10 304 0
  • Loading ...

Tài liệu liên quan

Thông tin tài liệu

Ngày đăng: 28/07/2014, 04:20

51 4.3 K ết quả kiểm tra sản phẩm RT-PCR bằng phương pháp giải trình tự Các sản phẩm RT-PCR khi điện di trên gel agarose 1,5% đã thu được vạch DNA với kích thước 589 bp như mong đợi. Tuy nhiên, chưa thể đưa ra kết luận rằng đây chính là đoạn DNA đã nhân bản từ đoạn gene HSP 70 của PMWaV-1. Do đó, phương pháp giải trình tự được áp dụng để kiểm chứng lại các sản phẩm này. Có 2 mẫu sản phẩm RT-PCR dương tính trên điện di, một từ cây bệnh và một từ chồi giống thương phẩm bình thường (không có triệu chứng bệnh) đã được chọn để đem giải trình tự. Do trong các quá trình giải trình tự trực tiếp trên sản phẩm PCR, máy thường không đọc được một số nucleotide đầu tiên nên trình tự của các sản phẩm PCR giải ra bị mất một đoạn khoảng 20 nucleotide về phía đầu 5’, nơi primer xuôi bắt cặp vào. Vì vậy, kết quả giải trình tự 2 sản phẩm RT-PCR thu được 2 đoạn 566 bp và 568 bp. Bảng 4.4: Trình tự của sản phẩm RT-PCR Mẫu Trình tự (5’ – 3’) D1 (566 bp) NNNNNGATTTATGCTGTGGAAAGATTCAGGTTATCGTGATATAAAAAGGT ATTTCGGACTCAACAAGTTCAACAAAGATGTGTATCTCGATAAATTGAAA CCCACAATCGAGGTAGTGGTTGACGACTGGGGTTGTTCTATAGGACCAGT AGACGGTGCGAGAGGGAAAGCCAAATCAGTTCTCACTTTAGCCTCTGATT TTATAACGGGATTGGTACAACTAGCGATCAAGATGACGAATCAACAAGTA TCTGTGTCTGTTTGTTCAGTACCAGCAGCTTACAATTCTTATCAAAGGGG TTTTATTTTTGAAAGTTGTAAGTTGAGCTCTATAAATGTGCAGGCGGTAG TAAACGAACCGACCGCAGCTGGATTGAGTGCTTTCATAACTACCCCGAAA GCTTCTGTGAATTATTTGTTAGTCTACGATTTCGGAGGAGGCACTTTTGA TAGTTCCTTACTCGTGGTTGGGCCTGCGTACGTGGGAGTACTGGATTCGA TGGGAGATAACTATCTGGGAGGCAGGGACGTAGATAACAGATTGCTTAGT TTTTGGTGCGANNNNN 52 D2 (568 bp) NNNNNCGCATTCTGCTGNTTGGAAGACTTGAGGTTATCGTGATATAAAAA GGTATTTCGGACTCAACAAGTTCAACAAAGATGTGTATCTCGATAAATTG AAACCCACAATCGAGGTAGTGGTTGACGACTGGGGTTGTTCTATAGGACC AGTAGACGGTGCGAGAGGGAAAGCCAAATCAGTTCTCACTTTAGCCTCTG ATTTTATAACGGGATTGGTACAACTAGCGATCAAGATGACGAATCAACAA GTATCTGTGTCTGTTTGTTCAGTACCAGCAGCTTACAATTCTTATCAAAG GGGTTTTATTTTTGAAAGTTGTAAGTTGAGCTCTATAAATGTGCAGGCGG TAGTAAACGAACCGACCGCAGCTGGATTGAGTGCTTTCATAACTACCCCG AAAGCTTCTGTGAATTATTTGTTAGTCTACGATTTCGGAGGAGGCACTTT TGATAGTTCCTTACTCGTGGTTGGGCCTGCGTACGTGGGAGTACTGGATT CGATGGGAGATAACTATCTGGGAGGCAGGGACGTAGATAACAGATTGCTG AATTTTGTGTCCGAANNT Chú thích: D1: mẫu từ cây bệnh D2: mẫu từ chồi dứa thương phẩm N: các nucleotide không xác định được Thường ở đầu và cuối đoạn DNA được giải trình tự, các tín hiệu huỳnh quang mà máy thu được thường bị nhiễu nên đoạn này máy thường đọc trình tự không chính xác hoặc không xác định được