Figure 5.1. Spatial differences in VEGF-A distribution accompany the differential remodeling of cortical and medullary sinuses during prolonged inflammation (A) VEGF-A expression was largely confined to the subcapsular B cell regions of the activated LNs at day post-immunization but was also detected within the T cell zone and LN medulla at day 14. Scale bar in represents 400 µm (B) Confocal images revealed that while VEGF-A co-localized with subcapsular sinuses on both day and 14 after immunization, VEGF-A co-localization with the cortical and medullary sinuses were detected only on day 14. Scale bars represent 50µm.   106   Given the intricate relationship between FRC network and lymphatic channels, we also examined VEGF-A distribution with respect to the ER-TR7+ reticular fibers associated with lymphatics. VEGF-A co-localized with the reticular network that lined subcapsular sinuses (identified by presence of DCs within lymphatics in previous sequential section, not shown) (dotted white lines demarcated subcapsular lymphatics) on both day and 14 post-immunization (Fig. 5.2A). Interestingly, while VEGF-A was largely absent from the ER-TR7+ network associated with cortical and medullary sinuses (identified by absence of DCs in lumen of LYVE-1+ sinuses in previous sequential section, not shown) (dotted while lines demarcate cortical and medullary sinuses, lumen marked by L) on day post-immunization, there was an obvious association of VEGF-A with the ER-TR7+ FRC fibers that lined cortical and medullary sinuses at day 14 post-immunization (Fig. 5.2A). Association between FRCs lining cortical and medullary sinuses and VEGF-A was ascertained to occur at interfaces - VEGF-A was present at the surface and inside reticular fibers (Fig. 5.2B). While the observation of VEGF-A within and on the reticular fibers is suggestive that VEGF-A is produced by FRCs and secreted into the LN parenchyma, we cannot exclude the possibility that extra-nodal VEGF-A may be transported within reticular conduits and subsequently displayed on FRCs. To further explore the relationship between lymphatics and FRCs, we used VEGFR3 as another marker for lymphatics. We observed similar close spatial association between lymphatics and FRCs (Fig 5.2C). Closer examination also revealed that cortical and medullary sinuses, FRCs and VEGF-A in LNs from day 14 postimmunization engaged in a tripartite interaction whereas such an interaction was not observed at day (Fig. 5.2C).   107   Altogether, these data indicate that as the inflammation evolved, spatial differences in the distribution of VEGF-A within DLNs may mediate the remodeling of cortical and medullary sinuses.   108     109   Figure 5.2. Association of VEGF-A with the FRCs lining lymphatics (A) VEGF-A co-localized with FRCs that lined subcapsular sinuses on both day and 14 after immunization. VEGF-A association with FRCs that lined cortical and medullary sinuses was detected only on day 14 post-immunization. Dotted while lines demarcates lymphatics (B) Orthogonal plane view of how VEGF-A is aligned on the FRCs lining cortical and medullary sinuses. Inset shows enlarged image of confocal image stack of boxed region in E. VEGF-A can be found on the surface of as well as inside FRCs; (C) The interaction between cortical-medullary lymphatics, FRCs and VEGF-A in LNs on day 14 post-immunization. Scale bars represent 50µm. L = lumen   110   5.2.2 Interstitial flow is required for the differential distribution of VEGF-A in lymph node during inflammation Interstitial flow acting in concert with lymphangiogenic factor has been reported to be a key driving force of lymphangiogenesis (Boardman and Swartz, 2003; Goldman et al., 2007). Moreover, alterations in interstitial flow have also been shown to be important for the expression of chemokines by FRCs (Tomei et al., 2009). We therefore considered the possibility that interstitial flow through the LNs during inflammation might influence the expression and distribution of VEGF-A and, thereby support differential LV remodeling. To address this, we designed a surgical strategy to perturb LN interstitial flow by cutting the afferent lymphatics draining the popliteal LN at day 10 post-immunization. Mice that received sham operations served as controls (Fig. 5.3A). Mice were sacrificed day after surgery. Patency or obstruction of lymphatic flow to the popliteal LN was verified (Fig. 5.3B).   