PKA independent and cell type specific activation of the expression of caudal homeobox gene Cdx-2 by cyclic AMP ´ Liang Chen1,2, Peixiang Wang1,2, Cristiano F Andrade1,2, Ian Y Zhao1,2, Philip E Dube3, Patricia L Brubaker3,4, Mingyao Liu1,2,3 and Tianru Jin1,2,4,5 Division of Cell and Molecular Biology, Toronto General Research Institute, University Health Network Institute of Medical Science, University of Toronto, Canada Department of Physiology, University of Toronto, Canada Department of Medicine, University of Toronto, Canada Department of Laboratory Medicine and Pathobiology, University of Toronto, Canada Keywords Cdx-2; cAMP; Epac; ERK1 ⁄ 2; proglucagon Correspondence T Jin, Division of Cell and Molecular Biology, Toronto General Research Institute, University Health Network 67 College St., Toronto, Ontario, M5G 2M1 Fax: +1 416 340 3453 Tel: +1 416 340 4800, ext 4768 E-mail: tianru.jin@utoronto.ca (Received March 2005, accepted 31 March 2005) doi:10.1111/j.1742-4658.2005.04694.x Cdx-2 is a transactivator for the proglucagon gene in pancreatic and intestinal endocrine cells Cdx-2 is also expressed in differentiated intestinal epithelia of nonendocrine origin Cdx-2– ⁄ – mice are embryonic lethal, while Cdx-2+ ⁄ – mutants show multiple malfunctions including the formation of intestinal polyps Within the polyps, the remaining wild type Cdx-2 allele ceases its expression, while the expression of both Cdx-2 and proglucagon in the endocrine cells remains unaltered, indicating that Cdx-2 could be haplo-insufficient for nonendocrine cells, but not for proglucagon producing endocrine cells We propose that mechanisms underlying Cdx-2 expression and auto-regulation [Xu F, Li H & Jin T (1999), J Biol Chem 274, 34310–34316] differ in these two types of cells We show here that forskolin and cAMP upregulate Cdx-2 expression in proglucagon producing cells, but not in colon cancer cells and primary intestinal cell cultures It is unlikely that the activation is mainly mediated by PKA, because the activation was observed in a PKA deficient cell line Cotransfecting a dominant negative Ras expression plasmid substantially repressed the Cdx-2 promoter, in contrast to a previous finding that Ras is a negative factor for Cdx-2 expression in colon cancer cells Furthermore, forskolin activated ERK1 ⁄ phosphorylation in the endocrine cells, and attenuation of ERK1 ⁄ phosphorylation by its inhibitor is associated with attenuated Cdx-2 expression Finally, an Epac pathway specific cAMP analogue stimulated both ERK1 ⁄ phosphorylation and Cdx-2 expression Taken together, our observations suggest that Cdx-2 expression is regulated by the second messenger cAMP, cell-type specifically, via the Epac pathway Homeodomain (HD) proteins, encoded by homeobox genes, are tissue or cell-type specific transcription factors They are involved in embryogenesis; cell growth, differentiation and apoptosis; hormone synthesis; and many other biological and physiological cellular events In the adult, the caudal HD protein Cdx-2 is expressed in differentiated intestinal epithelia, including the proglucagon producing endocrine L cells [1–5] It is also expressed in the pancreatic islets, pancreatic insulin producing endocrine B cell lines, and proglucagon producing endocrine A cell lines [4–7] Using ‘knock out’ approaches, two research laboratories have Abbreviations CRE, cAMP response element; Epac, Exchange protein directly activated by cyclic AMP; FRIC, fetal rat intestinal cell; HD, homeodomain; IBMX, 3-isobutyl-1-methylxanthine; LUC, luciferase; MAPK, mitogen activated protein kinase; PKA, protein Kinase A; PKAc, catalytic subunit of PKA 2746 FEBS Journal 272 (2005) 2746–2759 ª 2005 FEBS L Chen et al independently demonstrated that Cdx-2– ⁄ – mice die during 3.5–5.5 day post coitus (dpc) [8,9] Interestingly, deleting one wild type