BioMed Central Page 1 of 25 (page number not for citation purposes) BMC Plant Biology Open Access Research article Isolation, identification and expression analysis of salt-induced genes in Suaeda maritima, a natural halophyte, using PCR-based suppression subtractive hybridization Binod B Sahu* and Birendra P Shaw Address: Environmental Biotechnology Laboratory, Institute of Life Sciences, Nalco Square, Bhubaneswar, PIN-751023, India Email: Binod B Sahu* - binodbiharisahu@gmail.com; Birendra P Shaw - b_p_shaw@yahoo.com * Corresponding author Abstract Background: Despite wealth of information generated on salt tolerance mechanism, its basics still remain elusive. Thus, there is a need of continued effort to understand the salt tolerance mechanism using suitable biotechnological techniques and test plants (species) to enable development of salt tolerant cultivars of interest. Therefore, the present study was undertaken to generate information on salt stress responsive genes in a natural halophyte, Suaeda maritima, using PCR-based suppression subtractive hybridization (PCR-SSH) technique. Results: Forward and reverse SSH cDNA libraries were constructed after exposing the young plants to 425 mM NaCl for 24 h. From the forward SSH cDNA library, 429 high quality ESTs were obtained. BLASTX search and TIGR assembler programme revealed overexpression of 167 unigenes comprising 89 singletons and 78 contigs with ESTs redundancy of 81.8%. Among the unigenes, 32.5% were found to be of special interest, indicating novel function of these genes with regard to salt tolerance. Literature search for the known unigenes revealed that only 17 of them were salt-inducible. A comparative analysis of the existing SSH cDNA libraries for NaCl stress in plants showed that only a few overexpressing unigenes were common in them. Moreover, the present study also showed increased expression of phosphoethanolamine N-methyltransferase gene, indicating the possible accumulation of a much studied osmoticum, glycinebetaine, in halophyte under salt stress. Functional categorization of the proteins as per the Munich database in general revealed that salt tolerance could be largely determined by the proteins involved in transcription, signal transduction, protein activity regulation and cell differentiation and organogenesis. Conclusion: The study provided a clear indication of possible vital role of glycinebetaine in the salt tolerance process in S. maritima. However, the salt-induced expression of a large number of genes involved in a wide range of cellular functions was indicative of highly complex nature of the process as such. Most of the salt inducible genes, nonetheless, appeared to be species-specific. In light of the observations made, it is reasonable to emphasize that a comparative analysis of ESTs from SSH cDNA libraries generated systematically for a few halophytes with varying salt exposure time may clearly identify the key salt tolerance determinant genes to a minimum number, highly desirable for any genetic manipulation adventure. Published: 5 June 2009 BMC Plant Biology 2009, 9:69 doi:10.1186/1471-2229-9-69 Received: 12 January 2009 Accepted: 5 June 2009 This article is available from: http://www.biomedcentral.com/1471-2229/9/69 © 2009 Sahu and Shaw; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0 ), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. BMC Plant Biology 2009, 9:69 http://www.biomedcentral.com/1471-2229/9/69 Page 2 of 25 (page number not for citation purposes) Background Abiotic stresses are the principal cause of decreasing the average yield of major crops by more than 50% leading to losses worth hundreds of million dollars each year [1]. Among these, high soil salinity, contributed largely by Na + and often compounded with drought, is the main factor that adversely limits the growth and productivity of the major crop plants, including rice. Nevertheless, plants do exist in nature, like the halophytes, which survive and grow under extreme of salinity; severe climate changes throughout millions of years have resulted in the evolu- tion of flora that exhibit substantial genetic diversity for adaptation to environmental perturbations [2]. It is in fact also believed that the genetic diversity in glycophyte, par- ticularly in the crop plants, has been narrowed down over the millennia because of loss of alleles contributing signif- icantly to salt adaptability [2]. Hence, while there is a need to understand the plants' response to salt stress, and the salt tolerance mechanism itself, with the common aim of enhancing salt tolerance in the crop plants, it is necessary that such attempt should include preferably the halo- phytic species. This is required, as variation in salt toler- ance in the crop plants is relatively small, although working with the crop species has direct implication for agriculture. Decades of research on the effect of salinity on growth and development of various plants and their response to salin- ity treatment at the physiological and biochemical levels has generated a wealth of information on the salt toler- ance related parameters or salt tolerance determinants in plants. These may be grouped into 1) morphology adap- tation, reflected as thickening of the leaves and cuticular wax deposition [3], 2) osmotic adjustment, reflected as accumulation of compatible solutes in the cytoplasm [4], 3) maintenance of ion homeostasis, reflected as H + -pump functioning [5], K + /Na + selectivity [6] and Na + exclusion and compartmentation [7-9], 4) cell signalling and gene expression, reflected as abscisic acid (ABA) and jasmonic acid (JA) accumulation [10,11], regulation of salt overly sensitive gene-1, SOS1 [12,13], Ca 2+ -induced increase in K + /Na + selectivity [14], increase in CDPK (Ca 2+ -dependent protein kinase) and MAPK (mitogen-activated protein kinase) activities [15,16] and synthesis of many transcrip- tion factors [15,17-19], 5) oxidative stress mitigation, reflected as activation of the antioxidative machinery [20,21], and 6) molecular trafficking and cell stability, reflected as the accumulation of heat-shock proteins (HSPs), jasmonic acid-induced proteins (JAIPs) and late embryogenesis abundant (LEA) proteins [15,17,22-25]. Although transgenic plants have been developed for many genes upregulated under salt stress, such as P5CS (Δ 1 -pyr- roline-5-carboxylate