trình tự tạo ra các N. Thống kê từ 2 trình tự trên cho thấy D1 có 10 N (chiếm 1,77 % tỷ lệ nucleotide), D2 có 7 N (chiếm 1,23 % tỷ lệ nucleotide). Tỷ lệ N thu được ở trên là rất thấp nên kết quả giải trình tự 2 mẫu D1, D2 là hoàn toàn chấp nhận được. Bước tiếp theo, 2 đoạn trình tự vừa giải được đem so sánh với các trình tự chuẩn đã được công bố trên GenBank để có thể khẳng định đó chính là trình tự HSP 70 của PMWaV-1. Ở đây phần mềm Clustal X 1.83 được sử dụng để xác định độ tương đồng của 2 trình tự được giải với trình tự HSP 70 tiêu chuẩn tải về từ NCBI. Như đã nói ở trên, các tín hiệu thu được ở 2 đầu của các trình tự D1, D2 rất xấu, không rõ ràng nên chúng tôi lấy 1 đoạn trình tự đáng tin cậy nhất của 2 mẫu (dài 532 bp) để tiến hành so sánh. 53 Bảng 4.5: Kết quả so sánh trình tự của sản phẩm RT-PCR Mẫu Trình tự D1 AAAAGACTTAGAGGTTTATCGTGATATAAAAAGGTATTTCGGACTCAACAAGTTCAACAA D2 AAAAGACTTAGAGGTTTATCGTGATATAAAAAGGTATTTCGGACTCAACAAGTTCAACAA AF414119 AAAAGACTTAGAGGTTTATCGTGATATAAAAAGGTATTTCGGACTCAACAAGTTCAACAA ************************************************************ D1 AGATGTGTATCTCGATAAATTGAAACCCACAATCGAGGTAGTGGTTGACGACTGGGGTTG D2 AGATGTGTATCTCGATAAATTGAAACCCACAATCGAGGTAGTGGTTGACGACTGGGGTTG AF414119 AGATGTGTATCTCGATAAATTGAAACCCACAATCGAGGTAGTGATTGACGACTGGGGTTG ******************************************* **************** D1 TTCTATAGGACCAGTAGACGGTGCGAGAGGGAAAGCCAAATCAGTTCTCACTTTAGCCTC D2 TTCTATAGGACCAGTAGACGGTGCGAGAGGGAAAGCCAAATCAGTTCTCACTTTAGCCTC AF414119 TCCTATAGGACCAGTAGACGGTGCGCGCGGGAAAGCCAAATCAGTTCTCACTTTAGCCTC * *********************** * ******************************** D1 TGATTTTATAACGGGATTGGTACAACTAGCGATCAAGATGACGAATCAACAAGTATCTGT D2 TGATTTTATAACGGGATTGGTACAACTAGCGATCAAGATGACGAATCAACAAGTATCTGT AF414119 TGATTTTATAACGGGATTGGTACAACTAGCGATCAAGATGACGAATCAACAAGTATCTGT ************************************************************ D1 GTCTGTTTGTTCAGTACCAGCAGCTTACAATTCTTATCAAAGGGGTTTTATTTTTGAAAG D2 GTCTGTTTGTTCAGTACCAGCAGCTTACAATTCTTATCAAAGGGGTTTTATTTTTGAAAG AF414119 GTCTGTTTGTTCAGTACCAGCAGCTTACAATTCTTATCAAAGGGGTTTTATTTTTGAAAG ************************************************************ D1 TTGTAAGTTGAGCTCTATAAATGTGCAGGCGGTAGTAAACGAACCGACCGCAGCTGGATT D2 TTGTAAGTTGAGCTCTATAAATGTGCAGGCGGTAGTAAACGAACCGACCGCAGCTGGATT AF414119 TTGTAAGTTGAGCTCTATAGATGTGCAGGCGGTAGTAAACGAACCGACCGCAGCTGGATT ******************* **************************************** D1 GAGTGCTTTCATAACTACCCCGAAAGCTTCTGTGAATTATTTGTTAGTCTACGATTTCGG D2 GAGTGCTTTCATAACTACCCCGAAAGCTTCTGTGAATTATTTGTTAGTCTACGATTTCGG