-25. Shugrue,C.A., Kolen,E.R., Peters,H., Czernik,A., Kaiser,C., Matovcik,L., Hubbard,A.L., and Gorelick,F. (1999). Identification of the putative mammalian orthologue of Sec31P, a component of the COPII coat. J. Cell Sci. 112 ( Pt 24), 4547-4556. Sladek,F.M., Zhong,W.M., Lai,E., and Darnell,J.E., Jr. (1990). Liver-enriched transcription factor HNF-4 is a novel member of the steroid hormone receptor superfamily. Genes Dev. 4, 2353-2365. Sosa-Pineda,B., Wigle,J.T., and Oliver,G. (2000). Hepatocyte migration during liver development requires Prox1. Nat. Genet. 25, 254-255. Stafford,D. and Prince,V.E. (2002). Retinoic acid signaling is required for a critical early step in zebrafish pancreatic development. Curr. Biol. 12, 1215-1220. Stagg,S.M., Gurkan,C., Fowler,D.M., LaPointe,P., Foss,T.R., Potter,C.S., Carragher,B., and Balch,W.E. (2006). Structure of the Sec13/31 COPII coat cage. Nature 439, 234-238. Stainier,D.Y. (2002). A glimpse into the molecular entrails of endoderm formation. Genes Dev. 16, 893-907. 161 Stankewich,M.C., Stabach,P.R., and Morrow,J.S. (2006). Human Sec31B: a family of new mammalian orthologues of yeast Sec31p that associate with the COPII coat. J. Cell Sci. 119, 958-969. Tang,B.L., Peter,F., Krijnse-Locker,J., Low,S.H., Griffiths,G., and Hong,W. (1997). The mammalian homolog of yeast Sec13p is enriched in the intermediate compartment and is essential for protein transport from the endoplasmic reticulum to the Golgi apparatus. Mol. Cell Biol. 17, 256-266. Tang,B.L., Wang,Y., Ong,Y.S., and Hong,W. (2005). COPII and exit from the endoplasmic reticulum. Biochim. Biophys. Acta 1744, 293-303. Tang,B.L., Zhang,T., Low,D.Y., Wong,E.T., Horstmann,H., and Hong,W. (2000). Mammalian homologues of yeast sec31p. An ubiquitously expressed form is localized to endoplasmic reticulum (ER) exit sites and is essential for ER-Golgi transport. J. Biol. Chem. 275, 13597-13604. Thisse,C. and Zon,L.I. (2002). Organogenesis--heart and blood formation from the zebrafish point of view. Science 295, 457-462. Wallace,K.N. and Pack,M. (2003). Unique and conserved aspects of gut development in zebrafish. Dev. Biol. 255, 12-29. Wallace,K.N., Yusuff,S., Sonntag,J.M., Chin,A.J., and Pack,M. (2001). Zebrafish hhex regulates liver development and digestive organ chirality. Genesis. 30, 141-143. Wan,H., Korzh,S., Li,Z., Mudumana,S.P., Korzh,V., Jiang,Y.J., Lin,S., and Gong,Z. (2006). Analyses of pancreas development by generation of gfp transgenic zebrafish using an exocrine pancreas-specific elastaseA gene promoter. Exp. Cell Res. 312, 1526-1539. Weinstein,D.C., Altaba,A., Chen,W.S., Hoodless,P., Prezioso,V.R., Jessell,T.M., and Darnell,J.E., Jr. (1994). The winged-helix transcription factor HNF-3 beta is required for notochord development in the mouse embryo. Cell 78, 575-588. Wells,J.M. and Melton,D.A. (1999). Vertebrate endoderm development. Annu. Rev. Cell Dev. Biol. 15, 393-410. Westerfield,M. (1995). The Zebrafish Book. A Guide for the Laboratory Use of Zebrafish (Danio rerio). Yogosawa,S., Kayukawa,K., Kawata,T., Makino,Y., Inoue,S., Okuda,A., Muramatsu,M., and Tamura,T. (1999). Induced expression, localization, and chromosome mapping of a gene for the TBP-interacting protein 120A. Biochem. Biophys. Res. Commun. 266, 123-128. Zaret,K.S. (2000). Liver specification and early morphogenesis. Mech. Dev. 92, 83-88. Zaret,K.S. (2001). Hepatocyte differentiation: from the endoderm and beyond. Curr. Opin. Genet. Dev. 11, 568-574. 162 Zaret,K.S. (2002). Regulatory phases of early liver development: paradigms of organogenesis. Nat. Rev. Genet. 3, 499-512. Zhao,R., Watt,A.J., Li,J., Luebke-Wheeler,J., Morrisey,E.E., and Duncan,S.A. (2005). GATA6 is essential for embryonic development of the liver but dispensable for early heart formation. Mol. Cell Biol. 25, 2622-2631. Zorn,A.M. and Wells,J.M. (2007). Molecular basis of vertebrate endoderm development. Int. Rev. Cytol. 259, 49-111. 163 [...]