PERIPHERAL BLOOD: A SIMPLE CELL SOURCE FOR THE GENERATION OF ANGIOGENIC PROGENITORS FROM MONOCYTES ANNA MARIA BLOCKI (B.SC. UNIVERSITY OF APPLIED SCIENCES OF GELSENKIRCHEN) A THESIS SUBMITTED FOR THE DEGREE OF DOCTOR OF PHILOSOPHY NUS GRADUATE SCHOOL FOR INTEGRATIVE SCIENCES AND ENGINEERING NATIONAL UNIVERSITY OF SINGAPORE 2012 Declaration I hereby declare that the thesis is my original work and that it has been written by me in its entirety. To the best of my knowledge, I have duly referenced the sources of information and duly acknowledged the origin of other materials used in this thesis. This thesis has not been submitted for any degree in any university previously. ___________________________---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------_ Anna Blocki 26 December 2012 II Acknowledgements I would like to thank my supervisor, A/P Michael Raghunath, who introduced me to the art of research. He introduced the lab to me as a huge playground, which I could use to live my curiosity. I am glad that he left me the freedom to try out various ideas and that he supported and mentored me on the way. His excitement about the sometimes surprising results was infectious and his encouragement when I couldn’t see the light at the end of the tunnel helped me to enjoy the journey of my PhD. His support to make research happen much beyond the intellectual discussion ensured that we were able to get this far. I am thankful for the support from my colleagues in the Tissue Modulation Laboratory, especially from Yingting Wang, who joined my research project during my last year and helped to generate beautiful data. Her enthusiasm, positive and always smiling nature and will to achieve as much as she can, made working with her a joy. Maria Koch from the University of Applied Sciences in Bremen, who joined our lab just recently as an international student further added a fantastic character to our team and managed to produce an astonishing amount of data. Although not yet through with her undergraduate studies, it is obvious that she will be a great and passionate researcher. I hope I will be able to work with both of them in the future. I am grateful for the support and advice from Prof Herbert Schwarz, who introduced me into the fabulous research of immunology and helped to look into my research from a different angle. I would also like to thank Prof Kishore Bhakoo, who always asked critical questions and gave valuable feedback. He also provided the means of life-cell imaging and in vivo studies. At this point I also have to thank Shebbrin Shehzahdi, who is an experienced research assistant of Prof Bhakoo and conducted the in vivo experiments with me. I learned a lot from her. A very special thank you and an “I couldn’t have done it without you” have to be said to my husband Sebastian Beyer. He made me dream of a fabulous adventure in Asia and a unique life that would be satisfying personally and professionally. He always believed in me and I taught me to believe in myself and to reach for the stars. It was indispensable for me to have someone, I could share all the happy and frustrating moments and especially to ramble about my work, when it did not let me go. Besides the mental support Sebastian was a person who intellectually and physically helped me to my work. It makes oneself stronger to know that there is someone you can always count on. My parents and grandparents brought me up in a way that taught me to always work hard and play fair and never be satisfied with an outcome if I haven’t tried as hard as I could. Their pride of me through my whole life, their love and encouragement provided me with the safety that I could not disappoint them and would have always a family to turn to. I wouldn’t have brought up the courage to go the way I did without their support. I owe my little siblings and my close friends a very special thank you, because they always showed understanding and did not let me go despite the great geographical distance. It is good to know that I have a special place in their hearts and they have a special place in mine. II Table of Content Acknowledgements    I   Summary    V   List of Illustrations    VII   List of Tables    VII   List of Figures    VIII   List of abbreviations   .  IX   Chapter : Pericytes, more than just MSCs? A functional in vitro study of pericytes and bone marrow MSCs in angiogenesis    1   Scope of Chapter   .  1   Identification of pericytes   .  2   Pericyte  recruitment  and  function  during  development   .  2   Pericyte  recruitment  and  function  in  induced  angiogenesis   .  5   Origin  of  pericytes  in  induced  angiogenesis    6   Pericytes are a population of mesenchymal stem cells    7   Goals  and  Objectives    10   Results    11   Pericytes shared tested flow cytometry marker profile with bone marrow (bm) MSCs   .  11   Pericytes and bmMSCs but not fibroblasts differentiate into both mesenchymal lineages: osteoblasts and adipocytes   .  13   BmMSCs and fibroblasts not share the expression of NG2, desmin and Tie-2 with pericytes   .  14   Co-localisation with the endothelial network on matrigel is not a pericyte-specific behaviour   .  16   Pericytes contribute to the formation of cord structures in a monolayer co-culture   .  24   Discussion   .  27   Conclusion    29   Materials and Methods    31   Cell culture    31   Flow cytometry    31   Immunocytochemistry   .  32   Differentiation into adipocytes and osteoblasts    33   Life cell labelling    34   Tube formation assay on matrigel   .  34   Spheroid sprouting assay    34   2D cord formation assay   .  35   Statistical analysis   .  35   Chapter : Blood-derived angiogenic cells (BDAC) represent a pericytic population and enhance early stages of angiogenesis.    36   Scope of chapter   .  36   Introduction   .  37   Not all pericytes are MSCs    37   Formulation of hypothesis   .  38   Monocytes/macrophages  during  angiogenesis   .  39   Macrophage in the initial formation of vasculature during development    40   Macrophages in induced angiogenesis   .  42   Other non-conventional monocyte-derived cells generated in vitro    44   Fibrocytes and fibrocyte-like cells    45   Endothelial progenitor cells   .  48   Goals  and  objectives    50   Results   .  51   III Generation of spindle-shaped cells in large numbers in the presence of macromolecules   .  51   Spindle-shaped cells express pericyte markers   .  56   Spindle-shaped cells express markers related to angiogenesis    59   BDAC express a unique marker profile    60   BDAC are distinguishable from blood-derived fibrocytes and endothelial progenitors   .  61   BDAC are not a multipotent cell population   .  64   BDAC are distinguishable from classical M1 and M2 macrophages in vitro    65   BDAC co-localise with and stabilise endothelial networks on matrigel.   .  67   BDAC contribute and enhance endothelial sprouting in vitro   .  