Cdx-2 allele leads to multiple malfunctions, including the development of polyp-like lesions in the proximal colon [8,9] Consistently, extensive in vitro and ex vivo studies by a number of laboratories have identified more than two-dozen potential downstream target genes of Cdx-2 [3–7, 10–25], including the genes that encode proglucagon and insulin in pancreatic islets and intestinal endocrine cells [4–6] Within the intestinal polyps in the Cdx-2+ ⁄ – mice, the remaining wild type Cdx-2 allele ceases its expression, while its expression in the surrounding normal intestinal epithelia continues [8,9] However, the expression of both Cdx-2 and proglucagon in the endocrine cells of both pancreatic and intestinal origin appears to be unaltered in the Cdx-2+ ⁄ – mice We hypothesized that Cdx-2 expression could be haploinsufficient in selected types of cells [20] To understand molecular mechanisms underlying this intriguing cell-type specific event, we have isolated the mouse Cdx-2 gene promoter, and initiated an examination of transcription factors and signaling molecules that regulate the expression of this promoter We found that cotransfection of the Cdx-2 cDNA led to upregulation of the expression of the Cdx-2 gene promoter in cell lines that express endogenous Cdx-2 [20] The activation, however, was not observed when the naive fibroblast cell lines were utilized [20] We also demonstrated that the POU HD protein Oct-1 is able to bind to the Cdx-2 gene promoter and is implicated in regulating Cdx-2 promoter expression and auto-expression [21] Such an auto-regulatory mechanism would provide an explanation as to why one functional Cdx-2 allele is sufficient for maintaining its own expression and for regulating proglucagon gene expression in the pancreatic A and intestinal L endocrine cells It, however, raises an even more intriguing question: why could one functional Cdx-2 allele be insufficient in maintaining its own expression in the intestinal nonendocrine cells, and in preventing the formation of intestinal polyps for the nonendocrine intestinal epithelia? We propose that molecular mechanisms underlying Cdx-2 expression, including its auto-expression, differ in the endocrine cells from those in the nonendocrine intestinal epithelia In this study, we demonstrate that forskolin ⁄ 3-isobutyl-1-methylxanthine (IBMX) and the second messenger cAMP upregulate Cdx-2 promoter and endogenous Cdx-2 gene expression, specifically in the proglucagon producing endocrine cells It is unlikely that the activation is mainly mediated by the protein kinase A (PKA) signaling FEBS Journal 272 (2005) 2746–2759 ª 2005 FEBS Activation of Cdx-2 expression by cAMP pathway In contrast, forskolin ⁄ IBMX does not activate Cdx-2 promoter and ⁄ or endogenous Cdx-2 gene expression in nonendocrine colon cancer cell lines and in primary fetal rat nonendocrine intestinal cell cultures Our results also suggest that the exchange protein directly activated by cAMP (Epac) signaling pathway is involved in this cell type specific activation event Results Forskolin/IBMX upregulates Cdx-2 gene promoter in proglucagon producing endocrine cell lines We started our investigation by seeking for chemicals or signaling molecules that upregulate Cdx-2 promoter expression in the proglucagon producing cell lines only The )769 Cdx-2 ⁄ LUC fusion gene plasmid [20,21] was transfected into the proglucagon producing GLUTag cell line After the transfection, RA (1 lm), TPA (1 lm), or forskolin ⁄ IBMX (F ⁄ I, 10 lm each) was added to the medium The cells continued to grow for 20 h before harvested for LUC reporter gene analysis As can be seen in Fig 1A, RA and TPA had virtually no effect on Cdx-2 promoter expression (panel i), while forskolin ⁄ IBMX treatment caused approximately 2.5-fold activation (panel ii) Similar results were obtained for two other