synthetase), DNA helicase, carbonic anhydrase (CA), glyceraldehydes-3-phosphate dehydro- genase, Na + /H + antiporter [26-30], and the plants show enhanced tolerance to salinity, the field trials of many of them have remained highly unsuccessful [31]. Hence, the basics of salt tolerance still remain illusive, and needs fur- ther investigation. The plant stress adaptive responses include dynamic tran- scriptome changes, presumably playing important role in co-ordination of the many different molecular events responsible for cellular and organismal homeostasis. These changes are generally regulated by complex signal- ling pathways, which are activated in response to various abiotic and biotic stimuli allowing the plants to cope with the changing environmental conditions [32]. There also occurs crosstalk between different signalling pathways [33,34], and identification of the convergent and diver- gent pathways between salinity and other abiotic stress responses and the nodes of signalling convergence may greatly enhance the understanding of the salinity stress response and the salt tolerance mechanism. Although sev- eral studies have been carried out on abiotic stress respon- sive signal pathways [15,35-37], and several reports exist on massive changes in the profile of gene expression in plants [38,39], these are mostly on Arabidopsis or other glycophytes, which are sensitive to salt. Such studies on the native flora of saline environment, i.e. halophytes, are scarce, although better information on the salt tolerance determinants is likely to come from the work on these plants rather than the work on the glycophytes. One of the techniques being largely used to identify stress- responsive genes is subtractive hybridization. Attempts have been made to identify the salt stress regulated genes by suppression subtractive hybridization (SSH) in rice [19] and tomato [18]. However, to the best of our knowl- edge, the technique has so far not been used to identify the genes differentially expressing under salt stress in salt- tolerant plants. Among the salt-tolerant photosynthetic organisms, nevertheless, the salt-stress upregulated ESTs have been cloned in an alga, Dunaliella salina [40]. How- ever, only a few highly upregulated ESTs were sequenced for further studies. Hence, the present work was carried out with the aim of generating cDNA library of salt- induced genes in S. maritima, a natural halophyte, follow- ing PCR based SSH in order to get information on salt stress response in the plant at the transcript level. Moreo- ver, most of the salt-stress upregulated ESTs were identi- fied so as to get a comprehensive picture of the salt-stress response in the plant at the level of gene, which might be useful in elucidating the molecular mechanism underly- ing salt tolerance. Methods Test plant and stress application Seeds of Suaeda maritima L. were collected from the adult plants growing along the mangrove coastal belt in Orissa, BMC Plant Biology 2009, 9:69 http://www.biomedcentral.com/1471-2229/9/69 Page 3 of 25 (page number not for citation purposes) India. The surface-sterilized seeds were soaked in de-ion- ized (Milli-Q) water overnight, transferred over wet filter paper in a petriplate and kept at 25°C for germination. It took approximately six days for the cotyledonary leaves to emerge fully. The germinated seeds were transferred over net, which remained in touch with half-strength Hoag- land's solution contained in 150 ml plastic beakers. The Hoagland's solution contained 5.0 mM KNO 3 , 7.0 mM Ca(NO 3 ) 2 , 2 mM MgSO 4 , 2 mM KH 2 PO 4 , 26 μM Fe-EDTA (Ethylenediaminetetraacetic acid Fe-salt), 45 μM H 3 BO 3 , 0.4 μM CuSO 4 , 0.7 μM ZnSO 4 , 9.1 μM MnCl 2 , 28 mM FeSO 4 and 0.1 μM (NH 4 ) 6 Mo 7 O 24 (pH 5.7, adjusted with 1 M KOH). The seedlings were allowed to grow hydropon- ically in a growth chamber maintained at 24 ± 3°C, 70– 75% relative humidity and 14 h light (200 μmol m -2 s -1 )/ 10 h dark cycle. The level of the medium was maintained by adding Milli-Q water. After 20 days, the seedlings were approximately 2 cm in height. At this stage, the seedlings were transferred to soil in plastic pots of known volume. The seedlings were set to acclimatize and grow for ~3 weeks under natural day/night cycle in a green house maintained at 24 ± 3°C and 70–75% relative humidity. During this period, the seedling attained a height of ~6 cm with lateral branches. The individual pots were watered every day alternately with approximately 150 ml of 1/10 th Hoagland's solution or Milli-Q water except on the penul- timate day of the stress application. For the stress applica- tion, initially 100 ml of 0.5% NaCl, prepared in 1/10 th strength Hoagland's solution, was poured into the indi- vidual pots in the evening. The control pots received only Milli-Q water. After incubation for 1 h, another 150 ml of 1/10 th strength Hoagland's solution containing 5.75 g NaCl was poured into the treatment pots, raising their final NaCl treatment concentration (in 250 ml treatment volume) to 425 mM. It was determined earlier that 100 ml water was completely absorbed by the soil in the pot, while the additional 150 ml was partly absorbed and the rest inundated the soil. After 24 h of the initial NaCl treat- ment, the leaves of the seedlings were harvested, and were preserved in liquid N 2 until further analysis. The leaves from the control plants were also preserved similarly. The treatment duration was determined based on the observa- tion that the activity of the plasma membrane (PM) H + ATPase, involved in the maintenance of ion homeosta- sis, increased to a maximum in 30–36 h of the initial NaCl treatment. Although change in transcription, both quanti- tative and qualitative, in a plant can be noticed in less than half an hour of change in the environmental condi- tion, a long duration exposure (24 h) of the plant to NaCl was preferred thinking that it would provide information about those genes that are really needed for adaptation of plants to saline environment in long run. Moreover, as the time gap between transcription and translation is gener- ally 3 h or more, it was decided to go for RNA extraction after exposure (to NaCl) of the plant for 24 h, 6 h ahead of the exposure time at which the enzyme (PM-H + ATPase) activity reached to the maximum. RNA isolation and cDNA preparation