71   BDAC have a pro-angiogenic secretion profile and actively support endothelial sprouting via MMP secretion.    74   BDAC are pro-angiogenic in vivo   .  79   Discussion   .  86   BDAC represent a unique monocyte-derived cell population, which has pericyte characteristics and can be generated in clinically relevant numbers from peripheral blood.   .  86   BDAC exhibit a pericytic functional behaviour and are pro-angiogenic in vitro and in vivo   .  90   BDAC have a pro-angiogenic secretion profile and actively support endothelial sprouting via MMP9 secretion.    91   Conclusion    94   Future work   .  95   Materials and Methods    97   Cell culture    97   Generation of blood derived angiogenic cells (BDAC)   .  97   Study of the uptake of macromolecules by PBMC    98   Flow cytometry    98   Immunocytochemistry   .  98   Adherent cytometry to assess number of adherent cells after days (count of DAPI stained nuclei)    99   Differentiation into adipocytes and osteoblasts    99   RT-PCR    99   Induction of collagen I secretion and SDS-Page of pepsin digested culture    100   Life cell labelling   .  100   Tube formation assay on matrigel    100   Spheroid sprouting assay and inhibition of MMP9    100   Zymography   .  101   Angiogenesis proteome array    102   In vivo tumour model    102   Statistical analysis    103   References    104   Appendix: List of selected publications & academic contributions   .  113   Successful acquisition of research funding   .  113   Patents    113   Research articles   .  113   Conference Contributions   .  113   IV Summary Currently pericytes are considered to represent mesenchymal stem cells (MSCs) in a perivascular niche and can be recruited from bone marrow (bm). However literature in the past often suggested pericytes to express hematopoietic markers, when pericytes were studied at early stages of angiogenesis. MSCs lack hematopoietic and monocytic markers by definition. Therefore the discrepancy in marker expression of pericytes pointed to the notion that more than one pericyte population exists. “Early” pericytes would be hematopoietic and support early stages of angiogenesis. “Late” pericytes would be MSCs and recruited to forming vessels at later stages of angiogenesis, where they would stabilize and support maturation of formed vessels. We generated a novel, spindle-shaped, adherent cell type from human peripheral blood, which expressed besides hematopoietic markers CD45 and CD11b, pericyte-related markers PDGFR-β, NG2 and desmin. Therefore the generated cells could resemble the hematopoietic pericyte population, which was only studied in vivo so far. However, pericytes are an elusive cell type and so far there is no established knowledge on how to identify pericytes in vitro. Therefore we studied available pericytes derived from the placenta. We used this cell type to establish a pericyte specific marker expression and in vitro functional profile. Recently pericytes were isolated systematically from various tissues and were shown to be MSCs. In the scientific field the question arose if all MSCs might act as pericytes. Therefore we compared pericytes with bmMSCs and fibroblasts. We identified markers NG2, desmin and Tie-2 to distinguish pericytes from other stromal cells and demonstrated that only pericytes enhanced sprouting and sprout integrity in a spheroid sprouting assay. Further only pericytes contributed to cord formation with endothelial cells (EC) in a monolayer. We propose that pericytes are a subpopulation of MSCs, with specialised functions in blood V vessel biology that are not inherent to all MSCs. Thereby we also identified markers and functional behaviour in vitro to identify pericytes and distinguish it from other cell types. We then subjected the adherent spindle-shaped cells derived from human peripheral blood to the same assays. We showed that the generated cells co-localised with and stabilised endothelial networks on matrigel. Further we have shown that they enhance endothelial sprouting in vitro. The subcutaneous co-injection of generated cells with U87 glioma cells resulted in larger tumours with higher vasculature density. As the generated cells behaved strongly pro-angiogenic in vitro and in vivo we named them blood-derived angiogenic cells (BDAC). The pro-angiogenic secretion profile of BDAC indicated a role of BDAC in the support of endothelial migration, proliferation and sprouting. MMP9, secreted by BDAC, was proven to be a main driver thereof. In conclusion we developed a biotechnological platform to generate functional angiogenic cells from peripheral blood in clinically relevant numbers. This opens avenues for generating patient-specific cells from an easy accessible and renewable cell source for cell-based treatment of ischemic diseases. Further BDAC resemble a haematopoietic pericytic population described only in vivo so far. Therefore this will allow a more detailed study of these cells and their role in angiogenesis in vitro. VI List of Illustrations Illustration 2-1: Illustration of working hypothesis. . 39 Illustration 2-2: Molecular structure of MMP9/13 inhibitor. 101 List of Tables Table 1-1: Antibodies used for flow cytometry 32 Table 1-2: Antibodies used for immunocytochemistry . 33 Table 2-1: Angiogenic functions of the secreted factors by BDAC. 91 Table 2-2: Antibodies used for flow cytometry 98 Table 2-3: Antibodies used for immunocytochemistry . 98 VII List of Figures Figure 1-1: Pericytes have a MSC-related marker profile. . 11 Figure 1-2: Fibroblast share pericyte and bmMSC marker profile . 12 Figure 1-3: Pericyte and bmMSCs show a multipotent differentiation potential, which is not shared by fibroblasts. . 13 Figure 1-4: Pericyte marker NG2 and desmin are not shared by bmMSCs and fibroblast. 15 Figure 1-5: Tubular network formation is endothelial cell specific. . 16 Figure 1-6: Co-localisation with endothelial tubular network is not pericytic-specific 17 Figure 1-7: Only pericytes maintained endothelial network. 18 Figure 1-8: Only pericytes maintained endothelial network over a course of 24h. 19 Figure 1-9: Pericytes are able to significantly maintain endothelial tubular networks on matrigel. 20 Figure 1-10: Sprouting in an in vitro spheroid-sprouting assay is endothelial cell specific. 21 Figure 1-11: Pericytes enhance sprouting in an in vitro spheroid sprouting assay. 22 Figure 1-12: Only pericytes co-localise with formed sprouts. 23 Figure 1-13: Cord structures of pericytes and EC formed in monolayer co-cultures. 25 Figure 2-1: PBMC take up ficoll macromolecules of various macromolecular weights 52 Figure 2-2: Granulocytes and lymphocytes are the main fractions of PBMC to take up ficoll macromolecules . 53 Figure 2-3: Adherent spindle-shaped cells can be generated from PBMC in the presence of ficoll macromolecules . 55 Figure 2-4: BDAC express established pericyte markers. 57 Figure 2-5: BDAC express angiogenesis-related markers. . 