AF414119 GAGTGCTTTCATAACTACCCCGAAAGCTTCTGTGAATTATTTGTTAGTCTACGATTTCGG ************************************************************ 54 D1 AGGAGGCACTTTTGATAGTTCCTTACTCGTGGTTGGGCCTGCGTACGTGGGAGTACTGGA D2 AGGAGGCACTTTTGATAGTTCCTTACTCGTGGTTGGGCCTGCGTACGTGGGAGTACTGGA AF414119 AGGAGGCACTTTTGATAGTTCCTTACTCGTGGTTGGGGGTGCGTACGTGGGAGTACTGGA ************************************* ********************* D1 TTCGATGGGAGATAACTATCTGGGAGGCAGGGACGTAGATAACAGATTGCTT D2 TTCGATGGGAGATAACTATCTGGGAGGCAGGGACGTAGATAACAGATTGCTT AF414119 TTCGATGGGAGATAACTATCTGGGAGGCAGGGACGTAGATAACAGATTGCTT **************************************************** Chú thích: AF 414119: trình tự HSP 70 tiêu chuẩn từ GenBank *: thể hiện sự tương đồng giữa các trình tự Kết quả so sánh trên cho thấy 2 trình tự D1, D2 hoàn toàn giống nhau (100%) và có sự tương đồng cao (98,68 %) giữa 2 mẫu sản phẩm D1, D2 với trình tự tiêu chuẩn. Vì vậy, có thể kết luận rằng phản ứng RT-PCR được thiết lập đã nhân bản được đúng vùng gene HSP 70 của PMWaV-1. Trình tự D1, D2 cũng tiếp tục được tiến hành so sánh mở rộng với toàn bộ các genome của các loài khác bằng công cụ BLAST ( ). Chương trình này cho phép tìm kiếm trên toàn bộ cơ sở dữ liệu của tất cả các ngân hàng gene trên thế giới như GenBank, EMBL, DDBL… để tìm ra tất cả những đoạn gene tương đồng với 2 trình tự này nếu có. Phân tích này cho biết có loài nào khác cũng chứa đoạn gene tương tự như đoạn gene thu được từ phản ứng RT-PCR hay không. Hay nói các khác, phân tích cho biết đoạn gene khuếch đại được có đặc hiệu cho PMWaV-1 hay không. Kết quả của BLAST được trình bày theo độ tương đồng giảm dần. Ở đây, chúng tôi xin trình bày kết quả với 5 trình tự có độ tương đồng cao nhất đối với đoạn gene đang xét (trên tổng số 15 trình tự thu được – Phụ lục 3). 55 Bảng 4.6: Kết quả phân tích BLAST của 2 trình tự D1, D2 STT Tên trình tự Số Nu tương đồng 1 gi|18253957|gb|AF414119.1|AF414119 Pineapple mealybug wilt associated virus-1, complete cds 510/517 2 gi|8977608|emb|AL137017.9| Human DNA sequence from clone RP11-120J1 on chromosome 9 Contains the 3' end of a novel gene and a CpG island, complete sequence 28/517 3 gi|34495171|gb|AC140307.3| Mus musculus BAC clone RP23- 389D15 from chromosome 19, complete sequence 20/517 4 gi|62659432|ref|XM_579802.1| PREDICTED: Rattus norvegicus LOC498243 (LOC498243), mRNA 20/517 5 gi|15487179|emb|AL589706.13| Human DNA sequence from clone RP11-522P6 on chromosome X, complete sequence 20/517 Kết quả trên cho thấy chỉ có duy nhất một loài mang gene tương đồng với 2 trình tự D1, D2 của chúng tôi (với độ tương đồng 98,64%), đó là PMWaV-1. Vị trí tương đồng nằm trên vùng gene mã hóa HSP 70 của PMWaV-1. Như vậy chúng tôi có thể kết luận rằng trình tự mà chúng tôi nhân bản được chính là trình tự HSP 70 và hoàn toàn đặc hiệu với PMWaV-1. 