ĐẠI HỌC THÁI NGUYÊN TRƯỜNG ĐẠI HỌC NÔNG LÂM LÊ THỊ QUỲNH HOA Tên đề tài: “THIẾT KẾ VECTOR BIỂU HIỆN CÁC GEN MÃ HÓA ENZYME SINH TỔNG HỢP VANILLIN TRONG ESCHERICHIA COLI” KHÓA LUẬN TỐT NGHIỆP ĐẠI HỌC Hệ đào tạo : Chính quy Chun ngành : Cơng nghệ Sinh học Khoa : CNSH & CNTP Lớp : 42 - CNSH Khoá học : 2010 – 2014 Giảng viên hướng dẫn : TS Dương Văn Cường Khoa CNTP – CNSH - Trường ĐH Nông Lâm Thái Nguyên Thái Nguyên, 2014 LỜI CẢM ƠN Trong trình học tập nghiên cứu để hồn thành khóa luận tốt nghiệp với nỗ lực cá nhân, nhận hướng dẫn, giúp đỡ, bảo động viên thầy cô, bạn bè gia đình Nhân dịp hồn thành luận văn: Tơi xin tỏ lòng biết ơn sâu sắc tới thầy giáo TS Dương Văn Cường, kĩ sư Ma Thị Trang, người trực tiếp hướng dẫn giúp đỡ suốt thời gian thực đề tài trình hồn chỉnh luận văn tốt nghiệp Tơi xin chân thành cảm ơn thầy cô Khoa CNSH – CNTP dạy dỗ giúp đỡ thời gian qua Tôi xin chân thành cảm ơn tới cán bộ, anh chị làm việc Viện Khoa học Sự sống – ĐH Thái Nguyên giúp đỡ tạo điều kiện để học tập nghiên cứu Cuối tơi xin gửi lời cảm ơn tới gia đình, người thân, bạn bè động viên, chia sẻ giúp đỡ tơi vượt qua khó khăn q trình học tập, nghiên cứu hồn thành khóa luận Xin chân trọng cảm ơn! Thái Nguyên, ngày tháng Sinh viên Lê Thị Quỳnh Hoa năm 2014 MỤC LỤC PHẦN 1: MỞ ĐẦU 1.1 Đặt vấn đề 1.2 Mục tiêu đề tài 1.3 Yêu cầu đề tài .2 1.4 Ý nghĩa khoa học thực tiễn đề tài 1.4.1 Ý nghĩa khoa học 1.4.2 Ý nghĩa thực tiễn .2 PHẦN 2: TỔNG QUAN TÀI LIỆU .3 2.1 Giới thiệu vanillin 2.1.1 Nguồn gốc 2.1.2 Cấu trúc, đặc điểm lí hóa 2.1.3 Đặc tính sinh học .4 2.1.4 Vai trò vanillin công nghiệp đời sống 2.2 Các đường sinh tổng hợp vanillin 2.2.1 Con đường sinh tổng hợp vanillin thực vật .9 2.2.2 Con đường sinh tổng hợp vanillin từ acid ferulic vi sinh vật 2.3 Các phương pháp sản xuất vanillin 14 2.3.1 Phương pháp tách chiết vanillin từ thực vật 14 2.3.2 Sản xuất vanillin tổng hợp hoá học 15 2.3.3 Sản xuất vanillin ứng dụng công nghệ sinh học 17 Tiềm ứng dụng công nghệ DNA tái tổ hợp sản xuất vanillin 20 2.4.1 Các gen mã hóa enzyme sinh tổng hợp vanillin từ acid ferulic 20 2.4.2 Vi khuẩn E coli khả sử dụng làm vật chủ sản xuất vanillin .22 2.5 Tình hình nghiên cứu sản xuất vanillin ứng dụng công nghệ DNA tái tổ hợp nước nước 24 2.5.1 Tình hình nghiên cứu giới 24 2.5.2 Các nghiên cứu nước .28 PHẦN 3: VẬT LIỆU, NỘI DUNG, PHƯƠNG PHÁP NGHIÊN CỨU .29 3.1 Vật liệu nghiên cứu 29 3.1.1 Đối tượng nghiên cứu 29 3.1.2 Vật liệu 29 3.1.3 Hoá chất 34 3.1.4 Dụng cụ 35 3.1.5 Thiết bị 36 3.2 Địa điểm thời gian nghiên cứu .36 3.3 Nội dung .37 3.4 Phương pháp nghiên cứu 38 3.4.1 Quy trình thực 38 3.4.2 PCR 40 3.4.3 Điện di gel agarose 41 3.4.4 Tách chiết DNA plasmid 42 3.4.5 Lập đồ giới hạn (Restriction mapping) 43 3.4.6 Thu nhận DNA từ gel 44 3.4.7 Phản ứng nối DNA 45 3.4.8 Chuẩn bị tế bào khả biến 45 3.4.9 Biến nạp DNA vào tế bào khả biến .46 3.4.10 Phương pháp xác định trình tự nucleotide 46 3.4.11 Phương pháp so sánh trình tự gen tách dịng với trình tự công bố ngân hàng gen NCBI 47 PHẦN 4: KẾT QUẢ VÀ THẢO LUẬN 48 4.1 Tách dòng giải trình tự gen ech, fcs từ P fluorescens VTCC-B-668 .48 4.1.1 Kết