59 Figure 2-6: BDAC express a marker profile not shared by other cells. 60 Figure 2-7: BDAC not express vWF or collagen I. . 62 Figure 2-8: BDAC not differentiate into osteoblasts or adipocytes. 64 Figure 2-9: BDAC are distinguishable from classical M1 and M2 macrophages and cannot be polarised. . 66 Figure 2-10: BDAC co-localise with endothelial tubular network on matrigel. . 68 Figure 2-11: BDAC co-localise with junction points of the endothelial tubular network. . 69 Figure 2-12: BDAC co-localise with the endothelial tubular network also in poor culture medium. 70 Figure 2-13: BDAC stabilise endothelial tubular network on matrigel 70 Figure 2-14: BDAC contribute to endothelial sprouting in vitro. . 71 Figure 2-15: BDAC enhance endothelial sprouting in vitro. 73 Figure 2-16: BDAC secrete a proangiogenic marker profile. . 75 Figure 2-17: BDAC secrete MMP9, which digests gelatine and collagen I in a zymograph. 76 Figure 2-18: MMP inhibition decreases sprouting efficiency only in EC -BDAC co-cultures. . 78 Figure 2-19: Solid glioma tumour has a larger size and weight, when co-injected with BDAC. . 80 Figure 2-20 : Co-injection of U87 and BDAC results in more microvasculature. . 81 Figure 2-21: Solid tumours, which result from co-injection of U87 cells with BDAC, possess a higher vascular density. 82 Figure 2-22: Only in solid tumours, which resulted from the co-injection of U87 cells with BDAC, mature larger vessels were observed. 84 VIII Study of the uptake of macromolecules by PBMC PBMCs were isolated as described above and seeded in LG DMEM (without phenol-red) containing either FITC-tagged Fc70 or Fc400 on non-adherent dishes for hour. Afterwards cells were collected and fixed in 1% formaldehyde for 15 minutes. Fixed cells were analysed either using the Cyan flow cytometer (Dako Cytomation) or resuspended in PBS buffer supplemented with 0.5 % FBS for further staining. Cells nuclei were stained with DAPI and the cytoskeleton with 594-labelled Phalloidin for 30 minutes. Cells were washed once with PBS buffer supplemented with 0.5 % FBS and resuspended in PBS. Cells were then distributed between two coverslips and viewed with a Zeiss apotome fluorescence microscope. Flow cytometry Flow cytometry was performed as explained in chapter 1. Antibodies used and not mentioned in chapter can be found in table 2-2. Antigen CD206 Cat No. Isotype Volume per 50µL Source 551135 Control FITC Mouse IgG1, κ 10 µL BD Pharmingen Table 2-2: Antibodies used for flow cytometry Immunocytochemistry BDAC were generated and methanol-fixed on day 5. Immunocytochemistry was performed as described in chapter 1. Antibodies used and not mentioned in chapter can be found in table 2-3. Antigen Cat No. VEGFR-1 (Flt-1) CD31 (PECAM-1) vWF PM-2K CD31 VE-cadherin ab32152 M0823 A0082 ab58822 ab28364 ab33168 Format Primary Antibodies Rabbit monoclonal Mouse monoclonal Rabbit polyclonal antiserum Mouse monoclonal Rabbit polyclonal Rabbit polyclonal Dilution Source :100 1:50 1:1000 1:1000 1:50 1:50 Abcam Dako Cytomation Dako Cytomation Abcam Abcam Abcam Table 2-3: Antibodies used for immunocytochemistry 98 Adherent cytometry to assess number of adherent cells after days (count of DAPI stained nuclei) Adherent fluorescent cytometry was based on a montage of sites per well taken by a coolSNAP HQ camera attached to a Nikon TE2000 microscope at 2x magnification, covering 83% of total well area. DAPI fluorescence was accessed with a single Dapi filter [Ex 350nm/Em 465nm]. The number of stained nuclei was imported into Microsoft Excel, and the mean ± SD of the areas was calculated. Differentiation into adipocytes and osteoblasts BDAC were induced using protocols described in chapter 1. RT-PCR Total RNA was extracted using the RNAeasy single step column spin (Qiagen) following the manufacturer’s protocol. Isolated mRNA concentrations were measured using Nanodrop and cDNA was synthesised from equal amounts of isolated mRNA using Superscript reverse transcriptase II. RT-PCR reactions were performed using following primers: collagen forward primer 5’ agccagcagatcgagaacat 3’, reverse primer 5’ cttgtccttggggtcttg 3’; vWF forward primer 5’taagtctgaagtagaggtgg 3’, reverse primer 5’ agagcagcaggagcactggt 3’. RT-PCR was monitored on a Stratagene real-time PCR instrument (Stratagene) with a PCR master mix based on Platinum Taq DNA polymerase (Invitrogen). Data analysis was performed using the MxPro software (Stratagene). For each cDNA sample, the Ct value was defined as the cycle number at which the fluorescence intensity reached the amplification based-threshold fixed by the instrument-software. Relative expression level for collagen I and vWF were calculated by normalising the quantified cDNA transcript level (Ct) to that of GAPDH. Fold-change of mRNA levels between samples was calculated as Ct1-Ct2. 99 Induction of collagen I secretion and SDS-Page of pepsin digested culture Collagen secretion into culture media was induced by supplementing the culture media with 100 mM L-ascorbic acid phosphate (Wako Pure Chemical Industries, Osaka, Japan). After days culture media were harvested into separate vials, culture medium was digested with porcine gastric mucosa pepsin (2500 U/mg; Roche Diagnostics Asia Pacific, Singapore) in a final concentration of 100 mg/mL. Samples were incubated at room temperature (RT) for 2h with gentle shaking followed by neutralisation with 0.1 N NaOH. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE): Medium and cell layer samples were analysed by SDS- PAGE with 5% acrylamide under non-reducing conditions. A small format was used (Mini-Protean 3; Bio-Rad Laboratories, Singapore). Protein bands were stained with the SilverQuestÔ kit (Invitrogen) according to the manufacturer’s protocol. Densitometric analysis of wet gels was performed on the GS-800Ô Calibrated Densitometer (Bio-Rad) with Quantity One v4.5.2 analysis software (Bio-Rad). Life cell labelling BDAC were labeled using the protocol mentioned in chapter 1. Tube formation assay on matrigel Tube formation assay was performed as described in chapter 1. HUVEC were co-cultured with BDAC on matrigel at a ratio of 2:1. Quantification of total tube length per taken area was done with the Fiji software using the simple neurite tracer plugin. Spheroid sprouting assay and inhibition of MMP9 Spheroid sprouting assay was performed as described in chapter 1. BDAC were either added to EC (HUVEC) to form spheroids at a ratio of 1:2 or as single cells at indicated cell concentration to the spheroid suspensions in EGM-2 with µg/ml methylcellulose. For 100 MMP9 inhibition MMP9/13 inhibitor (Santa Cruz, sc-311438, Ill. 2-2) was resuspended in DMSO to yield a stock concentration of 20.2 mM. MMP9/13 inhibitor was added at a final concentration of µM to the spheroid suspensions in EGM-2 with µg/ml methylcellulose. The MMP9/13 inhibitor is a piperazine-based, cell-permeable, and highly