Total RNA was isolated from the leaves of control and 425 mM NaCl exposed plants following LiCl method [41]. mRNA was purified from the total RNA isolated using Pol- yATtract ® mRNA Isolation System I (Promega, USA) fol- lowing the protocol supplied along with the kit. Double stranded cDNA was prepared by reverse transcription of 4 μg of the purified mRNA in 20 μl reaction solution follow- ing the steps outlined in the cDNA preparation kit (Super SMART PCR cDNA synthesis kit, Clontech, Palo alto, USA). The total RNA isolated from the leaves of both the control and NaCl-treated plants were processed simulta- neously for the mRNA purification and cDNA prepara- tion. Construction of SSH cDNA libraries The SSH (Suppression Subtractive Hybridization) cDNA libraries, forward and reverse, were prepared using PCR- select-cDNA SSH kit (Clontech, Palo alto, USA). For this, the double stranded cDNAs prepared from the control and NaCl treated samples were digested separately with RsaI for 1.5 h to produce blunt ends. The digested prod- ucts were extracted with phenol:chloroform:isoamyl alco- hol (25:24:1), followed by extraction of the resulting aqueous phase with chloroform:isoamyl alcohol (24:1) twice. Finally, the digested cDNAs in the upper aqueous phase were ethanol precipitated and resuspended in nuclease free water (Promega, USA). The RsaI digested cDNAs of the control (C) and NaCl-treated (T) samples were divided into 4 equal parts. One part each of the C and T cDNA populations were ligated separately with adapter-1 (supplied in the SSH kit) at the 5' end in the reactions carried out overnight at 16°C, and the ligated products were called CA1 (RsaI digested cDNA popula- tion of control sample with adapter-1) and TA1 (RsaI digested cDNA population of NaCl-treated sample with adapter-1), respectively. Another part each of the C and T cDNA populations were ligated with adaptor-2R (sup- plied in the SSH kit) at the 5' end in a similar fashion, and were called respectively C2R (RsaI digested cDNA popula- tion of control sample with adapter-2R) and T2R (RsaI digested cDNA population of NaCl-treated sample with adapter-2R). The ligation of both the adaptors was checked by PCR amplification of the actin gene using actin gene-specific reverse primer (5'TTGCATCACTCAG- CACCTTC) and adapter-specific forward primer (pro- vided in the SSH kit). The remaining two parts of both C and T, representing the RsaI digested cDNA population with blunt end of the control and NaCl-treated samples, respectively were kept as such. BMC Plant Biology 2009, 9:69 http://www.biomedcentral.com/1471-2229/9/69 Page 4 of 25 (page number not for citation purposes) To create the forward SSH cDNA library, which would rep- resent enriched population of the overexpressed and newly induced transcript messages, TA1 and T2R were considered as 'Tester-A' and “Tester-B', respectively, and the C as the 'Driver'. The opposite was the case for the cre- ation of the reverse SSH cDNA library representing enriched population of the down-regulated transcripts, i.e. CA1 and C2R were considered as 'Tester-A' and 'Tester- B', respectively, and the T as the 'Driver'. Two rounds of hybridization were performed. In the first round, the denatured 'Tester-A' and 'Tester-B' were mixed separately with excess of the denatured 'Driver'. This resulted in sub- traction of the cDNAs representing the less or equally abundant transcripts in the 'Tester' source (the sample considered as 'Tester') compared to that in the 'Driver' source (the sample considered as 'Driver'). Besides, this also resulted in the formation of single stranded cDNAs having adapter-1 (in the case when the 'Tester A' cDNA population was hybridized with the 'Driver') or adapter- 2R (in the case when the 'Tester B' cDNA population was hybridized with the 'Driver'). These represented the tran- scripts not present in the 'Driver' source or present in greater number in the 'Tester' source than that in the 'Driver' source. In the second round of hybridization, the 'Tester-A' and 'Tester-B', hybridized previously with the excess of 'Driver' separately, were mixed together without denaturing, followed by mixing with excess of the dena- tured 'Driver'. This resulted in the formation of hybrid double stranded cDNA (one strand having adaptor-1 and the other strand having adaptor 2R at the 5' end) for those transcripts present only in the 'Tester' source or present in greater number in the 'Tester' source than that in the 'Driver' source. Two rounds of PCR were carried out with two different sets of primers specific to the two adaptors (supplied in the SSH kit) to exponentially amplify the hybrid cDNAs. The primary PCR was performed with one set of primers for 27 cycles (94°C for 3 minute followed by 27 cycles of 94°C for 30 seconds, 50°C for 30 seconds and 72°C for 45 seconds, and finally incubation at 72°C for 10 minutes and storage at 4°C forever). This was referred as the forward or the reverse subtracted SSH cDNA (library), as the case may be. The secondary PCR was performed with the other set of primers for 20 cycles maintaining the same conditions using ten-fold diluted product of the primary PCR. The secondary PCR products of the forward and the reverse SSH cDNA libraries were purified using Qiagen column, cloned into pGEMT Easy- Vector (Promega, USA) and transformed into JM109 E. coli competent cells. The transformed bacteria for both the forward and the reverse SSH cDNA libraries were plated separately on four LB agar plates (15 μl SSH cDNA each plate), incubated at 37°C for 24 h, and the white colonies were picked-up. Approximately 500 colonies from both the forward and the reverse SSH libraries could be picked-up. These colo- nies were grown individually in liquid LB medium at 37°C overnight at 200 rpm in 96 well plates. The medium contained 10% glycerol to facilitate long period storage. Inoculums of the individual culture were then grown in 2 ml of the same medium (supplemented with 100 μg ml -1 ampicillin) at 37°C and 200 rpm overnight. The plasmids were isolated using Qiaprep Spin Mini-Prep kit (Qiagen, GmbH) as per the manufacturer's protocol. Screening and authentication of the SSH libraries Randomly selected 150 plasmid samples of each library were spotted (approximately 50 ng plasmid DNA each spot) separately on 8" × 10" nylon membrane (N + , Amer- sham Hybond) in