tách dòng giải trình tự gen ech 48 4.1.2 Kết tách dòng gen fcs giải trình tự .52 4.2 Thiết kế vector biểu chứa gen gltA, ech, fcs dựa tảng vector pET22b(+) 55 4.2.1 Kết gắn gen gltA vào pET22b+ tạo tổ hợp pET22-G .55 4.2.2 Kết gắn gen ech vào vector pET22-G tạo tổ hợp pET22-GE 57 4.2.3 Kết gắn gen fcs vào vector pET22-GE tạo tổ hợp pET22-GEF .60 PHẦN 5: KẾT LUẬN VÀ KIẾN NGHỊ 61 5.1 Kết luận 61 5.2 Kiến nghị 61 TÀI LIỆU THAM KHẢO 62 I Tiếng Việt 62 II Tiếng Anh .62 DANH MỤC CÁC BẢNG Bảng 2.1: Các đặc tính hóa lí vanilin (Ravendra, Sharma et al 2012) Bảng 2.2: Mức độ sử dụng vanillin hạng mục thực phẩm Bảng 2.3: Hàm lượng vanillin có mặt hàng thực phẩm mỹ phẩm Bảng 2.4: Các chủng vi sinh vật với khả sản xuất vanillin chất 19 Bảng 3.1: Các thành phần vector pTZ57R/T 30 Bảng 3.2: Các thành phần vector pET22b (+) 32 Bảng 3.3: Trình tự mồi khuếch đại gen ech, fcs 33 Bảng 3.4: Danh mục thiết bị 36 Bảng 3.5: Thành phần phản ứng PCR 40 Bảng 3.6: Thành phần phản ứng cắt enzyme 44 Bảng 3.7: Thành phần phản ứng nối 45 DANH MỤC CÁC HÌNH Hình 2.1: Sơ đồ phân bố vanila giới .3 Hình 2.2: Cơng thức cấu tạo .4 Hình 2.3: Vanillin dạng bột Hình 2.4 : Con đường Non-β-oxidative deacetylation (CoA-dependent) 10 Hình 2.5: Con đường β-oxidative deacetylation (CoA-dependent) 11 Hình 2.6: Con đường Non-oxidation decarboxylataion 12 Hình 2.7: Con đường CoA-Independent Deacetylation 13 Hình 2.8: Con đường Side-Chain Reductive 14 Hình 2.9: Thứ tự phản ứng tổng hợp vanillin từ guaiacol 16 Hình 2.10: Sơ đồ đường phân hủy acid ferulic P fluorescens BF13 21 Hình 2.11: Con đường sinh tổng hợp vanillin chủng E coli tái tổ hợp 22 Hình 2.12 Sơ đồ đường tái sử dụng CoA từ acety-CoA 23 Hình 2.13: Cấu trúc plasmid pBB1 chứa gen từ Pseudomonas fluorescens BF13 25 Hình 3.1: Cấu trúc vector tách dòng pTZ57R/T .29 Hình 3.2: Cấu trúc vector pTZ-gltA .31 Hình 3.3 Cấu trúc vector biểu pET22b(+) .31 Hình 3.4: Sơ đồ quy trình tách dịng gen ech, fcs từ P fluorescens VTCC-B-668 38 Hình 3.5: Sơ đồ quy trình thiết kế vector biểu chứa gen 39 Hình 3.6: Chu trình nhiệt phản ứng PCR khuếch đại gen ech 40 Hình 3.7: Chu trình nhiệt phản ứng PCR khuếch đại gen fcs 41 Hình 4.1: Kết PCR khuếch đại gen ech 48 Hình 4.2: Kết sàng lọc dòng mang vector pTZ-ech 49 Hình 4.3: A-Vector pTZ-ech theo lý thuyết , B- Kết cắt đồng thời enzyme giới hạn SacI EcoRI 50 Hình 4.4: Kết khuếch đại gen fcs dải nhiệt độ gắn mồi 52 Hình 4.5: Kết sàng lọc dòng mang vector pTZ-fcs 53 Hình 4.6: Kết PCR khuếch đại gen fcs .53 Hình 4.7: Kết cắt đồng thời enzyme EcoRI SacI .54 Hình 4.8: Kết điện di dòng plasmid .55 Hình 4.9: Kết cắt đồng thời enzyme HindIII SacI 56 Hình 4.10: Minh hoạ sở kiểm tra chiều gắn gen gltA pET22-G 56 Hình 4.11: Kết cắt pET22-G dòng 1,7 enzyme NcoI 57 Hình 4.12: Kết điện di dòng plasmid tế bào biến nạp sản phẩm gắn nối gen ech pET22-G 58 Hình 4.13: Kết cắt plasmid đồng thời enzyme SacI EcoRI 58 Hình 4.14: Minh hoạ sở kiểm tra chiều gắn gen ech pET22-GE .59 Hình 4.15: Kết cắt dịng đồng thời EcoRI BamHI 60 DANH MỤC CÁC TỪ, CỤM TỪ VIẾT TẮT 4-CL : 4-hydroxycinnamate-CoA ligase ATP : Adenosine triphosphate Bp : Base