potent inhibitor of MMP-9 (IC50 = 900 pM) and MMP-13 (IC50 = 900 pM). It was reported to inhibit MMP-1 and MMP-3 at much higher concentrations (IC50 = 43 nM and 23 nM, respectively) and also acted as an inhibitor of MMP-7 (IC50 = 930 nM). Cumulative sprout length was measured with the Fiji software. Illustration 2-2: Molecular structure of MMP9/13 inhibitor. Zymography Zymograph SDS-PAGE gels composed of 10% acrylamide gel containing 1mg/ml gelatin or neutralised collagen I and of a stacking gel containing 3% acrylamide. Volumes of 20 µl of sample were loaded into each well of the gel and proteins in the samples were separated on the gel by SDS-PAGE. Zymographs were washed with buffer containing 2.5% TritonX100, 50 mM Tris, 5mM CaCl2 and 1µM ZnCl2 that allowed the MMPs, which were separated by their size to re-nature, for hour. Afterwards zymographs were rinsed with deionised H2O and incubated in a reaction buffer containing 50 mM Tris, mM CaCl2 and µM ZnCl2 at 37°C with gentle agitation over night. Zymographs were stained with Page Blue using manufacturer’s protocol. Briefly zymographs were rinsed with deionised H2O twice, 101 incubated for hour with the staining solution and washed more times with deionised H2O. Densitometric analysis of wet gels was performed on the GS-800Ô Calibrated Densitometer (Bio-Rad) with the Quantity One v4.5.2 image analysis software (Bio-Rad). Angiogenesis proteome array BDAC were incubated with LG DMEM containing 0.5% FBS for days. Media was collected and un-conditioned media as a control were filtered through a 0.22 µm pore-size filter. Secretion profile of BDAC was established using an angiogenesis proteome array from (R&D) (Cat. no. ARY007) following the manufacturers protocol. Captured antigens were visualised using a chemiluminescence substrate from Pierce (femto) and a Versadoc (Biorad). In vivo tumour model 2.5 million U87-MG cells were mixed alone or together with million BDAC in 200 µl of L15 media and added to concentrated matrigel at a v/v ratio 1:1. Nude mice were anesthetised using isoflurane. Cell suspensions (200 µl containing million U87 and 0.5 million BDAC) were injected subcutaneously into the flanks of the mice. U87-MG cells alone were injected on the left and U87-MG cells with BDAC on the right. After tumours had reached a critical size mice were sacrificed and tumours harvested. Tumours were snap-frozen in liquid nitrogen and stored at -80°C. Samples were embedded in OCT medium and cryosectioned at a thickness of µm. Cryosections were fixed in ice-cold 100% methanol and air-dried. Sections were blocked with 3% BSA in PBS for hour and incubated with rabbit polyclonal antibodies against CD31, VE-cadherin or vWF diluted in PBS (table 2-3) for 1.5 hours. Slides were washed times with PBS for 10 minutes in coblin jars and then incubated with secondary antibodies and DAPI for 30 minutes. washes of the slides with PBS were repeated and sections were mounted. Sections were viewed using an epifluorescence microscope (Olympus, IX71) or an Apotome (Zeiss). 102 Statistical analysis Obtained values were averaged and are displayed as average value +/- standard deviation. Pvalues were calculated using student’s t-test. 103 References     Abe, R, S C Donnelly, T Peng, R Bucala and C N Metz. 2001. "Peripheral blood fibrocytes: differentiation pathway and migration to wound sites." J Immunol 166(12):7556-7562.
 Alexandra Abramsson, Örjan Berlin, Hayk Papayan, Denise Paulin, Moshe Shani, Christer Betsholtz, PhD. 2002. "Analysis of Mural Cell Recruitment to Tumor Vessels." Circulation 105(1):112-117.
 Aidoudi, Sallouha and Andreas Bikfalvi. 2010. "Interaction of PF4 (CXCL4) with the vasculature: a role in atherosclerosis and angiogenesis." Thromb Haemost 104(5):941-948.
 Armulik, Annika, Guillem Genové and Christer Betsholtz. 2011. "Pericytes: developmental, physiological, and pathological perspectives, problems, and promises." Dev Cell 21(2):193215.
 Asahara, T, T Murohara, A Sullivan, M Silver, R van der Zee, T Li, B Witzenbichler, G Schatteman and J M Isner. 1997. "Isolation of putative progenitor endothelial cells for angiogenesis." Science 275(5302):964-967.
 Bellini, Alberto and Sabrina Mattoli. 2007. "The role of the fibrocyte, a bone marrow-derived mesenchymal progenitor, in reactive and reparative fibroses." Lab Invest 87(9):858-870.
 Brighton, C T, D G Lorich, R Kupcha, T M Reilly, A R Jones and R A Woodbury. 1992. "The pericyte as a possible osteoblast progenitor cell." Clin Orthop Relat Res (275):287-299.
 Bucala, R, L A Spiegel, J Chesney, M Hogan and A Cerami. 1994. "Circulating fibrocytes define a new leukocyte subpopulation that mediates tissue repair." Mol Med 1(1):71-81.
 Canfield, A E, A B Sutton, J A Hoyland and A M Schor. 1996. "Association of thrombospondin-1 with osteogenic differentiation of retinal pericytes in vitro." J Cell Sci 109 ( Pt 2):343-353.
 Caplan, Arnold I 2008. "All MSCs are pericytes? (1)." Cell stem cell 3(3):229-230.
 Chen, Clarice, Felicia Loe, Anna Blocki, Yanxian Peng and Michael Raghunath. 2011. "Applying macromolecular crowding to enhance extracellular matrix deposition and its remodeling in vitro for tissue engineering and cell-based therapies." Adv Drug Deliv Rev 63(4-5):277-290.
 Chesney, J, M Bacher, A Bender and R Bucala. 1997. "The peripheral blood fibrocyte is a 104 potent antigen-presenting cell capable of priming naive T cells in situ." Proc Natl Acad Sci U S A 94(12):6307-6312.
 Corselli, M., C. W. Chen, M. Crisan, L. Lazzari and B. Peault. 2010. "Perivascular ancestors of adult multipotent stem cells. (1)." Arterioscler Thromb Vasc Biol 30(6):1104-1109.
 Corselli, Mirko, Chien-Wen Chen, Bin Sun, Solomon Yap, J Peter Rubin and Bruno Péault. 2012. "The tunica adventitia of human arteries and veins as a source of mesenchymal stem cells." Stem Cells Dev 21(8):1299-1308.
 Crisan, Mihaela, Chien-Wen Chen, Mirko Corselli, Gabriella Andriolo, Lorenza Lazzari and Bruno Péault. 2009. "Perivascular multipotent progenitor cells in human organs." Ann N Y Acad Sci 1176:118-123.
 Crisan, Mihaela, Solomon Yap, Louis Casteilla, Chien-Wen Chen, Mirko Corselli, Tea Soon Park, Gabriella Andriolo, Bin Sun, Bo Zheng, Li Zhang, Cyrille Norotte, Pang-Ning Teng, Jeremy Traas, Rebecca Schugar, Bridget M. Deasy, Stephen Badylak, Hans-Jörg Bûhring, Jean-Paul Giacobino, Lorenza Lazzari, Johnny Huard and Bruno Péault. 2008. "A perivascular origin for mesenchymal stem cells in multiple human organs." Cell stem cell 3(3):301-313.
 da Silva Meirelles, L 2006. "Mesenchymal stem cells reside in virtually all post-natal organs and tissues." J Cell Sci 119(11):2204-2213.
 Dar, Ayelet, Hagit Domev, Oren Ben-Yosef, Maty Tzukerman, Naama Zeevi-Levin, Atara Novak, Igal Germanguz, Michal Amit and Joseph Itskovitz-Eldor. 2012. "Multipotent vasculogenic pericytes from human pluripotent stem cells promote recovery of murine ischemic limb." Circulation 125(1):87-99.