111   Figure 5.3. LV surgery to disrupt lymph flow to the popliteal lymph node. (A) Afferent lymphatic vessels were cut on one side (‘LV resection’) while a sham operation was performed on LVs on the contralateral side (‘sham’). FITC-dextran uptake was used as a marker of lymphatic transport and flow. LV transport of FITCdextran to LN following ‘LV resection’ was cut off compared to the ‘sham’ LN. (B) At sacrifice, FITC-dextran injected into footpads of mice verified that lymph flow to the popliteal LNs was still functional in the ‘sham’ side and not patent in the side with ‘LV resection’. The popliteal LN with the intact LV was brightly fluorescent while fluorescence of the popliteal LN drained by the severed LV was dim. Scale bar in (B) represents 2mm.   112   While VEGF-A expression was preserved in the sham-treated LNs, perturbation of interstitial flow dramatically decreased expression of VEGF-A in LNs (Fig. 5.4A). In addition, perturbation of interstitial flow altered VEGF-A distribution in LNs such that it was markedly confined to the superficial cortex. This indicated that during late inflammation, interstitial flow within LNs governed distribution of VEGF-A into the paracortex and medulla. To further support this, disruption of interstitial flow was noted to obliterate association of VEGF-A with cortical and medullary sinuses compared to sham-treated LNs (Fig. 5.4B). This implies that lymph flow through the LN could influence the spatial-temporal distribution of VEGF-A during the course of inflammation and, as a consequence, modulate the remodeling of cortical and medullary sinuses. As other groups have described that interstitial flow can modulate FRC organization and function (Tomei et al., 2009) and, in our model, extra-nodal VEGF-A may be transported within FRC fibers and subsequently displayed and/or produced by FRCs , we next investigated what might be the repercussions of disrupting interstitial flow on VEGF-A interaction with the fibroblastic reticular network. In contrast to shamtreated LNs, perturbation of interstitial flow through LNs ablated VEGF-A colocalization with ER-TR7+ reticular fibers lining the cortical and medullary sinuses (Fig 5.4C). This suggests that LN interstitial flow is an important regulator of both VEGF-A production and presentation by the FRC network.   113     114   Figure 5.4. Disrupting interstitial flow through DLNS affected VEGF-A localization (A) LV resection resulting in perturbation of interstitial flow, affected VEGF-A expression and distribution in DLNs. Confocal images showed that disruption of interstitial flow in DLNs abolished association of VEGF-A with cortical-medullary sinuses (B) and with FRCs lining them (C). Scale bar in (A) represents 400 µm. Scale bar in (B) and (C) represents 50µm. L = lumen Images are representative of independent experiments (n=3).   115   Opdenakker, G., Van den Steen, P. E., Dubois, B., Nelissen, I., Van Coillie, E., Masure, S., Proost, P., and Van Damme, J. (2001). Gelatinase B functions as regulator and effector in leukocyte biology. J Leukoc Biol 69, 851-859. Palframan, R. T., Jung, S., Cheng, G., Weninger, W., Luo, Y., Dorf, M., Littman, D. R., Rollins, B. J., Zweerink, H., Rot, A., and von Andrian, U. H. (2001). Inflammatory chemokine transport and presentation in HEV: a remote control mechanism for monocyte recruitment to lymph nodes in inflamed tissues. J Exp Med 194, 1361-1373. Pappu, R., Schwab, S. R., Cornelissen, I., Pereira, J. P., Regard, J. B., Xu, Y., Camerer, E., Zheng, Y. W., Huang, Y., Cyster, J. G., and Coughlin, S. R. (2007). Promotion of lymphocyte egress into blood and lymph by distinct sources of sphingosine-1-phosphate. Science 316, 295-298. Park, J. E., Keller, G. A., and Ferrara, N. (1993). The vascular endothelial growth factor (VEGF) isoforms: differential deposition into the subepithelial extracellular matrix and bioactivity of extracellular matrix-bound VEGF. Mol Biol Cell 4, 13171326. Patel, S. P., and Dana, R. (2009). Corneal lymphangiogenesis: implications in immunity. Semin Ophthalmol 24, 135-138. Paupert, J., Sounni, N. E., and Noel, A. (2011). Lymphangiogenesis in post-natal tissue remodeling: lymphatic endothelial cell connection with its environment. Mol Aspects Med 32, 146-158. Pedica, F., Ligorio, C., Tonelli, P., Bartolini, S., and Baccarini, P. (2008). Lymphangiogenesis in Crohn's disease: an immunohistochemical study using monoclonal antibody D2-40. Virchows Arch 452, 57-63.   