pair CCl4 : Carbon tetrachloride : Coenzyme Acetoacetyl : Đại học quốc gia Hà Nội CoA ĐHQGHN DNA dNTP : Deoxyribonucleic acid : DNA protein kinase : DNA protein kinase : Deoxyribonucleotide triphosphate E coli EDTA : Escherichia coli : Etilenduamin tetraacetic acid HCLC : 4-hydroxycinnamate CoA- IPTG hydratase/lyase : Isopropy Thyogalactoside DNA-PK DNA-PK Kb LB NCBI PCR : Kilo base : Lauria Broth : Nation Center for Biotechnology Information : Polymerase Chain Reaction SDS : Sodium doecyl sulfat TAE TCA : Tris acetate EDTA : Tricarboxylic acid : Vanillyl alcohol oxidase 5-bromo-4chloro-3indoly-β-Dgalactoside VAO X-gal PHẦN MỞ ĐẦU 1.1 Đặt vấn đề Vanillin (3-methoxy-4-hydroxybenzaldehyde) chất thơm quan trọng sử dụng phổ biến giới công nghiệp thực phẩm, đồ uống, nước hoa, dược phẩm, dinh dưỡng (Ranadive, 1994) Mức độ tiêu thụ hàng năm giới vào khoảng 12000 (Lomascolo, Stentelaire, Asther, & LesageMeessen, 1999) Vanillin cịn thể đặc tính chống khuẩn chống oxy hóa vanillin (Sinha, Sharma, & Sharma, 2008), đồng thời có nghiên cứu chứng minh vanillin có tác dụng chống đột biến ung thư (Sinha et al., 2008) Vanillin sản xuất chủ yếu từ nguồn tách chiết vỏ loài lan Vanilla planifolia tổng hợp nhân tạo từ eugenol, lignin…Trong đó, vanillin tách chiết từ thực vật đáp ứng 1% nhu cầu thị trường, cịn lại tổng hợp hóa học Giá trị kinh tế vanillin tự nhiên từ Vanilla planifolia có giá lên tới 4000 đơla kilogam, trái lại vanillin nhân tạo vào khoảng 15 đôla kilogam (S.-H Yoon et al., 2005) Tuy nhiên, vanilin nhân tạo không đánh giá tương đương vanillin tự nhiên theo quy định Mỹ Châu Âu thiếu hẳn hương vị khiết vanillin tự nhiên trình tổng hợp gây ảnh hưởng xấu tới môi trường (Muheim & Lerch, 1999) Sự khác biệt lớn giá trị vanillin tự nhiên với vanillin tổng hợp kích thích mối quan tâm ngành công nghiệp hương liệu để sản xuất vanillin tự nhiên, bảo vệ môi trường hiệu kinh tế đường sinh tổng hợp thông qua chuyển hóa sinh học nhờ vi sinh vật từ nguồn chất acid ferulic, eugenol, isogenol, lignin,… Trong nguồn chất trên, acid ferulic nghiên nhiều đường chuyển hóa để tạo vanillin ghi nhãn tự nhiên Acid ferulic có nhiều thành tế bào thực vật hai mầm nên thu từ phế phụ phẩm nơng nghiệp Một số vi sinh vật có khả phân hủy acid ferulic để tạo vanillin Amycolatopsis sp strain HR167 (Achterholt, Priefert, & Steinbuchel, 2000), Delftia acidovorans (R Plaggenborg, Steinbuchel, & Priefert, 2001), Pseudomonas putida (R Plaggenborg, Overhage, Steinbüchel, & Priefert, 2003), Streptomyces setonii (Sutherland, Crawford, & Pometto, 1983), Pseudomonas 64 brettanomyces anomalus Enzyme and Microbial Technology, 22(4), 232-239 doi: http://dx.doi.org/10.1016/S0141-0229(97)00169-5 Fitzgerald, D.J., Stratford, M., Gasson, M.J., & Narbad, A (2005) Structurefunction analysis of the vanillin molecule and its antifungal properties J Agric Food Chem, 53(5), 1769-1775 doi: 10.1021/jf048575t Furia, T.E., & Bellanca, N (1975) Fenaroli's handbook of flavor ingredients: C R C Press LLC Gasson, M.J., Kitamura, Y., McLauchlan, W.R., Narbad, A., Parr, A.J., Parsons, E.L., Walton, N.J (1998) Metabolism of ferulic acid to vanillin A bacterial gene of the enoyl-scoa hydratase/isomerase superfamily encodes an enzyme for the hydration and cleavage of a hydroxycinnamic acid scoa thioester J Biol Chem, 273(7), 4163-4170 Gupta, J., Hamp, S., Buswell, J., & Eriksson, K.