 Darland, D C and P A D'Amore. 2001. "TGF beta is required for the formation of capillarylike structures in three-dimensional cocultures of 10T1/2 and endothelial cells." Angiogenesis 4(1):11-20.
 De Palma, Michele, Mary Anna Venneri, Rossella Galli, Lucia Sergi Sergi, Letterio S. Politi, Maurilio Sampaolesi and Luigi Naldini. 2005. "Tie2 identifies a hematopoietic lineage of proangiogenic monocytes required for tumor vessel formation and a mesenchymal population of pericyte progenitors. (1)." Cancer Cell 8(3):211-226.
 Dellavalle, Arianna, Maurilio Sampaolesi, Rossana Tonlorenzi, Enrico Tagliafico, Benedetto Sacchetti, Laura Perani, Anna Innocenzi, Beatriz G Galvez, Graziella Messina, Roberta Morosetti, Sheng Li, Marzia Belicchi, Giuseppe Peretti, Jeffrey S Chamberlain, Woodring E Wright, Yvan Torrente, Stefano Ferrari, Paolo Bianco and Giulio Cossu. 2007. "Pericytes of human skeletal muscle are myogenic precursors distinct from satellite cells." Nat Cell Biol 9(3):255-267.
 105 Diaz-Flores, L, R Gutierrez, A Lopez-Alonso, R Gonzalez and H Varela. 1992. "Pericytes as a supplementary source of osteoblasts in periosteal osteogenesis." Clin Orthop Relat Res (275):280-286.
 Dimmeler, S., J. Burchfield and A. M. Zeiher. 2008. "Cell-based therapy of myocardial infarction." Arterioscler Thromb Vasc Biol 28(2):208-216.
 Dominici, M, K Le Blanc, I Mueller, I Slaper-Cortenbach, Fc Marini, Ds Krause, Rj Deans, A Keating, Dj Prockop and Em Horwitz. 2006. "Minimal criteria for defining multipotent mesenchymal stromal cells. The International Society for Cellular Therapy position statement." Cytotherapy 8(4):315-317.
 Dore-Duffy, Paula, Andre Katychev, Xueqian Wang and Eric Van Buren. 2006. "CNS microvascular pericytes exhibit multipotential stem cell activity." J Cereb Blood Flow Metab 26(5):613-624.
 Eubank, Tim D., Ryan Roberts, Michelle Galloway, Yijie Wang, David E. Cohn and Clay B. Marsh. 2004. "GM-CSF induces expression of soluble VEGF receptor-1 from human monocytes and inhibits angiogenesis in mice." Immunity 21(6):831-842.
 Fantin, A., J. M. Vieira, G. Gestri, L. Denti, Q. Schwarz, S. Prykhozhij, F. Peri, S. W. Wilson and C. Ruhrberg. 2010. "Tissue macrophages act as cellular chaperones for vascular anastomosis downstream of VEGF-mediated endothelial tip cell induction." Blood 116(5):829-840.
 Farrington-Rock, C 2004. "Chondrogenic and adipogenic potential of microvascular pericytes." Circulation 110(15):2226-2232.
 Fuchs, Sabine, Maria Iris Hermanns and Charles James Kirkpatrick. 2006. "Retention of a differentiated endothelial phenotype by outgrowth endothelial cells isolated from human peripheral blood and expanded in long-term cultures." Cell Tissue Res 326(1):79-92.
 Gaengel, K., G. Genove, A. Armulik and C. Betsholtz. 2009. "Endothelial-mural cell signaling in vascular development and angiogenesis. (1)." Arterioscler Thromb Vasc Biol 29(5):630-638.
 Gerhardt, Holger and Christer Betsholtz. 2003. "Endothelial-pericyte interactions in angiogenesis." Cell Tissue Res 314(1):15-23.
 Gulati, R 2003. "Diverse origin and function of cells with endothelial phenotype obtained from adult human blood." Circ Res 93(11):1023-1025.
 106 Guzman, Raul J. 2007. "Clinical, cellular, and molecular aspects of arterial calcification." J Vasc Surg 45 Suppl A:A57-A63.
 Hartlapp, I, R Abe, R W Saeed, T Peng, W Voelter, R Bucala and C N Metz. 2001. "Fibrocytes induce an angiogenic phenotype in cultured endothelial cells and promote angiogenesis in vivo." FASEB journal : official publication of the Federation of American Societies for Experimental Biology 15(12):2215-2224.
 Hellström, M, H Gerhardt, M Kalén, X Li, U Eriksson, H Wolburg and C Betsholtz. 2001. "Lack of pericytes leads to endothelial hyperplasia and abnormal vascular morphogenesis." J Cell Biol 153(3):543-553.
 Hellström, M, M Kalén, P Lindahl, A Abramsson and C Betsholtz. 1999. "Role of PDGF-B and PDGFR-beta in recruitment of vascular smooth muscle cells and pericytes during embryonic blood vessel formation in the mouse." Development 126(14):3047-3055.
 Hirschi, K K and P A D'Amore. 1996. "Pericytes in the microvasculature." Cardiovasc Res 32(4):687-698.
 Hirschi, K K, S A Rohovsky, L H Beck, S R Smith and P A D'Amore. 1999. "Endothelial cells modulate the proliferation of mural cell precursors via platelet-derived growth factor-BB and heterotypic cell contact." Circ Res 84(3):298-305.
 Hoeben, Ann, Bart Landuyt, Martin S Highley, Hans Wildiers, Allan T Van Oosterom and Ernst A De Bruijn. 2004. "Vascular endothelial growth factor and angiogenesis." Pharmacol Rev 56(4):549-580.
 Hong, K. M., J. A. Belperio, M. P. Keane, M. D. Burdick and R. M. Strieter. 2007. "Differentiation of human circulating fibrocytes as mediated by transforming growth factorbeta and peroxisome proliferator-activated receptor gamma." J Biol Chem 282(31):2291022920.
 Hong, Kurt M, Marie D Burdick, Roderick J Phillips, David Heber and Robert M Strieter. 2005. "Characterization of human fibrocytes as circulating adipocyte progenitors and the formation of human adipose tissue in SCID mice." FASEB journal : official publication of the Federation of American Societies for Experimental Biology 19(14):2029-2031.
 Horwitz, EM, K Le Blanc, M Dominici, I Mueller, I Slaper-Cortenbach, FC Marini, RJ Deans, DS Krause and A Keating. 2005. "Clarification of the nomenclature for MSC: The International Society for Cellular Therapy position statement." Cytotherapy 7(5):393-395.
 Hristov, M 2003. "Endothelial progenitor cells: mobilization, differentiation, and homing." Arterioscler Thromb Vasc Biol 23(7):1185-1189.