duplicate. The secondary PCR products (100 ng, prepared afresh) of the forward and the reverse SSH cDNA libraries were labelled separately with α- 32 P- dATP by random primer labelling as per the instruction of the SSH screening kit (PCR-select screening kit, Clontech), and purified by BioRad spin-30 column (Bio-Rad, USA). The plasmid spotted membranes were incubated sepa- rately for half an hour in 30 ml prehybridization buffer (7% SDS and 10 mM Na-EDTA in 0.5 M sodium phos- phate buffer, pH 7.2) at 65°C in 300 mm × 35 mm hybridization bottles. The buffer in each bottle was replaced with 30 ml of fresh prehybridization buffer, maintained at 65°C. The desired denatured probe was added to the individual bottles and hybridization was allowed to continue overnight at 65°C. One of the two membranes spotted with the plasmids from the forward SSH cDNA library was hybridized with the probe pre- pared from the secondary PCR product of the forward SSH cDNA library and the other with the probe prepared from the secondary PCR product of the reverse SSH cDNA library. Similarly, one of the two membranes spotted with the plasmids from the reverse SSH cDNA library was hybridized with the probe prepared from the forward SSH cDNA library and the other with probe prepared from the reverse SSH cDNA library. After the hybridization reac- tion, the membranes were washed with 30 ml of wash buffer-I (1 × SSC, pH 7.0 containing 150 mM NaCl, 15 mM Na 3 Citrate.2H 2 O and 0.1% SDS) for 30 min at 65°C followed by washing with 30 ml of wash buffer-II (0.5 × SSC and 0.1% SDS) at 65°C for 15 min. The membranes were air-dried and exposed to X-ray film at -70°C over- night, and developed. Sequencing and analysis of the cloned ESTs The plasmid inserts of only the forward SSH cDNA library were considered for sequencing. The plasmids purified by Qiagen mini-prep plasmid kit were sent for single pass sequencing at The Centre for Genomic Application (TCGA, New Delhi) with SP 6 as the forward primer. The sequences obtained were fed into VecScreen software (NCBI) to remove the vector sequence contaminations. BMC Plant Biology 2009, 9:69 http://www.biomedcentral.com/1471-2229/9/69 Page 5 of 25 (page number not for citation purposes) The sequences of the adaptors were removed manually. The expressed sequence tags (ESTs) of approximately 100 bp or more in length were only considered for further analysis. The EST sequences were grouped into singletons and contigs using TIGR assembler http://nbc11.biolo gie.uni-kl.de/framed/Left/menu/auto/rightigr_assembler and were termed as unigenes. The unigene sequences were blasted for homology search using BLASTX programme (default) at NCBI database, and categorised into the pro- teins with known function, the proteins with unknown function and the proteins with no match in the database. The unigenes were then grouped into functional catego- ries using MIPS (Munich Information for Protein Sequences) function catalogue http://mips.gsf.de/ projects/function developed based on the information available on the function of a protein in Arabidopsis thal- iana protein database. For this, the unigenes were individ- ually assigned a unique locus name after the BLAST against the A. thaliana protein database. The locus names were fed to the MIPS functional catalogue and the genes were clustered under different functional categories. Expression validation by Northern and real time PCR (qRT-PCR) Slot blot Northern analysis was done for select EST clones of the forward SSH cDNA library to confirm if the ESTs population in the library indeed represented the genes overexpressed due to salt stress. It was also done to vali- date the EST redundancy in a functional category. For this, total RNA was isolated from the leaves of the control and NaCl-treated S. maritima as described above and 10 μg RNA per slot was vacuum blotted on to nylon membrane (N + Hybond, Amersham). The blots were air-dried and UV cross-linked at 150 mJ using a UV cross linker (GS Gene linker, Bio-Rad). These were hybridized with the probe made by random primer α 32 P-dATP labelling of the ESTs of interest. The PCR amplified actin fragment was radiolabelled similarly. This was hybridized with a RNA blot each of a control and a NaCl treated sample for the normalization of the RNA loading in the two cases. The hybridization and washing conditions were as described above [41]. In order to verify further the salt-induced expression or enhanced expression of the unigenes, real-time RT-PCR (qRT-PCR) was conducted for five of them encoding jas- monic acid induced protein, JAIP (FC932662), catalase (FC932734), phosphoethanolamine N-methyltrans- ferase, PEAMT (FC932718), Δ 1 -pyrroline-5-carboxylate synthetase, P5CS(FC932725) and DnaJ (FC932656). The selected unigenes varied greatly in EST redundancy. qRT- PCR was also performed to check the influence of NaCl on the expression of the gene encoding betainealdehyde dehydrogenase (BADH), the ultimate gene in the pathway of glycinebetaine synthesis from choline in plant. The gene encoding actin was amplified simultaneously for each set of qRT-PCR reaction for comparison and normal- ization of the data. RNA was isolated as and when required from the leaves of the control and NaCl treated plants as described above and treated with DNase to remove any DNA contamination. The quality and quan- tity of the RNA in each preparation was checked spectro- photometrically using NanoPhotometer (Implen, GmbH). The qRT-PCR reaction was conducted using QuantiFast SYBR Green RT-PCR kit (Qiagen, USA) and Opticon-2 qRT-PCR machine (MJ Research, Bio-Rad). Each RT-PCR reaction mixture was prepared as per the instructions in the kit taking 100 ng of RNA and 1 μM gene-specific primer in a final volume of 25 μl. The prim- ers for all the genes, except BADH, were designed based on the nucleotide sequence information of their ESTs. For designing the primer for BADH, the nucleotide sequence information of its full-length cDNA clone from Suaeda salsa [DQ641924] was considered. The primers were obtained from Gene Link (NY, USA). The primer sequences for the various genes were: JAIP-For5'CAAT- CAAAGCTCCCTTTTCG, Rev5'AAGCCCGAAAACTCCAC TCT; Cat-For5'GAGTGGTTGATGCCCTGTCT, Rev5' TCT- CATCTCGATCCCCAAAG; PEAMT-For5'TTGCCCTTGAG CGTTCTATT, Rev5'TACCTCCTGGCTTCAACCAT; P5 CS- For5'GATGTTTTTGCTGCCATTGA, Rev5' GC TAATC CC