4.5 Kết quả giám định chồi giống dứa Áp dụng quy trình RT-PCR đã xây dựng được, chúng tôi tiến hành giám định PMWaV-1 trên 90 mẫu chồi giống dứa Cayenne thương phẩm thuộc 3 giống Thái Lan, Trung Quốc, Lâm Đồng, mỗi giống gồm 30 chồi được thực hiện phản ứng RT-PCR và đọc kết quả bằng điện di. Sau đây là kết quả của một số mẫu giám định tiêu biểu. 56 Hình 4.6: Kết quả điện di sản phẩm RT-PCR của 10 mẫu chồi dứa Thái Lan Chú thích: L: Ladder (-): Mẫu đối chứng âm Giếng 2, 3, 4, 5, 8, 9: mẫu dương tính với PMWaV-1. Giếng 1, 6, 7, 10: mẫu âm tính với PMWaV-1. Các kết quả giám định trên 90 mẫu chồi dứa Cayenne ở cả 3 giống được thống kê lại như sau: Bảng 4.7 Tổng kết giám định PMWaV-1 trên chồi dứa Giống Tỷ lệ nhiễm PMWaV-1 Thái Lan 16 / 30 (53,3%) Trung Quốc 14 / 30 (46,7%) Lâm Đồng 14 /30 (46,7%) Tổng số 44 / 90 (48,9%) Kết quả thống kê trên cho thấy có sự hiện diện rất cao của PMWaV-1 trong chồi giống dứa thương phẩm, 48,9 % các mẫu thử nghiệm phát hiện được PMWaV-1. Tỷ lệ nhiễm PMWaV-1 cao và khá đồng đều đối với các giống dứa cũng như trên các địa điểm lấy mẫu cho thấy tình hình nhiễm PMWaV-1 đang diễn ra hết sức nghiêm trọng trên diện rộng ở cả 2 nông trường được khảo sát. L 1 2 3 4 5 6 7 8 9 10 ( - ) 589 bp 500 bp 57 Đối với nước ta, Thái Lan và Trung Quốc là hai nguồn cung cấp giống chủ yếu cho chiến lược phát triển cây dứa Cayenne những năm gần đây. Tỷ lệ nhiễm PMWaV-1 cao trên cả hai nguồn giống này cho thấy một nguy cơ lớn của bệnh héo đỏ đầu lá đang tiềm ẩn trên các vùng dứa vừa được phát triển. Nguy cơ này đang tạo ra một áp lực rất lớn cho người trồng dứa và đòi hỏi cấp bách một nguồn giống Cayenne sạch bệnh để bảo đảm cho sự phát triển bền vững của ngành dứa Việt Nam. 58 Phần4: KẾT LUẬN VÀ ĐỀ NGHỊ 4.1 Kết luận Với những kết quả ghi nhận được sau khi thực hiện đề tài, chúng tôi đi đến những kết luận sau: ¾ Đã ly trích được RNA tổng số từ mẫu dứa. ¾ Quy trình RT-PCR tối ưu cho phát hiện PMWaV-1: 1 chu kỳ 10 chu kỳ 35 chu kỳ 1 chu kỳ 45 o C/45’ 94 o C/2’ 92 o C/30’’ 58 o C/1’ 68 o C/1’30’’ 92 o C/30’’ 54 o C/1’ 68 o C/1’30’’ 68 o C/8’ ¾ Sản phẩm RT-PCR được giải trình tự nằm đúng vùng gene HSP 70 cần nhân bản và hoàn toàn đặc hiệu cho PMWaV-1. Điều này khẳng định độ tin