-E (1981) Metabolism of transferulic acid by the white-rot fungus sporotrichum pulverulentum Archives of Microbiology, 128(4), 349-354 doi: 10.1007/BF00405911 Gustafson, D.L., Franz, H.R., Ueno, A.M., Smith, C.J., Doolittle, D.J., & Waldren, C.A (2000) Vanillin (3-methoxy-4-hydroxybenzaldehyde) inhibits mutation induced by hydrogen peroxide, n-methyl-n-nitrosoguanidine and mitomycin c but not 137cs γ-radiation at the cd59 locus in human–hamster hybrid al cells Mutagenesis, 15(3), 207-213 doi: 10.1093/mutage/15.3.207 Havkin-Frenkel, D., & Belanger, F (2007) Application of metabolic engineering to vanillin biosynthetic pathways in vanilla planifolia In R Verpoorte, A W Alfermann & T S Johnson (Eds.), Applications of plant metabolic engineering (pp 175-196): Springer Netherlands Havkin-Frenkel, D., & Belanger, F (2010) Handbook of vanilla science and technology: Wiley Havkin-Frenkel, D., Podstolski, A., & Knorr, D (1996) Effect of light on vanillin precursors formation by in vitro cultures of vanilla planifolia Plant Cell, Tissue and Organ Culture, 45(2), 133-136 doi: 10.1007/BF00048756 Hopp, R., & Rabenhorst, J (2000) Process for the preparation of vanillin and microorganisms suitable therefor: Google Patents Huang, Z., Dostal, L., & Rosazza, J.P (1993a) Mechanisms of ferulic acid conversions to vanillic acid and guaiacol by rhodotorula rubra J Biol Chem, 268(32), 23954-23958 65 Huang, Z., Dostal, L., & Rosazza, J.P (1993b) Microbial transformations of ferulic acid by saccharomyces cerevisiae and pseudomonas fluorescens Appl Environ Microbiol, 59(7), 2244-2250 Kamat, J., Ghosh, A., & Devasagayam, T.A (2000) Vanillin as an antioxidant in rat liver mitochondria: Inhibition of protein oxidation and lipid peroxidation induced by photosensitization Molecular and Cellular Biochemistry, 209(1-2), 47-53 doi: 10.1023/A:1007048313556 Kamoda, S., Habu, N., Samejima, M., & Yoshimoto, T (1989) Purification and some properties of lignostilbene-?,?-dioxygenase responsible for the c?-c? Cleavage of a diarylpropane type lignin model compound from pseudomonas sp Tmy1009 Agricultural and biological chemistry, 53(10), 2757-2761 Kanski, J., Aksenova, M., Stoyanova, A., & Butterfield, D.A (2002) Ferulic acid antioxidant protection against hydroxyl and peroxyl radical oxidation in synaptosomal and neuronal cell culture systems in vitro: Structure-activity studies The Journal of nutritional biochemistry, 13(5), 273-281 Keen, H., Glynne, A., Pickup, J.C., Viberti, G.C., Bilous, R.W., Jarrett, R.J., & Marsden, R (1980) Human insulin produced by recombinant DNA technology: Safety and hypoglycaemic potency in healthy men Lancet, 2(8191), 398-401 Kirk, R.E., & Othmer, D.F (1983) Kirk-othmer encyclopedia of chemical technology: Sulfonation and sulfation to thorium and thorium compounds: Wiley Knuth, M.E., & Sahai, O.P (1991) Flavor composition and method: Google Patents Kumar, R., Sharma, P.K., & Mishra, P.S (2012) Cheminform abstract: Vanillin derivatives showing various biological activities ChemInform, 43(28), no-no doi: 10.1002/chin.201228263 Lee, E.G., Yoon, S.H., Das, A., Lee, S.H., Li, C., Kim, J.Y., Kim, S.W (2009) Directing vanillin production from ferulic acid by increased acetyl-coa consumption in recombinant escherichia coli Biotechnol Bioeng, 102(1), 200208 doi: 10.1002/bit.22040 Lomascolo, A., Stentelaire, C., Asther, M., & Lesage-Meessen, L (1999) Basidiomycetes as new biotechnological tools to generate natural aromatic flavours for the food industry Trends in biotechnology, 17(7), 282-289 López-Malo, A., Alzamora, S.M., & Argaiz, A (1995) Effect of natural vanillin on germination time and radial growth of moulds in fruit-based agar systems Food 66 Microbiology, 12(0), 213-219 doi: http://dx.doi.org/10.1016/S07400020(95)80100-6 Luziatelli, F., & Ruzzi, M Genetic engineering of escherichia coli to enhance biological production of vanillin from ferulic acid Makni, M., Chtourou, Y., Barkallah, M., & Fetoui, H (2012) Protective effect of vanillin against carbon tetrachloride (ccl4)-induced oxidative brain injury in rats Toxicology and Industrial Health, 28(7), 655-662 doi: 10.1177/0748233711420472 Markus, P.H., Peters, A.L., & Roos, R (1994) Process for the preparation of phenylaldehydes: Google Patents Martínez-Cuesta, M.d.C., Payne, J., Hanniffy, S.B., Gasson, M.J., & Narbad, A (2005) Functional analysis of the vanillin pathway in a vdh-negative mutant strain of pseudomonas fluorescens an103 Enzyme and Microbial Technology, 37(1), 131-138 doi: http://dx.doi.org/10.1016/j.enzmictec.2005.02.004 Mathew, S., & Abraham, T.E (2006) Bioconversions of ferulic acid, an hydroxycinnamic acid Crit Rev Microbiol, 32(3), 115-125 doi: 10.1080/10408410600709628 Muheim, A., & Lerch, K (1999) Towards a high-yield bioconversion of ferulic acid to vanillin Applied Microbiology and Biotechnology, 51(4), 456-461 doi: 10.1007/s002530051416 Muheim, A., MÜLLER, B., Münch, T., & Wetli, M (2012) Process for the production of vanillin: Google Patents Narbad, A., & Gasson, M.J (1998) Metabolism of ferulic acid via vanillin using a novel coa-dependent pathway in a newly-isolated strain of pseudomonas fluorescens Microbiology, 144 ( Pt 5), 1397-1405 Nausch, H., Huckauf, J., Koslowski, R., Meyer, U., Broer, I., & Mikschofsky, H (2013) Recombinant production of human interleukin in escherichia coli PLoS One, 8(1), e54933 doi: 10.1371/journal.pone.0054933 Ner, S.S., Bhayana, V., Bell, A.W., Giles, I.G., Duckworth, H.W., & Bloxham, D.P (1983) Complete sequence of the glta gene encoding citrate synthase in escherichia coli Biochemistry, 22(23), 5243-5249 doi: 10.1021/bi00292a001 Ngarmsak, M., Delaquis, P., Toivonen, P., Ngarmsak, T., Ooraikul, B., & Mazza, G (2006) Antimicrobial activity of vanillin against spoilage microorganisms in stored fresh-cut mangoes J Food Prot, 69(7), 1724-1727 67 Odoux, E., Escoute, J., Verdeil, J.L., & Brillouet, J.M (2003) Localization of betad-glucosidase activity and glucovanillin in vanilla bean (vanilla planifolia andrews) Ann Bot, 92(3), 437-444 doi: 10.1093/aob/mcg150 Ou, S., & Kwok, K.