220   Pegu, A., Qin, S., Fallert Junecko, B. A., Nisato, R. E., Pepper, M. S., and Reinhart, T. A. (2008). Human lymphatic endothelial cells express multiple functional TLRs. J Immunol 180, 3399-3405. Petrova, T. V., Makinen, T., Makela, T. P., Saarela, J., Virtanen, I., Ferrell, R. E., Finegold, D. N., Kerjaschki, D., Yla-Herttuala, S., and Alitalo, K. (2002). Lymphatic endothelial reprogramming of vascular endothelial cells by the Prox-1 homeobox transcription factor. Embo J 21, 4593-4599. Pflicke, H., and Sixt, M. (2009). Preformed portals facilitate dendritic cell entry into afferent lymphatic vessels. J Exp Med 206, 2925-2935. Pham, C. T. (2008). Neutrophil serine proteases fine-tune the inflammatory response. Int J Biochem Cell Biol 40, 1317-1333. Pham, T. H., Okada, T., Matloubian, M., Lo, C. G., and Cyster, J. G. (2008). S1P1 receptor signaling overrides retention mediated by G alpha i-coupled receptors to promote T cell egress. Immunity 28, 122-133. Phan, T. G., Green, J. A., Gray, E. E., Xu, Y., and Cyster, J. G. (2009). Immune complex relay by subcapsular sinus macrophages and noncognate B cells drives antibody affinity maturation. Nat Immunol 10, 786-793. Podgrabinska, S., Braun, P., Velasco, P., Kloos, B., Pepper, M. S., and Skobe, M. (2002). Molecular characterization of lymphatic endothelial cells. Proc Natl Acad Sci U S A 99, 16069-16074. Podgrabinska, S., Kamalu, O., Mayer, L., Shimaoka, M., Snoeck, H., Randolph, G. J., and Skobe, M. (2009). Inflamed lymphatic endothelium suppresses dendritic cell maturation and function via Mac-1/ICAM-1-dependent mechanism. J Immunol 183, 1767-1779.   221   Polzer, K., Baeten, D., Soleiman, A., Distler, J., Gerlag, D. M., Tak, P. P., Schett, G., and Zwerina, J. (2008). Tumour necrosis factor blockade increases lymphangiogenesis in murine and human arthritic joints. Ann Rheum Dis 67, 16101616. Proulx, S. T., Kwok, E., You, Z., Beck, C. A., Shealy, D. J., Ritchlin, C. T., Boyce, B. F., Xing, L., and Schwarz, E. M. (2007). MRI and quantification of draining lymph node function in inflammatory arthritis. Ann N Y Acad Sci 1117, 106-123. Pugin, J., Widmer, M. C., Kossodo, S., Liang, C. M., Preas, H. L. n., and Suffredini, A. F. (1999). Human neutrophils secrete gelatinase B in vitro and in vivo in response to endotoxin and proinflammatory mediators. Am J Respir Cell Mol Biol 20, 458-464. Pytowski, B., Goldman, J., Persaud, K., Wu, Y., Witte, L., Hicklin, D. J., Skobe, M., Boardman, K. C., and Swartz, M. A. (2005). Complete and specific inhibition of adult lymphatic regeneration by a novel VEGFR-3 neutralizing antibody. J Natl Cancer Inst 97, 14-21. Qian, C. N., Berghuis, B., Tsarfaty, G., Bruch, M., Kort, E. J., Ditlev, J., Tsarfaty, I., Hudson, E., Jackson, D. G., Petillo, D., et al. (2006). Preparing the "soil": the primary tumor induces vasculature reorganization in the sentinel lymph node before the arrival of metastatic cancer cells. Cancer Res 66, 10365-10376. Randolph, G. J., Angeli, V., and Swartz, M. A. (2005). Dendritic-cell trafficking to lymph nodes through lymphatic vessels. Nat Rev Immunol 5, 617-628. Religa, P., Cao, R., Bjorndahl, M., Zhou, Z., Zhu, Z., and Cao, Y. (2005). Presence of bone marrow-derived circulating progenitor endothelial cells in the newly formed lymphatic vessels. Blood 106, 4184-4190.   222   Ristimaki, A., Narko, K., Enholm, B., Joukov, V., and Alitalo, K. (1998). Proinflammatory cytokines regulate expression of the lymphatic endothelial mitogen vascular endothelial growth factor-C. J Biol Chem 273, 8413-8418. Robbiani, D. F., Finch, R. A., Jager, D., Muller, W. A., Sartorelli, A. C., and Randolph, G. J. (2000). The leukotriene C4 transporter MRP1 regulates CCL19 (MIP3beta, ELC)-dependent mobilization of dendritic cells to lymph nodes. Cell 103, 757768. Roth, D., Piekarek, M., Paulsson, M., Christ, H., Bloch, W., Krieg, T., Davidson, J. M., and Eming, S. A. (2006). Plasmin modulates vascular endothelial growth factorA-mediated angiogenesis during wound repair. Am J Pathol 168, 670-684. Ruhrberg, C., Gerhardt, H., Golding, M., Watson, R., Ioannidou, S., Fujisawa, H., Betsholtz, C., and Shima, D. T. (2002). Spatially restricted patterning cues provided by heparin-binding VEGF-A control blood vessel branching morphogenesis. Genes Dev 16, 2684-2698. Rutkowski, J. M., Markhus, C. E., Gyenge, C. C., Alitalo, K., Wiig, H., and Swartz, M. A. (2010). Dermal collagen and lipid deposition correlate with tissue swelling and hydraulic conductivity in murine primary lymphedema. Am J Pathol 176, 1122-1129. Saban, M. R., Memet, S., Jackson, D. G., Ash, J., Roig, A. A., Israel, A., and Saban, R. (2004). Visualization of lymphatic vessels through NF-kappaB activity. Blood 104, 3228-3230. Sabin, F. R. (1916). The Method of Growth of the Lymphatic System. Science 44, 145-158. Salmi, M., Koskinen, K., Henttinen, T., Elima, K., and Jalkanen, S. (2004). CLEVER1 mediates lymphocyte transmigration through vascular and lymphatic endothelium. Blood 104, 3849-3857.   