AACCTCAGCAC; DnaJ-For5'GGAATACAGGAGGGG GA CAT, Rev5'CCTTTTGGGAGAACCAAACA; BADH-For5' TGGAAAATTGCTCCAGCTCT, Rev5'CTGGACCTAATCCC GTCAAA; Actin-For5'AAACCACAAGCCCCTAAACC, Rev5 'TTGCATCACTCAGCACCTTC. The PCR reaction condi- tions were also set as per the instruction manual in the kit. After the completion of the reactions, threshold cycle (C T ) value for each reaction was obtained with the help of the software attached with the machine and the difference in the transcript level (in fold) between the control and NaCl treated sample was calculated using Pfaffl method [42] considering the C T value of actin as the internal control. The fold change in the transcript levels of each gene (con- sidered for qRT-PCR) upon NaCl treatment was presented as the mean ± standard deviation (sd) of three independ- ent experimental analysis. Enzyme activity study The effect of NaCl on the activity of two enzymes Δ 1 -pyr- roline-5-carboxylate synthetase (P5CS, EC 1.5.1.12) and catalase (Cat, EC 1.11.1.6) was studied. The leaves of the control and NaCl treated plants were homogenized sepa- rately in chilled enzyme extraction buffer (100 mM Tris- HCl, pH 7.8 containing 10 mM MgCl 2 , 1 mM PMSF, 0.1 mM EDTA, 2% PVPP, 1% protease inhibitor cocktail and 10 mM DTT) in a cold room using pre-chilled mortar and pestles [20,43]. The homogenates were centrifuged twice BMC Plant Biology 2009, 9:69 http://www.biomedcentral.com/1471-2229/9/69 Page 6 of 25 (page number not for citation purposes) at 4°C for 20 min at 20000 × g. The protein in the super- natants was quantified by coomassie brilliant blue-dye binding method [44]. P5CS activity in the enzyme extract was determined as γ- glutamyl kinase by monitoring the formation of γ- glutamyl hydroxamate [45]. The enzyme mixture in a final volume of 0.5 ml contained 50 mM Tris-HCl (pH 7.0), 50 mM L-glutamate, 20 mM MgCl 2 , 100 mM hydroxamate-HCl, 10 mM ATP and 50 μl enzyme extract. After addition of the enzyme extract, the reaction mixture was incubated at 37°C for 15 min. The reaction was stopped by adding 1 ml of the stop buffer (2.5 g FeCl 3 and 6 g trichloroacetic acid in a final volume of 100 ml of 2.5 M HCl). The precipitated proteins were removed by cen- trifugation, and the absorbance of the clear supernatant was read at 535 nm against a blank identical to the above but lacking ATP. The activity was expressed as the unit (U) mg -1 protein; 1 U represented the amount of the enzyme (protein) required to produce 1 μmol of γ-glutamyl hydroxamate (molar extinction co-efficient- 250 M -1 cm -1 ) in one min. The data presented are the means of at least three independent analyses. The activity of catalase in the supernatant was measured following the method of Chance and Maehly [46] with some modification. The reaction mixture for catalase con- tained 25 mM potassium phosphate buffer (pH 6.8), 20 mM H 2 O 2 and the enzyme extract. The reaction was started by adding the enzyme extract. The decomposition of H 2 O 2 was followed at 240 nm, and was quantified using a standard graph prepared for H 2 O 2 concentration. The activity was expressed as U mg -1 protein, where 1 U is the amount of the enzyme (protein) required to decom- pose 1 μmol of H 2 O 2 in 1 min. The data presented are the means of at least three independent analyses. The significance of difference in the enzyme activity between the samples was checked by Duncan's multiple range test for unequal sample size [47]. In-gel catalase activity study The effect of NaCl on the activity of catalase was also stud- ied by in-gel activity staining of the enzyme activity. The enzyme extracts from the leaves of the control and NaCl treated plants were obtained as above. The homogenizing buffer contained 10% glycerol in addition to the other ingredients [48]. The individual supernatant was mixed with 3× loading buffer (190 mM Tris HCl, pH 6.8, 20% glycerol, 65 mM DTT, 0.002% bromophenol blue) in 2:1 ratio and loaded on to a native gel (7. 5% separating and 4% stacking) supported by 10% glycerol [48]. Equal amount of protein (40 μg) was loaded in each lane and the electrophoresis was conducted in a cold room by applying 10 mA current for the stacking gel and 20 mA for the separating gel. The electrophoresis was allowed to continue for 2 h after the dye crossed the separating gel. The gel was removed, soaked in 3.27 mM H 2 O 2 for 25 min, rinsed quickly with distilled water and stained with solution containing 1% (w/v) potassium ferricyanide and 1% (w/v) ferric chloride. The presence of catalase was vis- ualized as negative band. The progress of staining was stopped by removing the staining solution and adding 1% HCl. Results SSH library construction and their differential screening The agarose plating of the competent E. coli cells trans- formed for the ESTs from the forward and the reverse SSH cDNA libraries yielded several transformed colonies. From the four plating done for each SSH cDNA library, 492 recombinant colonies for the forward and 502 colo- nies for the reverse library could be picked-up. The results of the differential screening of the EST clones from both the forward and the reverse SSH cDNA libraries are shown in Fig. 1. Most of the 150 spotted plasmids from the ran- domly picked transformed colonies generated for the for- ward subtracted SSH cDNA showed hybridization signal with the probe made from the secondary PCR product of the forward subtracted SSH cDNA (Fig. 1a). The intensity of the spots varied greatly suggesting the presence of vari- able number of transcript messages of the individual over- expressing genes. Upon hybridization of the duplicate blot with the probe made from the secondary PCR prod- uct of the reverse subtracted SSH cDNA, only a few hybrid- ization signals were observed (Fig. 1b). This suggested that the transcript messages present in the forward SSH cDNA library were different from that present in the reverse SSH cDNA library, and that the library represented mostly the salt-induced transcript messages. A few hybrid- ization signals obtained could be an artefact or the sub- traction of the cDNAs of a few overexpressing genes might not have been total during the preparation of the reverse SSH cDNA library. For the screening of the reverse SSH cDNA library, 96 plas- mid DNA samples, isolated from the randomly picked transformed bacterial colonies obtained for the reverse subtracted SSH