 107 Hur, J 2004. "Characterization of two types of endothelial progenitor cells and their different contributions to neovasculogenesis." Arterioscler Thromb Vasc Biol 24(2):288-293.
 Ingram, David A, Laura E Mead, Hiromi Tanaka, Virginia Meade, Amy Fenoglio, Kelly Mortell, Karen Pollok, Michael J Ferkowicz, David Gilley and Mervin C Yoder. 2004. "Identification of a novel hierarchy of endothelial progenitor cells using human peripheral and umbilical cord blood." Blood 104(9):2752-2760.
 Kidd, Shannon, Erika Spaeth, Keri Watson, Jared Burks, Hongbo Lu, Ann Klopp, Michael Andreeff, Frank C. Marini and Pranela Rameshwar. 2012. "Origins of the tumor microenvironment: quantitative assessment of adipose-derived and bone marrow-derived stroma." PloS one 7(2):e30563.
 Kim, Sun-Jin, Jang-Seong Kim, John Papadopoulos, Seung Wook Kim, Marva Maya, Fahao Zhang, Junquin He, Dominic Fan, Robert Langley and Isaiah J. Fidler. 2009. "Circulating monocytes expressing CD31: implications for acute and chronic angiogenesis. (1)." Am J Pathol 174(5):1972-1980.
 Kokovay, Erzsebet, Lu Li and Lee A Cunningham. 2005. "Angiogenic recruitment of pericytes from bone marrow after stroke (1)." Journal of Cerebral Blood Flow & Metabolism 26(4):545-555.
 Kuwana, Masataka, Yuka Okazaki, Hiroaki Kodama, Keisuke Izumi, Hidekata Yasuoka, Yoko Ogawa, Yutaka Kawakami and Yasuo Ikeda. 2003. "Human circulating CD14+ monocytes as a source of progenitors that exhibit mesenchymal cell differentiation." J Leukoc Biol 74(5):833-845.
 Kuwana, Masataka, Yuka Okazaki, Hiroaki Kodama, Takashi Satoh, Yutaka Kawakami and Yasuo Ikeda. 2006. "Endothelial differentiation potential of human monocyte-derived multipotential cells." Stem Cells 24(12):2733-2743.
 Lamagna, Chrystelle and Gabriele Bergers. 2006. "The bone marrow constitutes a reservoir of pericyte progenitors. (2)." J Leukoc Biol 80(4):677-681.
 Laurent, Julien, Cedric Touvrey, Francesca Botta, Franois Kuonen and Curzio Ruegg. 2011. "Emerging paradigms and questions on pro-angiogenic bone marrow-derived myelomonocytic cells." Int J Dev Biol 55(4-5):527-534.
 Leveen, P, M Pekny, S Gebre-Medhin, B Swolin, E Larsson and C Betsholtz. 1994. "Mice deficient for PDGF B show renal, cardiovascular, and hematological abnormalities." Genes Dev 8(16):1875-1887.
 Li, Aihua, Seema Dubey, Michelle L Varney, Bhavana J Dave and Rakesh K Singh. 2003. 108 "IL-8 directly enhanced endothelial cell survival, proliferation, and matrix metalloproteinases production and regulated angiogenesis." J Immunol 170(6):3369-3376.
 Li, Qing, Ying Yu, Joyce Bischoff, John B Mulliken and Bjorn R Olsen. 2003. "Differential expression of CD146 in tissues and endothelial cells derived from infantile haemangioma and normal human skin." J Pathol 201(2):296-302.
 Lin, E. Y., J.-F. Li, L. Gnatovskiy, Y. Deng, L. Zhu, D. A. Grzesik, H. Qian, X.-n. Xue and J. W. Pollard. 2006. "Macrophages regulate the angiogenic switch in a mouse model of breast cancer." Cancer Res 66(23):11238-11246.
 Lin, Y, D J Weisdorf, A Solovey and R P Hebbel. 2000. "Origins of circulating endothelial cells and endothelial outgrowth from blood." J Clin Invest 105(1):71-77.
 Lindahl, P, B R Johansson, P Levéen and C Betsholtz. 1997. "Pericyte loss and microaneurysm formation in PDGF-B-deficient mice." Science 277(5323):242-245.
 Mantovani, A 2006. "Macrophage diversity and polarization: in vivo veritas." Blood 108(2):408-409.
 Mason  C.,  Dunnill  P  2009.  Assessing  the  value  of  autologous  and  allogeneic  cells  for   regenerative  medicine.  Regen.  Med.  4(6):  835-­‐53.   Mehta, Veela B. and Gail E. Besner. 2007. "HB-EGF promotes angiogenesis in endothelial cells via PI3-kinase and MAPK signaling pathways." Growth Factors 25(4):253-263.
 Miyamoto, Shingo, Hiroshi Yagi, Fusanori Yotsumoto, Shinji Horiuchi, Toshiyuki Yoshizato, Tatsuhiko Kawarabayashi, Masahide Kuroki and Eisuke Mekada. 2007. "New approach to cancer therapy: heparin binding-epidermal growth factor-like growth factor as a novel targeting molecule." Anticancer Res 27(6A):3713-3721.
 Mosser, David M. and Justin P. Edwards. 2008. "Exploring the full spectrum of macrophage activation." Nat Rev Immunol 8(12):958-969.
 Mukai, Nana, Taichi Akahori, Motohiro Komaki, Qin Li, Toshie Kanayasu-Toyoda, Akiko Ishii-Watabe, Akiko Kobayashi, Teruhide Yamaguchi, Mayumi Abe, Teruo Amagasa and Ikuo Morita. 2008. "A comparison of the tube forming potentials of early and late endothelial progenitor cells." Exp Cell Res 314(3):430-440.
 Murdoch, Craig, Munitta Muthana, Seth B. Coffelt and Claire E. Lewis. 2008. "The role of myeloid cells in the promotion of tumour angiogenesis." Nat Rev Cancer 8(8):618-631.
 Niu, J., A. Azfer, O. Zhelyabovska, S. Fatma and P. E. Kolattukudy. 2008. "Monocyte 109 chemotactic protein (MCP)-1 promotes angiogenesis via a novel transcription factor, MCP-1induced protein (MCPIP)." J Biol Chem 283(21):14542-14551.
 Nucera, Silvia, Daniela Biziato and Michele De Palma. 2011. "The interplay between macrophages and angiogenesis in development, tissue injury and regeneration." Int J Dev Biol 55(4-5):495-503.
 Ongusaha, P. P 2004. "HB-EGF is a potent inducer of tumor growth and angiogenesis." Cancer Res 64(15):5283-5290.
 Orlidge, A and P A D'Amore. 1987. "Inhibition of capillary endothelial cell growth by pericytes and smooth muscle cells." J Cell Biol 105(3):1455-1462.
 Ozerdem, U 2005. "Contribution of Bone Marrow-Derived Pericyte Precursor Cells to Corneal Vasculogenesis." Invest Ophthalmol Vis Sci 46(10):3502-3506.