223   Salven, P., Mustjoki, S., Alitalo, R., Alitalo, K., and Rafii, S. (2003). VEGFR-3 and CD133 identify a population of CD34+ lymphatic/vascular endothelial precursor cells. Blood 101, 168-172. Sanna, M. G., Wang, S. K., Gonzalez-Cabrera, P. J., Don, A., Marsolais, D., Matheu, M. P., Wei, S. H., Parker, I., Jo, E., Cheng, W. C., et al. (2006). Enhancement of capillary leakage and restoration of lymphocyte egress by a chiral S1P1 antagonist in vivo. Nat Chem Biol 2, 434-441. Scandella, E., Bolinger, B., Lattmann, E., Miller, S., Favre, S., Littman, D. R., Finke, D., Luther, S. A., Junt, T., and Ludewig, B. (2008). Restoration of lymphoid organ integrity through the interaction of lymphoid tissue-inducer cells with stroma of the T cell zone. Nat Immunol 9, 667-675. Scapini, P., Morini, M., Tecchio, C., Minghelli, S., Di Carlo, E., Tanghetti, E., Albini, A., Lowell, C., Berton, G., Noonan, D. M., and Cassatella, M. A. (2004). CXCL1/macrophage inflammatory protein-2-induced angiogenesis in vivo is mediated by neutrophil-derived vascular endothelial growth factor-A. J Immunol 172, 5034-5040. Scapini, P., Nardelli, B., Nadali, G., Calzetti, F., Pizzolo, G., Montecucco, C., and Cassatella, M. A. (2003). G-CSF-stimulated neutrophils are a prominent source of functional BLyS. J Exp Med 197, 297-302. Schruefer, R., Lutze, N., Schymeinsky, J., and Walzog, B. (2005). Human neutrophils promote angiogenesis by a paracrine feedforward mechanism involving endothelial interleukin-8. Am J Physiol Heart Circ Physiol 288, H1186-1192. Schulte-Merker, S., Sabine, A., and Petrova, T. V. (2011). Lymphatic vascular morphogenesis in development, physiology, and disease. J Cell Biol 193, 607-618.   224   Schwab, S. R., Pereira, J. P., Matloubian, M., Xu, Y., Huang, Y., and Cyster, J. G. (2005). Lymphocyte sequestration through S1P lyase inhibition and disruption of S1P gradients. Science 309, 1735-1739. Shapiro, S. D., Fliszar, C. J., Broekelmann, T. J., Mecham, R. P., Senior, R. M., and Welgus, H. G. (1995). Activation of the 92-kDa gelatinase by stromelysin and 4aminophenylmercuric acetate. Differential processing and stabilization of the carboxyl-terminal domain by tissue inhibitor of metalloproteinases (TIMP). J Biol Chem 270, 6351-6356. Shiow, L. R., Rosen, D. B., Brdickova, N., Xu, Y., An, J., Lanier, L. L., Cyster, J. G., and Matloubian, M. (2006). CD69 acts downstream of interferon-alpha/beta to inhibit S1P1 and lymphocyte egress from lymphoid organs. Nature 440, 540-544. Shrestha, B., Hashiguchi, T., Ito, T., Miura, N., Takenouchi, K., Oyama, Y., Kawahara, K., Tancharoen, S., Ki, I. Y., Arimura, N., et al. (2010). B cell-derived vascular endothelial growth factor A promotes lymphangiogenesis and high endothelial venule expansion in lymph nodes. J Immunol 184, 4819-4826. Siegfried, G., Basak, A., Cromlish, J. A., Benjannet, S., Marcinkiewicz, J., Chretien, M., Seidah, N. G., and Khatib, A. M. (2003). The secretory proprotein convertases furin, PC5, and PC7 activate VEGF-C to induce tumorigenesis. J Clin Invest 111, 1723-1732. Sinha, R. K., Park, C., Hwang, I. Y., Davis, M. D., and Kehrl, J. H. (2009). B Lymphocytes Exit Lymph Nodes through Cortical Lymphatic Sinusoids by a Mechanism Independent of Sphingosine-1-Phosphate-Mediated Chemotaxis. Immunity. Sixt, M., Kanazawa, N., Selg, M., Samson, T., Roos, G., Reinhardt, D. P., Pabst, R., Lutz, M. B., and Sorokin, L. (2005). The conduit system transports soluble antigens   225   from the afferent lymph to resident dendritic cells in the T cell area of the lymph node. Immunity 22, 19-29. Smelt, S. C., Cotterell, S. E., Engwerda, C. R., and Kaye, P. M. (2000). B celldeficient mice are highly resistant to Leishmania donovani infection, but develop neutrophil-mediated tissue pathology. J Immunol 164, 3681-3688. Smith, E., Stark, M. A., Zarbock, A., Burcin, T. L., Bruce, A. C., Vaswani, D., Foley, P., and