-C (2004) Ferulic acid: Pharmaceutical functions, preparation and applications in foods Journal of the Science of Food and Agriculture, 84(11), 1261-1269 doi: 10.1002/jsfa.1873 Overhage, J., Priefert, H., & Steinbuchel, A (1999) Biochemical and genetic analyses of ferulic acid catabolism in pseudomonas sp Strain hr199 Appl Environ Microbiol, 65(11), 4837-4847 Overhage, J., Steinbuchel, A., & Priefert, H (2003) Highly efficient biotransformation of eugenol to ferulic acid and further conversion to vanillin in recombinant strains of escherichia coli Appl Environ Microbiol, 69(11), 65696576 Plaggenborg, R., Overhage, J., Loos, A., Archer, J.C., Lessard, P., Sinskey, A., Priefert, H (2006) Potential of rhodococcus strains for biotechnological vanillin production from ferulic acid and eugenol Applied Microbiology and Biotechnology, 72(4), 745-755 doi: 10.1007/s00253-005-0302-5 Plaggenborg, R., Overhage, J., Steinbüchel, A., & Priefert, H (2003) Functional analyses of genes involved in the metabolism of ferulic acid in pseudomonas putida kt2440 Applied Microbiology and Biotechnology, 61(5-6), 528-535 doi: 10.1007/s00253-003-1260-4 Plaggenborg, R., Steinbuchel, A., & Priefert, H (2001) The coenzyme adependent, non-beta-oxidation pathway and not direct deacetylation is the major route for ferulic acid degradation in delftia acidovorans FEMS Microbiol Lett, 205(1), 9-16 Rabenhorst, J.D., & Hopp, R.D (1997) Verfahren zur herstellung von vanillin und dafür geeignete mikroorganismen: Google Patents Ramachandra Rao, S., & Ravishankar, G.A (2000) Vanilla flavour: Production by conventional and biotechnological routes Journal of the science of food and agriculture, 80(3), 289-304 Ranadive, A.S (1994) Vanilla cultivation, curing, chemistry, technology and commercial products Developments in food science., 34, 517-577 Ravendra, K., Sharma, P.K., & Prem Shanker, M (2012) Cheminform abstract: Vanillin derivatives showing various biological activities ChemInform, 43(28) doi: 10.1002/chin.201228263 68 Rezaei, M., & Zarkesh-Esfahani, S.H (2012) Optimization of production of recombinant human growth hormone in escherichia coli Rosazza, J.P.N., Huang, Z., Dostal, L., Volm, T., & Rousseau, B (1995) Review: Biocatalytic transformations of ferulic acid: An abundant aromatic natural product Journal of Industrial Microbiology, 15(6), 457-471 doi: 10.1007/BF01570016 Shimoni, E., Ravid, U., & Shoham, Y (2000) Isolation of a bacillus sp Capable of transforming isoeugenol to vanillin J Biotechnol, 78(1), 1-9 Sinha, A.K., Sharma, U.K., & Sharma, N (2008) A comprehensive review on vanilla flavor: Extraction, isolation and quantification of vanillin and others constituents Int J Food Sci Nutr, 59(4), 299-326 doi: 10.1080/09687630701539350 Srinivasan, M.R., & Chandrasekhara, N (1992) Comparative influence of vanillin & capsaicin on liver & blood lipids in the rat Indian J Med Res, 96, 133-135 Sutherland, J.B., Crawford, D.L., & Pometto, A.L., 