 Ozerdem, U, K A Grako, K Dahlin-Huppe, E Monosov and W B Stallcup. 2001. "NG2 proteoglycan is expressed exclusively by mural cells during vascular morphogenesis." Dev Dyn 222(2):218-227.
 Patan, S. 1998. "TIE1 and TIE2 receptor tyrosine kinases inversely regulate embryonic angiogenesis by the mechanism of intussusceptive microvascular growth." Microvasc Res 56(1):1-21.
 Peault, B 2012. "Are mural cells guardians of stemness?: From pluri- to multipotency via vascular pericytes." Circulation 125(1):12-13.
 Pufe, Thomas, Wolf Petersen, Fred Fändrich, Deike Varoga, Christoph J. Wruck, Rolf Mentlein, Andreas Helfenstein, Daniela Hoseas, Stefanie Dressel, Bernhard Tillmann and Maren Ruhnke. 2008. "Programmable cells of monocytic origin (PCMO): a source of peripheral blood stem cells that generate collagen type II-producing chondrocytes." J Orthop Res 26(3):304-313.
 Raghunath, Michael, Yuan Sy Wong, Muhammad Farooq and Ruowen Ge. 2009. "Pharmacologically induced angiogenesis in transgenic zebrafish." Biochem Biophys Res Commun 378(4):766-771.
 Rajantie, Iiro, Maritta Ilmonen, Agne Alminaite, Ugur Ozerdem, Kari Alitalo and Petri Salven. 2004. "Adult bone marrow-derived cells recruited during angiogenesis comprise precursors for periendothelial vascular mural cells." Blood 104(7):2084-2086.
 Rajkumar, Vineeth S., Xu Shiwen, Maria Bostrom, Patricia Leoni, John Muddle, Mikael Ivarsson, Bengt Gerdin, Christopher P. Denton, George Bou-Gharios, Carol M. Black and 110 David J. Abraham. 2006. "Platelet-Derived Growth Factor-â Receptor Activation Is Essential for Fibroblast and Pericyte Recruitment during Cutaneous Wound Healing (1)." Am J Pathol 169(6):2254-2265.
 Ruhnke, Maren, Hendrik Ungefroren, Andreas Nussler, Franz Martin, Marc Brulport, Wiebke Schormann, Jan G Hengstler, Wolfram Klapper, Karin Ulrichs, James A Hutchinson, Bernat Soria, Reza M Parwaresch, Peter Heeckt, Bernd Kremer and Fred Fändrich. 2005. "Differentiation of in vitro-modified human peripheral blood monocytes into hepatocyte-like and pancreatic islet-like cells." Gastroenterology 128(7):1774-1786.
 Rymo, Simin F., Holger Gerhardt, Fredrik Wolfhagen Sand, Richard Lang, Anne Uv, Christer Betsholtz and Mike O. Karl. 2011. "A two-way communication between microglial cells and angiogenic sprouts regulates angiogenesis in aortic ring cultures." PloS one 6(1):e15846.
 Salcedo, R, M L Ponce, H A Young, K Wasserman, J M Ward, H K Kleinman, J J Oppenheim and W J Murphy. 2000. "Human endothelial cells express CCR2 and respond to MCP-1: direct role of MCP-1 in angiogenesis and tumor progression." Blood 96(1):34-40.
 Schrimpf, Claudia and Jeremy S Duffield. 2011. "Mechanisms of fibrosis: the role of the pericyte." Curr Opin Nephrol Hypertens 20(3):297-305.
 Shao, Diane D, Rahul Suresh, Varsha Vakil, Richard H Gomer and Darrell Pilling. 2008. "Pivotal Advance: Th-1 cytokines inhibit, and Th-2 cytokines promote fibrocyte differentiation." J Leukoc Biol 83(6):1323-1333.
 Shi, Songtao and Stan Gronthos. 2003. "Perivascular niche of postnatal mesenchymal stem cells in human bone marrow and dental pulp." J Bone Miner Res 18(4):696-704.
 Sica, Antonio, Paola Larghi, Alessandra Mancino, Luca Rubino, Chiara Porta, Maria Grazia Totaro, Monica Rimoldi, Subhra Kumar Biswas, Paola Allavena and Alberto Mantovani. 2008. "Macrophage polarization in tumour progression." Semin Cancer Biol 18(5):349-355.
 Sims, D E. 1986. "The pericyte--a review." Tissue Cell 18(2):153-174.
 Song, Steven, Andrew J Ewald, William Stallcup, Zena Werb and Gabriele Bergers. 2005. "PDGFRbeta+ perivascular progenitor cells in tumours regulate pericyte differentiation and vascular survival." Nat Cell Biol 7(9):870-879.
 Soriano, P. 1994. "Abnormal kidney development and hematological disorders in PDGF betareceptor mutant mice." Genes Dev 8(16):1888-1896.
 Sunderkötter, C, K Steinbrink, M Goebeler, R Bhardwaj and C Sorg. 1994. "Macrophages and angiogenesis." Epidemiol Bull 55(3):410-422.
 111 Tang, Wei, Daniel Zeve, Jae Myoung Suh, Darko Bosnakovski, Michael Kyba, Robert E Hammer, Michelle D Tallquist and Jonathan M Graff. 2008. "White fat progenitor cells reside in the adipose vasculature." Science 322(5901):583-586.
 Tigges, U., E. G. Hyer, J. Scharf and W. B. Stallcup. 2008. "FGF2-dependent neovascularization of subcutaneous Matrigel plugs is initiated by bone marrow-derived pericytes and macrophages." Development 135(3):523-532.
 Tögel, Florian and Christof Westenfelder. 2007. "Adult bone marrow-derived stem cells for organ regeneration and repair." Dev Dyn 236(12):3321-3331.
 Ueno, T, M Toi, H Saji, M Muta, H Bando, K Kuroi, M Koike, H Inadera and K Matsushima. 2000. "Significance of macrophage chemoattractant protein-1 in macrophage recruitment, angiogenesis, and survival in human breast cancer." Clin Cancer Res 6(8):3282-3289.
 Yoon, C.-H 2005. "Synergistic neovascularization by mixed transplantation of early endothelial progenitor cells and late outgrowth endothelial cells: the role of angiogenic cytokines and matrix metalloproteinases." Circulation 112(11):1618-1627.
 Yong Zhao, David Glesne, and Eliezer Huberman. 2003. "A human peripheral blood monocyte-derived subset acts as pluripotent stem cells." Proceedings of the National Academy of Sciences 100(5):2426-2431.
 Zhuge, Xin, Toshinori Murayama, Hidenori Arai, Ryoko Yamauchi, Makoto Tanaka, Takeshi Shimaoka, Shin Yonehara, Noriaki Kume, Masayuki Yokode and Toru Kita. 2005. "CXCL16 is a novel angiogenic factor for human umbilical vein endothelial cells." Biochem Biophys Res Commun 331(4):1295-1300.