Ley, K. (2008). IL-17A inhibits the expansion of IL-17A-producing T cells in mice through "short-loop" inhibition via IL-17 receptor. J Immunol 181, 1357-1364. Smith, E., Zarbock, A., Stark, M. A., Burcin, T. L., Bruce, A. C., Foley, P., and Ley, K. (2007). IL-23 is required for neutrophil homeostasis in normal and neutrophilic mice. J Immunol 179, 8274-8279. Soderberg, K. A., Payne, G. W., Sato, A., Medzhitov, R., Segal, S. S., and Iwasaki, A. (2005). Innate control of adaptive immunity via remodeling of lymph node feed arteriole. Proc Natl Acad Sci U S A 102, 16315-16320. Soderstrom, N., and Stenstrom, A. (1969). Outflow paths of cells from the lymph node parenchyma to the efferent lymphatics--observations in thin section histology. Scand J Haematol 6, 186-196. Soker, S., Takashima, S., Miao, H. Q., Neufeld, G., and Klagsbrun, M. (1998). Neuropilin-1 is expressed by endothelial and tumor cells as an isoform-specific receptor for vascular endothelial growth factor. Cell 92, 735-745. Springer, T. A. (1994). Traffic signals for lymphocyte recirculation and leukocyte emigration: the multistep paradigm. Cell 76, 301-314. Srinivasan, R. S., Dillard, M. E., Lagutin, O. V., Lin, F. J., Tsai, S., Tsai, M. J., Samokhvalov, I. M., and Oliver, G. (2007). Lineage tracing demonstrates the venous origin of the mammalian lymphatic vasculature. Genes Dev 21, 2422-2432.   226   St John, A. L., and Abraham, S. N. (2009). Salmonella disrupts lymph node architecture by TLR4-mediated suppression of homeostatic chemokines. Nat Med 15, 1259-1265. Stalmans, I., Ng, Y. S., Rohan, R., Fruttiger, M., Bouche, A., Yuce, A., Fujisawa, H., Hermans, B., Shani, M., Jansen, S., et al. (2002). Arteriolar and venular patterning in retinas of mice selectively expressing VEGF isoforms. J Clin Invest 109, 327-336. Stark, M. A., Huo, Y., Burcin, T. L., Morris, M. A., Olson, T. S., and Ley, K. (2005). Phagocytosis of apoptotic neutrophils regulates granulopoiesis via IL-23 and IL-17. Immunity 22, 285-294. Sudo, T., Nishikawa, S., Ogawa, M., Kataoka, H., Ohno, N., Izawa, A., and Hayashi, S. (1995). Functional hierarchy of c-kit and c-fms in intramarrow production of CFUM. Oncogene 11, 2469-2476. Summers, C., Rankin, S. M., Condliffe, A. M., Singh, N., Peters, A. M., and Chilvers, E. R. (2010). Neutrophil kinetics in health and disease. Trends Immunol 31, 318-324. Svensson, M., Irjala, H., Svanborg, C., and Godaly, G. (2008). Effects of epithelial and neutrophil CXCR2 on innate immunity and resistance to kidney infection. Kidney Int 74, 81-90. Taichman, N. S., Young, S., Cruchley, A. T., Taylor, P., and Paleolog, E. (1997). Human neutrophils secrete vascular endothelial growth factor. J Leukoc Biol 62, 397400. Tammela, T., and Alitalo, K. (2010). Lymphangiogenesis: Molecular mechanisms and future promise. Cell 140, 460-476. Tomei, A. A., Siegert, S., Britschgi, M. R., Luther, S. A., and Swartz, M. A. (2009). Fluid flow regulates stromal cell organization and CCL21 expression in a tissueengineered lymph node microenvironment. J Immunol 183, 4273-4283.   227   Turley, S. J., Fletcher, A. L., and Elpek, K. G. (2010). The stromal and haematopoietic antigen-presenting cells that reside in secondary lymphoid organs. Nat Rev Immunol 10, 813-825. Van Vliet, E., Melis, M., Foidart, J. M., and Van Ewijk, W. (1986). Reticular fibroblasts in peripheral lymphoid organs identified by a monoclonal antibody. J Histochem Cytochem 34, 883-890. Vigl, B., Aebischer, D., Nitschke, M., Iolyeva, M., Rothlin, T., Antsiferova, O., and Halin, C. (2011). Tissue inflammation modulates gene expression of lymphatic endothelial cells and dendritic cell migration in a stimulus-dependent manner. Blood 118, 205-215. von Andrian, U. H., and Mackay, C. R. (2000). T-cell function and migration. Two sides of the same coin. N Engl J Med 343, 1020-1034. von Andrian, U. H., and Mempel, T. R. (2003). Homing and cellular traffic in lymph nodes. Nat Rev Immunol 3, 867-878. von Vietinghoff, S., and Ley, K. (2008). Homeostatic regulation of blood neutrophil counts. J Immunol 181, 5183-5188. von Vietinghoff, S., and Ley, K. (2009). IL-17A controls IL-17F production and maintains blood neutrophil counts in mice. J Immunol 183, 865-873. Wada, Y., Yoshida, K., Tsutani, Y., Shigematsu, H., Oeda, M., Sanada, Y., Suzuki, T., Mizuiri, H., Hamai, Y., Tanabe, K., et al. (2007). Neutrophil elastase induces cell proliferation and migration by the release of TGF-alpha, PDGF and VEGF in esophageal cell lines. Oncol Rep 17, 161-167. Wang, Z. G., Puri, T. S., and Quigg, R. J. (2010). Characterization of novel VEGF (vascular endothelial growth factor)-C splicing isoforms from mouse. Biochem J 428, 347-354.   