cDNA, were blotted and hybridized with the probe made from the secondary PCR product of either the reverse or the forward subtracted SSH cDNA. As expected, most of the 96 spots gave hybridization signal with the probe made from the secondary product of the reverse subtracted SSH cDNA (Fig. 1d), but only a few hybridization signals were observed with the probe made from the secondary PCR product of the forward sub- tracted SSH cDNA (Fig. 1c). This suggested that the removal of the salt-induced or -unaffected messages dur- ing the subtraction step was more or less complete while constructing the reverse SSH cDNA library, and that the library represented mostly the messages that were down regulated due to the salt stress. BMC Plant Biology 2009, 9:69 http://www.biomedcentral.com/1471-2229/9/69 Page 7 of 25 (page number not for citation purposes) Sequencing of the forward subtracted SSH cDNA, contig assembly and annotation The cloned ESTs of only the forward SSH cDNA library were considered for sequencing. This is because these rep- resented the genes overexpressing in response to the NaCl treatment, and hence could be more relevant from the point of view of salt tolerance than the genes down-regu- lated by the NaCl treatment, represented by the reverse SSH cDNA library. Only 429 clones were found to be good for annotation and contig assembly (Table 1). These ESTs could be grouped into 89 singletons and 78 contigs represented by 340 ESTs with an overall EST redundancy Results of differential screening of the clones from forward and reverse SSH cDNA librariesFigure 1 Results of differential screening of the clones from forward and reverse SSH cDNA libraries. Young S. maritima plants were exposed to 425 mM NaCl for 24 h (treated). The plants of the same age not receiving NaCl treatment served as control. Plates a and b: the membranes were blotted with clones from the forward SSH cDNA library. Plates c and d: the membranes were blotted with the clones from the reverse SSH cDNA library. Plates a and c: the blotted membranes were screened by the probe made from the forward subtracted SSH cDNA. Plates b and d: the blotted membranes were screened by the probe made from the reverse subtracted SSH cDNA. BMC Plant Biology 2009, 9:69 http://www.biomedcentral.com/1471-2229/9/69 Page 8 of 25 (page number not for citation purposes) of 81.8% (Table 1). Thus, the forward SSH cDNA library represented 167 unigenes (the combined set of contigs and singletons), which either overexpressed in response to the NaCl treatment or expressed only after the NaCl treatment. More than half of the ESTs from the forward SSH cDNA library could be assigned putative function on the basis of the sequence similarity to the genes or pro- teins of known function in the GenBank (see Additional file 1). The maximum similarity of the ESTs to a given pro- tein in the database in terms of BLASTX E value is also given in the table. More than 30% of the unigenes showed no match in the protein database, and approximately 4% of the sequences represented proteins whose function is not known (see Additional file 1). Most of the unigenes, which represented known proteins showed BLASTX E value < 10 -2 . Only 15 unigenes finding matches in the pro- tein database showed BLASTX homology at E > 10 -2 , and of these nine were either hypothetical/unknown proteins or proteins with putative function. Hence, these may be considered as the unigenes with no match in the database. All the EST sequences are available at NCBI [GenBank: FC932656 –FC932657, FC932659–FC932666, FC932668 –FC932807 and FG228208–FG228224] Among the unigenes identified, that reported to be induced by jasmonic acid showed the highest expression; the EST redundancy of this particular gene was found to be as high as 7.69% (Table 2) out of the total contig EST redundancy of 81.8% (Table 1). In fact, two isoforms of the gene encoding jasmonic acid-induced protein (JAIP) were found to be overexpressing in the test plant upon NaCl treatment, one with EST redundancy of 2.80% and the other with EST redundancy of 7.69%. Down the line, the next gene showing high EST redundancy was that encoding homeodomain leucine zipper transcription fac- tors, ATB-1 (Homeobox leucine zipper) and HDZ3 (Homeodomain leucine zipper), each showing EST redundancy of 3.76%. The transcription factor EREBP (Ethylene responsive element binding protein) and a putative zinc binding protein with RING domain (Zn-fin- ger protein, ZnF) were among the protein products of highly overexpressing (NaCl-induced) genes after ATB-1 and HDZ3 showing EST redundancy of 0.89 and 1.17%, respectively. In addition, there was overexpression of genes of two other transcription factors, C2H2 zinc finger (C2H2-ZnF) family protein and white collar (WC1) pro- tein, and also of a protein, pasticcino-1 (PAS1) involved in regulation of the NAC transcription factors. The EST redundancy of these genes were, however, very low. Besides that of transcription factors, the expression of genes encoding several other proteins with regulatory function was also found to be enhanced in the plant in response to the NaCl treatment (Table 2). One group among them consisted of the genes encoding proteins with various recognized domains, such as CBS, F-box and C2, and motifs such as C3H4 zinc finger and leucine rich repeat, mediating protein-protein interaction in various biochemical events such as polyubiquitination, transcrip- tion elongation, centromeric binding, translational elon- gation, membrane trafficking, etc. The second group was comprised of the genes of G protein (Transducin, GTP binding protein) and AMP-binding (Adenosine mono- phosphate binding) protein, which are involved in signal perception and transduction. The genes of other proteins with some possible regulatory role that overexpressed in response to the NaCl treatment was O-linked GlcNAc (N- acetylglucosamine) transferase (OGT) regulating protein function by O-linked β-N-acetylglucosamine addition on the serine/threonine residue, and DnaJ like protein func- tioning as co-chaperones helping in protein translation, translocation, folding, assembly and deassembly. Besides, the expression of the genes encoding proteins constituting the protein synthesis machinery itself, like preRNA splic- ing factor, sigma like transcription factor, 60S ribosomal P0 protein, appr-1p (ADP-ribose 