... subsequently in the kidney, not in the liver, thus liver defect does not lead 15 to embryonic lethal for anemia (Thisse and Zon, 2002) All these advantages make the zebrafish an excellent model for forward genetic studies of liver organogenesis 1.4.2 Study of liver development in zebrafish Study of liver development in zebrafish has a relatively short history Currently the morphology of zebrafish liver organogenesis... difficult to be used in performing forward genetic screening The intrauterine development of mouse fetus is inconvenient for the observation of phenotypes in embryonic stages In addition, liver is the initial site of hematopoiesis in mammals, thus liver defects in mouse often cause early embryonic death Zebrafish has been revealed to be a vertebrate model organism that is suitable for forward genetic research... also expressed in hepatoblasts at this stage, which is similar to that observed in mouse Knockdown of hex via morpholino injection led to a largely reduced liver size by 50 hpf, indicating that hex is essential for liver development in zebrafish (Wallace et al., 2001) Retinoid acid (RA) has also been shown to be necessary for the specification of hepatoblasts in zebrafish (Stafford and Prince, 2002) At... of using zebrafish as a genetic model to study liver development and disease 1.5 The study of COPII complex 1.5.1 The COPII complex is essential for protein transport from ER to Golgi In eukaryotes, newly synthesized secreted proteins need to be properly transported from one membrane compartment to another for cell growth and maintenance This kind of transportation is mediated by vesicular vectors,... and has many essential functions, including storage of substances, maintaining homeostasis, blood detoxification, producing numerous enzymes for metabolism, and serving as an endocrine/exocrine organ In mammalian fetus, the liver is the initial site of hematopoiesis, thus embryonic liver defects will lead to severe consequences As a big vascular organ, the liver serves as a reservoir for body fluids... organogenesis has been well described, especially in a study by Field et al with the help of the Tg (gutGFP) S584 transgenic fish (Figure 1-5) In addition, a few zebrafish genes related to liver development have been identified in genetic screening 1.4.2.1 Liver organogenesis in zebrafish Liver is an endoderm derived organ Although the situation of endoderm morphogenesis is different in zebrafish and... the liver from the intestinal bulb primordium The pancreas (asterisk) and endodermal lining of the swim bladder (arrow) can also be seen developing from the intestinal bulb primordium over time (G–I) Transverse sections through the gutGFP line stained with rhodamine-labeled phalloidin to visualize surrounding tissues The liver is marked by an arrowhead; the intestinal bulb primordium is outlined in. .. and the liver sits on the left side of the midline At 4 dpf, the liver is seen to generate a second lobe which is extending to the right side of the midline At 5 dpf, the two lobes of the liver become obvious Liver specific marker lfabp probe was used in whole mount in situ hybridization to generate these images 20 1.4.2.2 Study liver development through genetic approaches in zebrafish Owing to its... embryos, indicates that the transcription factor might generally control the development of epithelial tubules during organogenesis (Coffinier et al., 2002) 1.4 Zebrafish as a model to study liver organogenesis 1.4.1 The advantages of using zebrafish as a liver model Previous works in chick, mouse and rat model have brought us a lot of insights into the liver organogenesis To reveal the detailed mechanism... Figure Figure 1-1 Developmental history of zebrafish 2 Figure 1-2 The structure of the human liver 6 Figure 1-3 Diagram illustrating stages of liver development 9 Figure 1-4 Signals and tissue interactions regulate liver organogenesis 13 Figure 1-5 Time course of liver budding in zebrafish 19 Figure 1-6 Liver growth in zebrafish 20 Figure 1-7 Intracellular vesicular . GENETIC APPROACHES TO STUDY LIVER DEVELOPMENT IN ZEBRAFISH −−− CORE COMPONENT SEC13 IN COPII COMPLEX IS ESSENTIAL FOR LIVER DEVELOPMENT IN ZEBRAFISH GAO CHUAN (Bachelor. development in zebrafish 16 1.4.2.1 Liver organogenesis in zebrafish 16 1.4.2.2 Study liver development through genetic approaches in zebrafish 21 1.5 The study of COPII complex 21 1.5.1 . The COPII. Transcription factors involved in liver organogenesis 10 1.4 Zebrafish as a model to study liver organogenesis 15 1.4.1 The advantages of using zebrafish as a liver model 15 1.4.2 Study of liver development