228   Watari, K., Nakao, S., Fotovati, A., Basaki, Y., Hosoi, F., Bereczky, B., Higuchi, R., Miyamoto, T., Kuwano, M., and Ono, M. (2008). Role of macrophages in inflammatory lymphangiogenesis: Enhanced production of vascular endothelial growth factor C and D through NF-kappaB activation. Biochem Biophys Res Commun 377, 826-831. Webster, B., Ekland, E. H., Agle, L. M., Chyou, S., Ruggieri, R., and Lu, T. T. (2006). Regulation of lymph node vascular growth by dendritic cells. J Exp Med 203, 1903-1913. Wei, S. H., Rosen, H., Matheu, M. P., Sanna, M. G., Wang, S. K., Jo, E., Wong, C. H., Parker, I., and Cahalan, M. D. (2005). Sphingosine 1-phosphate type receptor agonism inhibits transendothelial migration of medullary T cells to lymphatic sinuses. Nat Immunol 6, 1228-1235. Wengner, A. M., Pitchford, S. C., Furze, R. C., and Rankin, S. M. (2008). The coordinated action of G-CSF and ELR + CXC chemokines in neutrophil mobilization during acute inflammation. Blood 111, 42-49. Wilkinson, L. S., and Edwards, J. C. (1991). Demonstration of lymphatics in human synovial tissue. Rheumatol Int 11, 151-155. Woolard, J., Bevan, H. S., Harper, S. J., and Bates, D. O. (2009). Molecular Diversity of VEGF-A as a Regulator of Its Biological Activity. Microcirculation, 1-21. Wuest, T. R., and Carr, D. J. (2010). VEGF-A expression by HSV-1-infected cells drives corneal lymphangiogenesis. J Exp Med 207, 101-115. Xu, H., Edwards, J., Banerji, S., Prevo, R., Jackson, D. G., and Athanasou, N. A. (2003). Distribution of lymphatic vessels in normal and arthritic human synovial tissues. Ann Rheum Dis 62, 1227-1229.   229   Xu, Y., Yuan, L., Mak, J., Pardanaud, L., Caunt, M., Kasman, I., Larrivee, B., Del Toro, R., Suchting, S., Medvinsky, A., et al. (2010). Neuropilin-2 mediates VEGF-Cinduced lymphatic sprouting together with VEGFR3. J Cell Biol 188, 115-130. Yamazaki, Y., and Morita, T. (2006). Molecular and functional diversity of vascular endothelial growth factors. Mol Divers 10, 515-527. Yao, L. C., Baluk, P., Feng, J., and McDonald, D. M. (2010). Steroid-resistant lymphatic remodeling in chronically inflamed mouse airways. Am J Pathol 176, 1525-1541. Young, A. J. (1999). The physiology of lymphocyte migration through the single lymph node in vivo. Semin Immunol 11, 73-83. Yuan, L., Moyon, D., Pardanaud, L., Breant, C., Karkkainen, M. J., Alitalo, K., and Eichmann, A. (2002). Abnormal lymphatic vessel development in neuropilin mutant mice. Development 129, 4797-4806. Zawieja, D. C. (2009). Contractile physiology of lymphatics. Lymphat Res Biol 7, 8796. Zhan, Y., Lieschke, G. J., Grail, D., Dunn, A. R., and Cheers, C. (1998). Essential roles for granulocyte-macrophage colony-stimulating factor (GM-CSF) and G-CSF in the sustained hematopoietic response of Listeria monocytogenes-infected mice. Blood 91, 863-869. Zhang, Q., Lu, Y., Proulx, S. T., Guo, R., Yao, Z., Schwarz, E. M., Boyce, B. F., and Xing, L. (2007). Increased lymphangiogenesis in joints of mice with inflammatory arthritis. Arthritis Res Ther 9, R118.   230   Appendix 1. Buffers and media PBS (working concentration, 1×) g NaCl, 0.2 g KCl, 1.44 g Na2HPO4, 0.24 g KH2PO4 in L H2O, pH 7.4 MACS buffer 0.5% BSA, mM EDTA in PBS, pH 7.4 FACS buffer 1% normal mouse serum, 1% normal rat serum, 0.5% BSA, mM EDTA in PBS, pH 7.4 RBC lysis buffer 0.15 M NH4Cl, 10 mM KHCO3, 0.1 mM Na2EDTA in H2O, pH 7.4 ELISA wash buffer (PBST) 0.05% Tween-20 in PBS Components for stacking and separating gels   Stacking Gel (4 mL) Separating Gel (10 mL) Acrylamide concentration 4% 10% 30% Acrylamide mix (29:1 acrylamide:bisacrylamide) 0.67 mL 3.3 mL 1.5M Tris pH8.8 - 2.5 mL 1M Tris pH6.8 0.5 mL - H20 2.4 mL 4.1 mL 10% SDS 40 µL 100 µL 10% ammonium persulfate 30 µL 50 µL TEMED µL µL 231   Western running buffer 1X Tris-glycine 25 mM Tris base 190 mM glycine 0.1% SDS Dissolve in deionized water and top up to 1000ml Western transfer buffer 25 mM Tris base 190 mM glycine 200ml methanol Top up to 1000ml with deionized water Tris-buffered Saline 24.23 g Trizma HCl 80.06 g NaCl Mix in 800 ml ultra pure water. Western wash buffer (TBST) 0.05% Tween-20 in Tris-buffered saline Complete RPMI media RPMI (4500 mg/ml glucose) 