 112 Appendix: List of selected publications & academic contributions Successful acquisition of research funding ING09006, Singapore MIT alliance for research and technology 49,800 S$ - official collaborator ING11024-BIO, Singapore MIT alliance for research and technology 89,600 S$ - official collaborator Patents 1. WO2011108993 (A1) Culture Additives to boost stem cell proliferation and differentiation response, M. Raghunath, F. Loe, A. Blocki, Y. Peng 2. PCT filing number SG2012/000083, Pericyte Progenitors from Peripheral Blood, M. Raghunath, A. Blocki Research articles 1. Applying macromolecular crowding to enhance extracellular matrix deposition and its remodeling in vitro for tissue engineering and cell-based therapies, Chen, C.; Loe, F.; Blocki, A.; Peng, Y.; Raghunath, M.; ADVANCED DRUG DELIVERY REVIEWS, 63, 4-5, pp 277-290, 2011. 2. Assembly of biomacromolecule loaded polyelectrolyte multilayer capsules by using water soluble sacrificial templates. Sebastian Beyer, Jianhao Bai , Anna M. Blocki , Chaitanya Kantak , Qianru Xue , Michael Raghunath and Dieter Trau ; Soft Matter, 2012,8, 2760-276. Conference Contributions Talks 1. Dirty Surface - Cleaner Cells? Some Observations with a Bio-Assembled Extracellular Matrix; Loe, F. C.; Peng, Y.; Blocki, A.; Thomson, A.; Lareu, R. R.; Raghunath, M.; 13TH INTERNATIONAL CONFERENCE ON BIOMEDICAL ENGINEERING, VOLS 1-3, IFMBE Proceedings , 23, 1-3,1469-1472, 2009 2. A novel approach to derive pericyte progenitors from peripheral blood, Anna Blocki, Kishore Bhakoo, Michael Raghunath, TERMIS AP meeting August 2011, Singapore, Singapore Posters 1. Generating Multipotent Fibrocytes from Peripheral Blood under Macromolecular Crowding, Anna Blocki, Michael Raghunath, TERMIS EU meeting June 2010 in Galway, Ireland 2. Lipid core alginate shell microparticles for tissue engineering; Beyer S.; Blocki A.; Bai J.; Raghunath M.; Trau D.; Poster Presentation at TERMIS EU meeting June 2010 in Galway, Ireland. 3. A Novel Approach to Generate Pericyte Precursors From Peripheral Blood, Anna Blocki, Michael Raghunath, Regenerative medicine-innovation for clinical therapies symposium March 2011, Hilton Head, USA 4. A Novel Approach to Generate Pericyte Progenitors from Peripheral Blood, Anna Blocki, Yingting Wang, Kishore Bhakoo, Michael Raghunath, Keystone symposium: Angiogenesis: Advances in Basic Science and Therapeutic Applications, January 2012, Snowbird Utah, USA     113 [...]... like anaemia, thrombocythemia, enlarged and deformed hearts and reduced size of livers and kidneys (Leveen et al 1994) Large blood vessels like the aorta were dilated (almost double the diameter) with a thinner layer of smooth muscle cells (SMC), the perivascular cells found around large blood vessels As the number of SMC remained the same as in control groups the thinning of the muscular layer was thought... which are commercially available, were compared in their marker expression and functional behaviour in various angiogenic in vitro assays We aimed to establish a platform to identify and characterise pericytes in vitro with easily accessible cell sources By this means we hope to establish a standard for pericyte identification, which due to the availability of cells and other resources can be used by other... et al 2012) The current results clearly indicate that at least a subset of pericytes originates from the bone marrow in induced angiogenesis What ratio of pericytes is recruited from the bone marrow to the angiogenic side will depend on the nature of the tumour or wound (Lamagna et al 2006) Pericytes are a population of mesenchymal stem cells Bone marrow is a source of MSCs The minimal criteria of. .. potential pericyte populations and other angiogenic cells Ms Yingting Wang, a master student, who joined the project under my supervision during the last year helped with the conduction of some of the experiments Together we established the marker profile and she performed the majority tube formation assays on matrigel The raw data were analysed and compiled by myself A manuscript that comprises of these... tumour associated macrophage basic fibroblast growth factor transforming growth factor β urokinase plasminogen activator matrix metallo protease Tie-2 expressing macrophage mesenchymal progenitor cells peripheral blood mononuclear cells endothelial progenitor cells granulocyte/macrophage-colony stimulating factor outgrowth endothelial cells endothelial like cells endothelial nitric oxide synthase ficoll... the stretched vessel diameter There was no sign of underdevelopment or degeneration of the blood vessels As SMC are located 2 around blood vessels it was suggested that PDGF-B was not responsible for the recruitment or proliferation of SMC, but rather for the modulation of cellular functions like cellular contraction, which is necessary for vascular wall integrity Interestingly, elastic membranes and... which are the networks of capillaries in the kidney, lacked mesangial cells, the specialized pericytes in the kidney, leading to leakage of glomeruli The cause of haemorrhages was then determined to be the lack of pericytes in various tissues like brain, lung, heart and adipose tissue in PDGF-B knockout mice (Lindahl et al 1997) PDGFR-β positive cells were found in the wall of large blood vessels such as... to a marker expression analysis Figure 1-1: Pericytes have a MSC-related marker profile Pericytes derived from the placenta and bmMSCs were grown in triplicates in separate flasks for one passage until confluency and were stained for MSC, EC and hematopoietic markers and analysed via flow cytometry Full graphs represent the isotype control, whereas checked graphs represent the stained sample Data are... disintegrated slowly as evident by the appearance of single cells, which were not incorporated into the network anymore and tubes that contracted together to form thicker ones, until finally some of them resulted in round cell aggregates Although all mesenchymal cell tested were able to rearrange to form a network on their own, but the network did not last long as cells had formed huge cell aggregates at 12 hours... segregation of the cell types (Fig 1-12) As differences in the quantity of sprouts were rather subtle when compared within one ratio of EC to mesenchymal cells, most observations are of qualitative nature Pericytes contribute to the formation of cord structures in a monolayer co-culture To study the effect of pro -angiogenic drugs a co-culture assay of fibroblasts and EC is often engaged (Raghunath et al 2009) . PERIPHERAL BLOOD: A SIMPLE CELL SOURCE FOR THE GENERATION OF ANGIOGENIC PROGENITORS FROM MONOCYTES ANNA MARIA BLOCKI (B.SC. UNIVERSITY OF APPLIED SCIENCES OF GELSENKIRCHEN). sprouting assay! !34! 2D cord formation assay! !35! Statistical analysis! !35! Chapter 2 : Blood- derived angiogenic cells (BDAC) represent a pericytic population and enhance early stages of angiogenesis.!. the last year helped with the conduction of some of the experiments. Together we established the marker profile and she performed the majority tube formation assays on matrigel. The raw data