1"-phosphate) process- ing enzyme family protein, eukaryotic elongation factor 1A and valyl tRNA synthetase involved in transcription, mRNA and tRNA processing and translation was greatly increased in response to the salt treatment. The most sig- nificant enhancement in the expression among them was of the gene encoding 60S acidic ribosomal P0 showing EST redundancy of 0.93%. A clear distinguishing feature of differential gene expres- sion in the test plant in response to the NaCl treatment was the overexpression of the genes encoding proteins performing various physiological functions related to adaptation of plants to saline and/or drought conditions Table 1: ESTs summary of the forward SSH cDNA library of S. maritima. Descriptive category Values No. of high quality ESTs 429 Mean EST length (bp) 392 EST size range (bp) 74–814 No. of singletons 89 No. of contiguous sequences (contigs) 78 No. of unigenes 167 No. of ESTs in contigs 340 Contig EST redundancy (%) a 81.8 Maximum EST redundancy in a contig (%) b 7.7 Forward SSH cDNA library, representing the salt-induced genes, was constructed considering the mRNA isolated from the leaves of the NaCl-treated (24 h) plant as 'Tester' and that from the leaves of the control plant as 'Driver'. The cDNAs of the library were cloned and transformed and 502 ESTs from such clones were sequenced. The results are summarized. a Percentage of the faction of ESTs assembled in the contigs/total no. of ESTs. b Percentage of the fraction of ESTs in a contig/total no. of ESTs BMC Plant Biology 2009, 9:69 http://www.biomedcentral.com/1471-2229/9/69 Page 9 of 25 (page number not for citation purposes) Table 2: Unigene sequences (ESTs) representing proteins with regulatory roles. EST accession number (GenBank) Name of the proteins/ genes EST redun-dancy for a gene (%) a BLASTX search E-value Mean EST length (bp) FC932788 60S acidic ribosomal protein P0 0.93 4.00E-46 657 FG228222 Adenosine monophosphate binding protein-5 (AMP-binding) 0.23 1.00E-64 543 FC932702 Appr-1-p processing enzyme family protein 1.40 8.00E-12 132 FC932664 ATHB-1 (Homeobox-leucine zipper protein) 3.76 4.00E-18 373 FC932731 C2 domain-containing protein 0.23 3.00E-14 601 FC932705 C2H2 type zinc finger family protein 0.23 3.00E-09 326 FC932694 C3H4-type zinc finger (RING finger) protein 0.23 2.00E-12 247 FC932783 CBS domain-containing protein 0.23 2.00E-25 254 FC932656 DnaJ protein, putative b 0.47 4.00E-67 467 FC932677 Ethylene responsive element binding protein (EREBP) 0.93 6.00E-16 160 FG228218 Eukaryotic elongation factor 1A 0.23 3.00E-42 321 FC932688 F-box domain containing protein, putative 0.23 0.056 509 FC932771 GTP-binding protein, putative 0.23 8.00E-44 276 FC932675 Homeodomain leucine zipper protein HDZ3 b 3.76 2.00E-18 373 FC932662 Jasmonate-induced protein homolog 7.69 0.001 386 FC932679 Jasmonate-induced protein homolog 2.80 1.00E-05 520 FC932804 Leucine-rich repeat family protein 0.23 9.00E-28 315 FC932737 O-linked GlcNAc transferase like 0.93 1.00E-04 307 FC932759 Pasticcino 1 0.23 1.00E-62 626 FC932684 Pre-mRNA splicing factor ATP-dependent RNA helicase-like protein b 0.23 2.30 610 FC932706 Putative sigma-like transcription factor 0.23 2.00E-09 271 FC932765 Putative Zn-binding protein with RING finger 1.17 7.00E-22 457 FG228209 Transducin family protein 0.23 1.00E-47 380 FG228219 Valyl-tRNA synthetase, putative 0.23 6.00E-36 539 FC932666 White collar 1 protein (WC1) 0.23 9.70 311 ESTs sequences from the forward SSH cDNA library of S. maritima were grouped into singletons and contigs using TIGR Assembler and were termed as unigenes. The unigene sequences were blasted for homology search using BLASTX programme (default) at NCBI database. The search results for those unigenes representing proteins having regulatory function are summarized. EST redundancy of each unigene is also given along with the average size of the ESTs constituting the unigene. a Percentage of the fraction of ESTs representing a unigene/total no. of ESTs b Genes reported to be induced by salt BMC Plant Biology 2009, 9:69 http://www.biomedcentral.com/1471-2229/9/69 Page 10 of 25 (page number not for citation purposes) (Table 3). At least three of these gene products function in association with the cellular membranes. The NaCl- induced expression of the gene encoding one among them, the choline transporter, was the maximum in the group; two isoforms were found to be expressing with a combined EST redundancy of 2.82%. The second gene encoding the membrane associated protein with high EST redundancy was the cation-efflux transporter; overexpres- sion of two isoforms of the gene was observed in this case as well. A putative Na + /H + antiporter was the third gene that was found to be overexpressed under NaCl stress, although the BLASTX sequence homology for the gene product was very less (E = 7.6). Besides the genes encoding membrane proteins, the genes for the enzymes possibly playing important role in cell wall formation, for example xyloglucan endotransglycosylase (2 isoforms) and expansin-3, also showed overexpression with high EST redundancy. Overexpression of the genes known to be directly or indi- rectly related to a well established physiological adapta- tion process in plants to salt or drought stress, the osmotic adjustment, was prominently reflected in the test plant in response to the NaCl treatment (Table 3). The most over- expressing gene in this category was that encoding phos- phoethanolamine N-methyltransferase (PEAMT) related to the synthesis and accumulation of glycinebetaine, a well known compatible solute for osmotic adjustment in plants under salt and drought stresses. The enzyme cata- lyzes the conversion of phosphoethanolamine (P-EA) to phosphocholine, a precursor of choline and glycine- betaine (Fig. 2). Three isoforms of PEAMT were detected with a combined EST redundancy of 1.63%. Besides, the expression of the gene encoding methionineadenosyl transferase (S-adenosyl-L-methionine synthetase, SAMS), the enzyme responsible for the synthesis of S-adenosyl- methione (SAM) required for the conversion of eth- anolamine (EA) to P-EA by methylation (Fig. 2), also increased greatly showing EST redundancy of 0.93%. Dur- ing the transmethylation reaction, SAM is converted to S- adenosyl-L-homocysteine (SAH), which is inhibitory to all SAM dependent methyltransferases, and hence it