450 ml, FBS 50 ml 10 %, 200 mM L-glutamine ml, 100 units/ml penicillin/streptomycin ml Compete serum free media RPMI (4500 mg/ml glucose) 500 ml, 100 units/ml penicillin/streptomycin ml   232   Appendix 2. List of antibodies used for flow cytometry Antibody Rat anti-mouse CD31 Hamster anti-mouse podoplanin Hamster anti-mouse CD11c (PE) Rat anti mouse-B220 (Pacific Blue) Rat anti mouse-B220 (FITC) Rat anti mouse-B220 (PCP-Cy5.5) Hamster anti-mouse CD3e (APC) Mouse anti mouse-CD45.1 (Biotin) Mouse anti mouse-CD45.2 (PCPCy5.5) Rat anti-mouse CD11b (PCP-Cy5.5) Rat anti-mouse Gr-1 (Ly6C/G) (Biotin) Rat anti-mouse Gr-1 (Ly6C/G) (APC) Rat anti-mouse Ly6G (PE) Rat anti-mouse F4/80 (FITC) Rat anti-mouse CD115 (Biotin) Streptavidin PE Streptavidin Pacific Blue Streptavidin PCP-Cy5.5 Anti-rat IgG (APC) Anti-syrian hamster IgG (PE) Rat IgG2a (PE, FITC, biotin) Hamster IgG   Company Serotec DKSH eBioscience eBioscience eBioscience BD Pharmingen eBioscience eBioscience Clone ER-MP12 8.1.1 N418 RA3-6B2 RA3-6B3 eBioscience BD Pharmingen eBioscience eBioscience BD Pharmingen Serotec eBioscience Caltag Caltag eBioscience Invitrogen Calbiochem eBioscience Biolegend 104 RA3-6B4 145-2C11 104 M1/70 RB6-8C5 RB6-8C5 1A8 CI:A3-1 AFS98 NA NA NA NA NA NA NA 233   Appendix 3. List of antibodies used for immunofluorescence Antibody Rat anti mouse-B220 (Purified) Rat anti mouse-B220 (Biotin) Hamster anti-mouse TCRβ (Purified) Hamster anti-mouse CD11c (Purified) Hamster anti-mouse CD11c (Biotin) Rat anti-mouse CD11b (Purified) Rat anti-mouse Gr-1 (Ly6C/G) (Biotin) Rat anti-mouse Ly6G (Purified) Rat anti-mouse F4/80 (Biotin) Rat anti-mouse CD31 (FITC) Armenian hamster anti-mouse CD31 Rabbit anti-mouse LYVE-1 Rat anti-mouse anti-CD169 (FITC) Mouse anti mouse-CD45.1 (Biotin) Mouse anti mouse-CD45.2 (Biotin) Rat anti mouse-ERTR7 (Purified) Rat anti-mouse Ki67 (Purified) Rabbit anti-mouse VEGF-A (Purified) Goat anti-mouse VEGF-C (Purified) Rabbit anti-mouse MMP-9 (Purified) Goat anti-mouse TIMP-1 Streptavidin Cy3 Streptavidin Dylight647 Anti-rat IgG (Cy2, Cy3 or Cy5.5) Anti-armenian hamster IgG (Dylight549, Dylight647) Anti-rabbit IgG (Cy2, Cy3 or Cy5.5) Anti-goat IgG (Dylight549, Dylight647) Rat IgG2a Rabbit IgG Goat IgG Company eBioscience eBioscience BD Pharmingen eBioscience eBioscience BD Pharmingen eBioscience BD Pharmingen Serotec BD Pharmingen Millipore Abcam Serotec eBioscience eBioscience Acris Dako Santa Cruz Santa Cruz Abcam R and D Systems Jackson Jackson Jackson Clone RA3-6B2 RA3-6B3 H57-597 HL-3 HL-3 M1/70 RB6-8C5 1A8 CI:A3-1 390 MAB1398Z Polyclonal 3D6.112 104 105 ER-TR7 MIB-5 Polyclonal C-1 Polyclonal Polyclonal NA NA NA Jackson Jackson Jackson eBioscience Jackson Jackson NA NA NA NA NA NA Appendix 4. List of antibodies used for western blots Antibody Rabbit anti-mouse MMP-9 (Purified) Rabbit anti-mouse mature VEGF-C (Purified) Goat anti-mouse TIMP-1 Anti-rabbit IgG (HRP)   Company Abcam Clone Polyclonal Millipore R and D Systems Jackson Polyclonal Polyclonal NA 234   Appendix 5. List of primers used for RT-PCR Target gene VEGF-A forward reverse VEGF-A120 forward reverse VEGF-A164 forward reverse VEGF-A188 forward reverse VEGF-C forward reverse CXCL1 Forward reverse CXCL2 Forward reverse CXCL5 Forward reverse Bv8 Forward reverse T-bet forward reverse GATA-3 forward reverse ROR forward reverse FoxP3 forward reverse GAPDH forward reverse   Primer sequence 5’- CAGAAGGAGAGCAGAAGTCC -3’ 5’-CTCCAGGGCTTCATCGTTA-3’ 5’-TGCAGGCTGCTGTAACGATG-3’ 5’-CCTCGGCTTGTCACATTTTTCT-3’ 5’-TGCAGGCTGCTGTAACGATG-3’ 5’-GAACAAGGCTCACAGTGATTTTCT-3’ 5’-TGCAGGCTGCTGTAACGATG-3’ 5’-GAACAAGGCTCACAGTGATTTTCT-3’ 5’ GTAAAAACAAACTTTTCCCTAATTC-3’ 5’-TTTAAGGAAGCACTT CTGTGTGT -3’ 5-CCGAAGTCATAGCCACACTCAA-3 5-GCAGTCTGTCTTCTTTCTCCGTTAC-3 5-AGACAGAAGTCATAGCCACTCTCAAG-3 5-CCTCCTTTCCAGGTCAGTTAGC-3 5’-GGTCCACAGTGCCCTACG-3’ 5'-GCGAGTGCATTCCGCTTA-3' 5-GCATGACAGGAGTCATCATTTT-3 5- AAATGGCAGGATATCAGGAAA-3 5’-CAACAACCCCTTTGCCAAAG-3’ 5’-TCCCCCAAGCAGTTGACAGT-3’ 5’-GAAGGCATCCAGACCCGAAAC-3’ 5’-ACCCATGGCGGTGACCATGC-3’ 5’-TACCTTGGCCAAAACAGAGG-3’ 5’-GATGCCTGGTTTCCTCAAAA-3’ 5’-TTCATGCATCAGCTCTCCAC-3’ 5’-CTGGACACCCATTCCAGACT-3’ 5’-GACGGCCGCATCTTCTTGTG-3’ 5’-CTTCCCATTCTCGGCCTTGACTGT-3’ 235   [...]