3rd (1983) Metabolism of cinnamic, p-coumaric, and ferulic acids by streptomyces setonii Can J Microbiol, 29(10), 1253-1257 Tawatsin, A., Wratten, S.D., Scott, R.R., Thavara, U., & Techadamrongsin, Y (2001) Repellency of volatile oils from plants against three mosquito vectors J Vector Ecol, 26(1), 76-82 Torre, P., De Faveri, D., Perego, P., Ruzzi, M., Barghini, P., Gandolfi, R., & Converti, A (2004) Bioconversion of ferulate into vanillin by escherichia coli strain jm109/pbb1 in an immobilized-cell reactor Annals of microbiology, 54(4), 517-527 Vaghasiya, Y.K., Nair, R., Soni, M., Baluja, S., & Shanda, S (2004) Synthesis, structural determination and antibacterial activity of compounds derived from vanillin and 4-aminoantipyrine Journal of the Serbian Chemical Society, 69(12), 991-998 van den Heuvel, R.H., Fraaije, M.W., Laane, C., & van Berkel, W.J (2001) Enzymatic synthesis of vanillin J Agric Food Chem, 49(6), 2954-2958 Venturi, V., Zennaro, F., Degrassi, G., Okeke, B.C., & Bruschi, C.V (1998) Genetics of ferulic acid bioconversion to protocatechuic acid in plant-growthpromoting pseudomonas putida wcs358 Microbiology, 144(4), 965-973 doi: 10.1099/00221287-144-4-965 Walton, N.J., Mayer, M.J., & Narbad, A (2003) Vanillin Phytochemistry, 63(5), 505-515 69 Westcott, R.J., Cheetham, P.S.J., & Barraclough, A.J (1993) Use of organized viable vanilla plant aerial roots for the production of natural vanillin Phytochemistry, 35(1), 135-138 doi: http://dx.doi.org/10.1016/S00319422(00)90521-1 Xu, P., Hua, D., & Ma, C (2007) Microbial transformation of propenylbenzenes for natural flavour production Trends Biotechnol, 25(12), 571-576 doi: 10.1016/j.tibtech.2007.08.011 Yamada, M., Okada, Y., Yoshida, T., & Nagasawa, T (2007) Biotransformation of isoeugenol to vanillin by pseudomonas putida ie27 cells Appl Microbiol Biotechnol, 73(5), 1025-1030 doi: 10.1007/s00253-006-0569-1 Yamada, M., Okada, Y., Yoshida, T., & Nagasawa, T (2008) Vanillin production using escherichia coli cells over-expressing isoeugenol monooxygenase of pseudomonas putida Biotechnol Lett, 30(4), 665-670 doi: 10.1007/s10529-0079602-4 Yoon, S.-H., Li, C., Lee, Y.-M., Lee, S.-H., Kim, S.-H., Choi, M.-S., Kim, S.W (2005) Production of vanillin from ferulic acid using recombinant strains ofescherichia coli Biotechnology and Bioprocess Engineering, 10(4), 378-384 doi: 10.1007/BF02931859 Yoon, S.H., Lee, E.G., Das, A., Lee, S.H., Li, C., Ryu, H.K., Kim, S.W (2007) Enhanced vanillin production from recombinant e Coli using ntg mutagenesis and adsorbent resin Biotechnol Prog, 23(5), 1143-1148 doi: 10.1021/bp070153r Yoon, S.H., Li, C., Kim, J.E., Lee, S.H., Yoon, J.Y., Choi, M.S., Kim, S.W (2005) Production of vanillin by metabolically engineered escherichia coli Biotechnol Lett, 27(22), 1829-1832 doi: 10.1007/s10529-005-3561-4 Zamzuri, N.A., & Abd-Aziz, S (2013) Biovanillin from agro wastes as an alternative food flavour J Sci Food Agric, 93(3), 429-438 doi: 10.1002/jsfa.5962 Zenk, M.H., Ulbrich, B., Busse, J., & Stockigt, J (1980) Procedure for the enzymatic synthesis and