cậy của quy trình RT-PCR vừa được xây dựng. ¾ Tỷ lệ nhiễm PMWaV-1 trên cả 3 giống dứa Cayenne được giám định đều rất cao, giống Thái Lan: 53,3%, giống Trung Quốc: 46,7% và giống Lâm Đồng: 46,7%. Kết quả này cho thấy một nguy cơ lớn của bệnh héo đỏ đầu lá đang đe dọa người trồng dứa và đòi hỏi cấp thiết một phương pháp phòng trừ bệnh hiệu quả. 4.2 Đề nghị Với những kết luận đã được rút ra trên, để tiếp tục phát triển hiệu quả của đề tài, chúng tôi đưa ra một số đề nghị sau: ¾ Tiếp tục mở rộng khảo sát trên nhiều vùng dứa khác để đánh giá chính xác tình hình bệnh héo đỏ đầu lá và nhiễm PMWaV-1 trong nước. ¾ Kết hợp với quy trình phát hiện PMWaV-2 và xử lý nhiệt – nuôi cấy mô cây dứa để có thể xây dựng mô hình cung cấp nguồn giống dứa sạch virus cho nông dân. Nếu xây dựng thành công mô hình này, sẽ mang lại hiệu quả kinh tế - xã hội rất lớn cho người trồng dứa nói riêng và cho ngành dứa Việt Nam nói chung. 59 TÀI LIỆU THAM KHẢO TÀI LIỆU TIẾNG VIỆT 1. Bùi Chí Bửu và Nguyễn Thị Lang, 1999. Di truyền phân tử - Những nguyên tắc cơ bản trong chọn giống cây trồng. Nhà xuất bản Nông Nghiệp, trang 195 – 209. 2. Đường Hồng Dật, 2003. Cây dứa và kỹ thuật trồng. Nhà xuất bản Lao Động - Xã Hội. 68 trang. 3. Hồ Huỳnh Thùy Dương, 1998. Sinh học phân tử. Nhà xuất bản Giáo Dục. 300 trang. 4. Võ Thị Mỹ Hân, 2004. Điều tra tình hình bệnh hại trên cây dứa (Ananas comosus) ở huyện Tân Phước - Tiền Giang. Luận văn tốt nghiệp kỹ sư Nông Nghiệp. Đại học Nông Lâm – Tp. Hồ Chí Minh. 5. Võ Thị Thúy Huệ, 2003. Điều tra tình hình bệnh hại trên cây dứa (Ananas comosus) ở huyện Bến Lức – Long An và huyện Bình Chánh – Tp. Hồ Chí Minh. Luận văn tốt nghiệp kỹ sư trồng trọt. Đại học Nông Lâm – Tp. Hồ Chí Minh. 6. Nguyễn Văn Kế, 2002. Cây ăn quả nhiệt đới (tập 1 và 2). Nhà xuất bản Nông Nghiệp. 7. Phạm Văn Khánh, 2003. Điều tra bệnh trên dứa ở Đức Trọng – Lâm Đồng và nông trường Thọ Vực – Xuân Lộc – Đồng Nai. Luận văn tốt nghiệp kỹ sư trồng trọt. Đại học Nông Lâm – Tp. Hồ Chí Minh. 8. Phan Cự Nhân, 2001. Di truyền học động vật. Nhà xuất bản Khoa Học và Kỹ Thuật Hà Nội, trang 157 – 164. 9. Phan Gia Tân, 1984. Cây dứa và kỹ thuật trồng dứa ở miền Nam. Nhà xuất bản Tp. Hồ Chí Minh. 98 trang 10. Trần Thế Tục và Vũ Mạnh Hải, 2001. Kỹ thuật trồng dứa. Nhà xuất bản Nông Nghiệp. 158 trang. 11. Bùi Trang Việt, 2002. Tài liệu giảng dạy sinh học phân tử (chương trình cao học). Đại học Nông Lâm Tp. Hồ Chí Minh. (Chưa xuất bản). 141 trang. 12. Tài liệu thống kê ngành Nông Nghiệp và Phát Triển Nông Thôn, 1996. Nhà xuất bản Nông Nghiệp. 