... be indispensable in driving lymphangiogenesis in the inflamed periphery (Baluk et al., 20 05; Cursiefen et al., 20 04b; Cursiefen et al., 20 11; Kang et al., 20 09; Kataru et al., 20 09; Kim et al., 20 09; Kubota et al., 20 09; Maruyama et al., 20 05; Yao et al., 20 10) and LNs draining the inflamed sites (Kataru et al., 20 09) DCs have been linked to the induction of lymphangiogenesis in various models of tissue... subcapsular region of the LN The heparin-binding carboxyl-domain of the predominant VEGF-A isoform, VEGF164 may bound the molecule to the extracellular matrix and limit its access deeper into the LN via the reticular network (Ferrara et al., 20 03) In contrast, at later phases of inflammation, VEGF-A expression was not restricted to the subcapsular region of the LN but extended into the cortical and medullary...   in the late phases of inflammation (Fig 6.1, D and E) 119     120   Figure 6.1 LN remodeling in WT and µMT mice following CFA/ KLH footpad immunization (A) Increase in LN cellularity in WT and µMT mice following immunization (B) Expansion of LECs population in WT and µMT mice following immunization (C) Immunofluorescence analysis of WT and µMT LN sections (D and E) Expansion of the BEC (D) and. .. cortical and medullary sinuses remodeling during late inflammation During early inflammation, VEGF-A may be transported from its primary site of production, i.e the inflamed peripheral tissue, to the DLNs (Halin et al., 20 07) and/ or produced by activated B cells or FRCs residing in the cortex of the DLNs (Angeli et al., 20 06) At this stage, VEGF-A expression was mainly confined to the subcapsular region of. .. results in an atypical recruitment of neutrophils into LNs during late inflammation, a phenomenon that was not observed in WT mice These findings echoed observations that have been made by other groups, describing the exaggerated and atypical recruitment of neutrophils into inflamed sites in the absence of B cells (Buendia et al., 20 02; Kondratieva et al., 20 10; Maglione et al., 20 07; Smelt et al., 20 00)... lymphangiogenesis in µMT LNs, it is unlikely that they were the only cells driving the process Depletion of monocytes and macrophages by the use of AFS98 MAb inhibited lymphangiogenesis in the µMT LNs, indicating that these cells play an equally critical role What is more likely is that both neutrophils and monocytes/ macrophages act in concert to drive inflammatory lymphangiogenesis in the µMT LNs and in the absence... for (A) and 20 0µm for (B) and (C)   126   6 .2. 3 Neutrophils are critical for lymph node lymphangiogenesis in the absence of B cells As expansion of neutrophils in µMT LNs at day 14 was the most dramatic amongst the immune cells and this coincided with a surge in lymphangiogenesis, we hypothesized that neutrophils may compensate for B cells to drive lymphangiogenesis during late inflammation In order... the temporal-spatial distribution of VEGF-A within the activated LNs during inflammation was dependent on interstitial flow In addition, interstitial flow may also support the production of VEGF-A by FRCs and/ or combined with expansion of the FRC network increase delivery of extra-nodal VEGF-A to the T cell zone Regardless of its source, VEGF-A may be displayed by cortical and medullary sinuses -lining... examined the T cell, DC and myeloid cell populations present in WT and µMT LNs as this may provide clues as to what cells may drive lymphangiogenesis in the absence of B cells We found similar increases in the T cell and DC populations in WT and µMT LNs at all time points after immunization (data not shown) Coincidentally, we observed a greater increase in the absolute numbers of myeloid cells (defined... expansion of the lymphatic network was clearly greater in inflamed WT compared to µMT LNs, this gave way to a greater growth of lymphatics in µMT LNs by day 14 post-immunization (Fig 6.1C) Expansion of the BEC and FRC populations in inflamed µMT LNs occurred in a manner similar to LECs In the early phase of inflammation, expansion of the BEC and FRC populations in µMT LNs was less compared to WT but the . was mainly confined to the subcapsular region of the LN. The heparin-binding carboxyl-domain of the predominant VEGF-A isoform, VEGF 164 may bound the molecule to the extracellular matrix and. through the LN could influence the spatial-temporal distribution of VEGF-A during the course of inflammation and, as a consequence, modulate the remodeling of cortical and medullary sinuses (Fig. 5.2C). ! 108! Altogether, these data indicate that as the inflammation evolved, spatial differences in the distribution of VEGF-A within DLNs may mediate the remodeling of cortical and