should be metabolized and recycled, which is done by SAH hydrolase, SAHH (Fig. 2). The expression of SAHH Table 3: The Unigene sequences (ESTs) representing proteins important for the salt adaptive phsiological processes. EST accession number (GenBank) Name of the proteins/ genes EST redun-dancy for a gene (%) a BLASTX search E-value Mean EST length (bp) FC932725 Δ 1 -pyrroline-5-carboxylate synthetase b 0.23 5.00E-36 227 FC932672 Carbonic anhydrase b 0.70 2.00E-73 606 FC932674 Carbonic anhydrase b 0.70 5.00E-73 574 FC932784 Cation-efflux transporter 0.93 9.00E-66 686 FG228211 Cation-efflux transporter 0.23 5.00E-64 581 FC932758 CCL (CCR-LIKE) protein 0.93 0.24 152 FC932738 Choline transporter- related b 0.93 3.00E-14 295 FC932763 Choline transporter- related b 1.89 1.00E-16 305 FC932670 Expansin 3 0.47 3.00E-23 727 FC932700 Methionine adenosyltransferase 0.93 2.00E-74 407 FC932718 Phosphoethanolamine N- methyltransferase b 0.70 8.00E-124 814 FC932801 Phosphoethanolamine N- methyltransferase b 0.70 1.00E-140 803 FG228215 Phosphoethanolamine N- methyltransferase b 0.23 2.00E-66 804 FC932680 Putative Na(+)/H(+) anti- porter 0.47 7.6 225 FC932696 S-adenosyl-L-homocystein hydrolase 0.23 2.00E-74 486 FC932721 Xyloglucan endotransglycosylase 1 0.70 1.00E-31 441 FC932774 Xyloglucan endotransglycosylase 1 0.70 5.00E-30 439 BLASTX results for those unigenes representing proteins performing various physiological functions related to adaptation of plants to saline condition and possibly vital for the salt adaptive physiological processes. Other details as in Table 2. a Percentage of the fraction of ESTs representing a unigene/total no. of ESTs b Genes reported to be induced by salt [...]... Takabe T: Expression of a betaine aldehyde dehydrogenase gene in rice, a glycinebetaine nonaccumulator, and possible localization of its protein in peroxisomes Plant J 1997, 11:1115-1120 Hibino T, Meng YL, Kawamitsu Y, Uehara N, Matsuda N, Tanaka Y, Ishikawa H, Baba S, Takabe T, Wada K, Ishii T: Molecular cloning and functional characterization of two kinds of betaine-aldehyde dehydrogenase in betaine-accumulating... copies of C2 domains have been identified in a growing number of eukaryotic signalling proteins that interact with cellular membranes and mediate a broad array of critical processes, including membrane trafficking, activation of GTPase for vesicular trafficking, control of protein phosphorylation and generation of lipid second messenger involved in signal transduction [81,82] The Ca2+-dependent tolerance... physiological or biochemical role of the enzyme in salt tolerance is yet to be established, especially in the non-aquatic angiosperm where the availability of CO2 is not influenced by salinity The tolerance of Dunaliella salina, a unicellular alga, to nearly saturating NaCl concentration, nonetheless, has been suggested to be in part due to increased accumulation of a halophilic plasma membrane CA isoform... showed a greater overexpression of DnaJ in the NaCl treated plant when compared to the result of the slot-blot hybridization A slight overexpression of BADH was detected in the test plant upon NaCl treatment, although cloning and sequencing of the cDNAs from the forward subtracted SSH cDNA library did not show any presence of EST of the gene Activity assay of catalase and P5CS The activity of catalase and. .. plants not accumulating glycinebetaine naturally, like Arabidopsis thaliana, Brassica napus and Nicotiana tobacum [98] Moreover, modelling of the labelling kinetics of choline metabolites upon supply of 14C-choline demonstrated that choline import into chloroplast indeed limited its flux to glycinebetaine [99] Hence, it was postulated that a high-activity choline transporter in the chloroplast envelope... living cells as a methyl group donor and as a precursor in ethylene biosynthesis catalyzed by ACC synthase and ACC oxidase (Fig 2) [53,100] Hence, maintaining a considerable pool of SAM by enhancing the rate of its synthesis must be essential when the physiological condition so demand, as in the case of glycinebetaine accumulation under salt stress In fact, it has been observed that in halophyte Atriplex... from the overexpression of the genes encoding Bcl2 binding BAG and DnaJ proteins (Table 2), which physically interact with HSP70 [88,89] DnaJ like proteins are involved in a variety of processes including protein folding, protein partitioning into organelles, signal transduction and targeted protein degradation Moreover, the DnaJ domain of the protein has especially been shown to interact directly... convincing that the genes/ proteins involved in the flow of information and developmental processes could be of much importance in salt stress response and adaptation of plants to saline environment The number of genes possibly involved in salt tolerance can be narrowed down further if the SSH cDNA library data on salt inducible genes are available for a sufficiently large number of closely related halophytic... Weber AP: Transcription profiling of Arabidopsis heat-shock proteins and transcription factors reveals extensive overlap between heat and non-heat stress response pathways BMC Genomics 2007, 8:125 Chourey K, Ramani S, Apte SK: Accumulation of LEA proteins in salt (NaCl) stressed young seedlings of rice (Oryza sativa L.) cultivar Bura Rata and their degradation during recovery from salinity stress J Plant... Stockinger EJ, Gilmour SJ, Thomashow MF: Arabidopsis thaliana CBF1 encodes an AP2 domain-containing transcriptional activator that binds to the C-repeat/DRE, a cis-acting DNA regulatory element that stimulates transcription in response to low temperature and water deficit Proc Natl Acad Sci USA 1997, 94:1035-1040 Ariel FD, Manavella PA, Dezar CA, Chan RL: The true story of the HD-Zip family Trends Plant . Rev5'TACCTCCTGGCTTCAACCAT; P5 CS- For5'GATGTTTTTGCTGCCATTGA, Rev5' GC TAATC CC AACCTCAGCAC; DnaJ-For5'GGAATACAGGAGGGG GA CAT, Rev5'CCTTTTGGGAGAACCAAACA; BADH-For5' TGGAAAATTGCTCCAGCTCT,. Rev5'CTGGACCTAATCCC GTCAAA; Actin-For5'AAACCACAAGCCCCTAAACC, Rev5 'TTGCATCACTCAGCACCTTC. The PCR reaction condi- tions were also set as per the instruction manual in the kit. After. Central Page 1 of 25 (page number not for citation purposes) BMC Plant Biology Open Access Research article Isolation, identification and expression analysis of salt-induced genes in Suaeda maritima,