isolation of cinnamoyl-coa thiolesters using a bacterial system Anal Biochem, 101(1), 182-187 Zhang, C., Li, X., Lian, L., Chen, Q., Abdulmalik, O., Vassilev, V., Asakura, T (2004) Anti-sickling effect of mx-1520, a prodrug of vanillin: An in vivo study using rodents Br J Haematol, 125(6), 788-795 doi: 10.1111/j.13652141.2004.04892.x 70 Zhang, Y., Xu, P., Han, S., Yan, H., & Ma, C (2006) Metabolism of isoeugenol via isoeugenol-diol by a newly isolated strain of bacillus subtilis hs8 Appl Microbiol Biotechnol, 73(4), 771-779 doi: 10.1007/s00253-006-0544-x 71 PHỤ LỤC 1 Dữ liệu trình tự gen ech tách dòng từ chủng P fluorescens VTCC-B-668 phân lập Việt Nam >140528-03_P21_Ech_1_M13F-pUC.ab1 1159 AGAATTCAGGAGGGCATCGCCATGAGCAACTACGAAGGCCGTTGGAC CACAGTCAAGGTTGAGATCGAAGAAGGCATCGCCTGGGTCATTCTCAATC GTCCGGAAAAACGCAACGCCATGAGCCCGACCCTGAACCGGGAAATGATC GACGTCCTGGGAACCCTCGAGCAGGATCCTGCCGCCGGCGTGCTGGTCCT CACCGGTGCGGGCGAAGCCTGGACGGCGGGCATGGACCTCAAGGAATACT TTCGCGAAGTGGATGCCGGCCCGGAAATCCTCCAGGAGAAAATCCGCCGC GAAGCCTCGCAATGGCAATGGAAACTGCTGCGCATGTACGCCAAGCCGAC CATCGCCATGGTCAATGGCTGGTGCTTCGGCGGTGGCTTCAGCCCGCTGG TGGCGTGCGACCTGGCGATCTGCGCCGACGAAGCGACCTTCGGCCTTTCG GAAATCAACTGGGGCATCCCGCCGGGTAACCTGGTGAGCAAGGCCATGGC CGACACCGTGGGCCATCGTCAATCGCTGTACTACATCATGACCGGCAAGA CCTTTGGCGGGCAGAAAGCCGCCGAAATGGGCCTTGTCAACGAAAGCGTG CCGCTGGCGCAACTGCGCGAAGTGACCATCGAACTGGCGCGTAACCTGCT CGAGAAAACCCCGGTGGTGCTGCGTGCCGCCAAGCATGGCTTCAAGCGCT GCCGCGAACTGACCTGGGAGCAGAACGAGGATTACCTCTACGCCAAGCTC GATCAGTCGCGTCTGCTCGACACCGAAGGCGGTCGCGAGCAGGGCATGAA ACAGTTCCTCGACGACAAGAGCATCAAGCCTGGCCTGCAGGCGTATAAAC GCTGAGAGCTCGC Hình 1: Trình tự gen ech pTZ-ech dịng ( Trình tự mồi F mồi R in đậm ) 72 Hình 2: Ảnh Chromas kết giải trình tự gen ech 73 Hình 3: Kết dịch mã gen ech in silico 74 Query: Trình tự gen ech Pseudomonas fluorescens VTCC-B-668 Sbjct: Trình tự gen ech Pseudomonas fluorescens BF13 cơng bố NCBI Hình 4: Kết so sánh trình tự gen ech từ P fluorescens VTCC-B-668 với gen ech từ P fluorescens BF13 công bố ngân hàng gen 75 Userseq1: Trình tự amino acid gen ech Pseudomonas fluorescens VTCC-B-668 Userseq2: Trình tự amino acid gen ech Pseudomonas fluorescens BF13 cơng bố NCBI Hình 5: Kết so sánh trình tự amino acid gen ech từ P fluorescens VTCC-B-668 với gen ech từ P fluorescens BF13 công bố ngân hàng gen ( http://web.expasy.org/sim/) 76 Thiết kế gắn gen gltA, ech, fcs vào vector pET22b(+) phần mềm vector NTI Hình 6: Sơ đồ thiết kế vector pET22-G 77 Hình 7: Sơ đồ thiết kế vector pET22-GE 78 Hình 8: Sơ đồ thiết kế vector pET22-GEF ... sinh vật biết, sau đưa gen vào vector biểu hiện, biến nạp vào tế bào vật chủ thích hợp cho phép biểu 2.4.1 Các gen mã hóa enzyme sinh tổng hợp vanillin từ acid ferulic Các gen mã hóa enzyme sinh. .. sinh tổng hợp vanillin xác định gen fcs mã hóa enzyme feruloyl-coA synthetase gen ech mã hóa enzyme enoyl-CoA hydratase/aldolase Hai gen tách dịng từ số vi sinh vật như: Pseudomonas fluorescens... gltA, ech, fcs dựa tảng vector pET22b(+) - Gắn gen gltA vào vector biểu pET22b+ tạo tổ hợp vector pET22-G - Gắn gen ech vào vector pET22-G tạo tổ hợp vector pET22-GE - Gắn gen fcs vào vector pET22-GE