60 TÀI LIỆU NƯỚC NGOÀI 13. Borroto E.G., Cintra M., González J., Borroto C., and Oramas P., 1998. First Report of a Closterovirus-Like Particle Associated with Pineapple Plants (Ananas comosus cv. Smooth Cayenne) Affected with Pineapple Mealybug Wilt in Cuba. Plant disease 82: p 263. 14. Hu J.S., Sether D., and Ullman D.E.,1996. Detection of pineapple closterovirus in pineapple plants and mealybug using monoclonal antibodies. Plant pathology. 42: 829 – 836. 15. Hu J.S., Sether D.M., Liu X.P., and Wang M., 1997. Use of a Tissue blotting immunoassay to examine the distribution of pineapple closterovirus in Hawaii. Plant disease 81 (10): 1150 – 1154. 16. Hu J.S., Sether D.M., and Ullman D.E., 1998. Transmission of pineapple mealybug wilt – associated virus by two species of mealybug (Dysmicoccus spp.). Phytopathology 88: 1224 – 1230. 17. German T.L., Ullman D.E., and Gunasinghe U.B., 1992. Mealybug wilt of pineapple. Adv. Dis. Vector Res. 9: 241 – 259. 18. Gunasinghe U.B., German T.L., 1989. Purification and partial charaterization of a virus from pineapple. Phytopathology 79:1337-1341. 19. Mc. Pherson M.J. and Moller S.G., 2000. PCR. BIOS scientific publisher. USA. p. 67 – 83. 20. O’Connell J., 2002. Method in molecular biology. Vol 193. RT-PCR protocols. Humana press. USA. p. 20 – 25. 21. Peremyslov V.V., Hajiwara Y., and Dolja V.V., 1999. HSP 70 homolog functions in cell-to-cell movement of a plant virus. PNAS 96: 14771 - 14776. 22. Rorhbach K.G., Beardsley J.W., German T.L., Reimer N.J., ans Sanford W.G, 1988. Mealybug wilt, mealybug, and ants on pineapple. Plant disease 72: 558 – 565. 23. Sether D.M., Karasev A.V., Okumura C., Arakawa C., Zee F., Kislan M.M., Busto J.L., and Hu J.S., 2001. Differentiation, distribution, and elimination of two different pineapple mealybug wilt – associated viruses found in pineapple. Plant disease 85: 856 – 864. . lược phát triển cây dứa Cayenne những năm gần đây. Tỷ lệ nhiễm PMWaV-1 cao trên cả hai nguồn giống này cho thấy một nguy cơ lớn của bệnh héo đỏ đầu lá đang tiềm ẩn trên các vùng dứa vừa được phát. PMWaV-1 trên cả 3 giống dứa Cayenne được giám định đều rất cao, giống Thái Lan: 53,3%, giống Trung Quốc: 46, 7% và giống Lâm Đồng: 46, 7%. Kết quả này cho thấy một nguy cơ lớn của bệnh héo đỏ đầu lá. đề nghị sau: ¾ Tiếp tục mở rộng khảo sát trên nhiều vùng dứa khác để đánh giá chính xác tình hình bệnh héo đỏ đầu lá và nhiễm PMWaV-1 trong nước. ¾ Kết hợp với quy trình phát hiện PMWaV-2
- Xem thêm -