endocrine cell lines, InR1-G9 and STC-1 (see below, and data not shown) On the other hand, when the same )769 Cdx-2 ⁄ LUC fusion reporter construct was transfected into the three nonendocrine colon cancer cell lines, we did not observe any appreciable activation by forskolin ⁄ IBMX treatment A representative result on the HT-29 cell line is shown in Fig 1A, panel iii Thus, it seems that forskolin ⁄ IBMX has different effects on Cdx-2 promoter expression between endocrine cells and nonendocrine cells We then further examined the effect of forskolin ⁄ IBMX treatment for different time lengths on Cdx-2 promoter expression in the GLUTag cell line It was found that the activation appeared at h and gradually increased during the 20 h experimental period (Fig 1A, panel iv) Panel v shows that forskolin ⁄ IBMX generated no substantial effect on the expression of pBLUC, the promoter-less plasmid utilized in the construction of both Cdx-2 ⁄ LUC and GLU ⁄ LUC [4,20] Forskolin/ IBMX activates endogenous Cdx-2 mRNA expression in endocrine cell lines We then asked the question whether forskolin ⁄ IBMX treatment would stimulate endogenous Cdx-2 mRNA 2747 Activation of Cdx-2 expression by cAMP A ii) GLUTag i) GLUTag Relative LUC Activity L Chen et al iii) HT-29 iv) GLUTag 1.2 ** 0.8 * v) GLUTag ** ** 1 Reporter Treatment V TPA RA -769 Cdx-LUC F/I V V F/I BLUC F/I V B F/I V 20 20 20 20 20 Time (h) 24 24 C InR1-G9 GLUTag C 0.4 C 8 24 C Time (h) 24 C 2 12 12 Cdx-2 Cdx-2 Tub D 3.1 Time (h) Tub 2.9 1.4 2.7 2.6 3.7 4.3 Caco-2 C C 2 4 6 12 12 24 24 Time (h) Cdx-2 Tub 0.9 0.9 1.0 0.9 1.0 Fig Forskolin ⁄ IBMX activates Cdx-2 promoter and Cdx-2 mRNA expression in the GLUTag cell line (A) Forskolin ⁄ IBMX (panels ii, iv), but not TPA or RA (panel i), activated Cdx-2 promoter expression in GLUTag cells The activation was not observed for the colon cancer cell line HT-29 (panel iii), nor for the promoter-less control LUC reporter pBLUC (panel v) Indicated cell lines were transfected with lg )769 Cdx-2 ⁄ LUC fusion gene plasmid ()769 Cdx-LUC), or pBLUC All trans retinoic acid (RA, lM), TPA (1 lM), or forskolin ⁄ IBMX (F ⁄ I, 10 lM each), or ethanol (vehicle, V) was added 20 h before the cells were harvested for LUC reporter gene analysis Relative LUC activity was calculated as the fold increase with the activity in the vehicle treated cells defined as onefold (mean ± SE, n ¼ 3) (B–D) GLUTag (B), InR1-G9 (C), and Caco-2 (D) cell lines were treated with either control medium (with ethanol as the vehicle, V), or medium with 10 lM forskolin plus 10 lM IMBX (F ⁄ I) at indicated h before harvesting Total RNA was extracted for northern blot analysis using cDNA probes for hamster Cdx-2 (Cdx-2) or mouse tubulin (Tub) as the loading control F ⁄ I, forskolin ⁄ IBMX expression After the endocrine cell lines were treated for the indicated period of time, total cell RNA was extracted and analyzed by northern blotting We found that, consistent with the data from our LUC reporter gene assay, Cdx-2 mRNA expression was notably 2748 activated in the GLUTag cell line by 8–24 h treatment with forskolin ⁄ IBMX (Fig 1B) A previous study has shown that the expression of proglucagon mRNA in the InR1-G9 cell line cannot be activated by forskolin ⁄ IBMX [26], indicating that FEBS Journal 272 (2005) 2746–2759 ª 2005 FEBS L Chen et al Activation of Cdx-2 expression by cAMP A B HT-29/Cdx-2 GLUTag/Cdx-2 15 ** Cdx-2/GAPDH Cdx-2/GAPDH 10 Treatment V Time (h) 16 F/I Treatment V C F/I Time (h) 16 D FRIC/CDX-2 * Proglucagon/GAPDH * Treatment V F/I Time (h) 2 this cell line is PKA deficient For this cell line, we therefore included additional time points to examine the effects of forskolin ⁄ IBMX As shown in Fig 1C, h after forskolin ⁄ IBMX treatment, Cdx-2 mRNA expression started to arise Substantial activation was observed h after the treatment, and the elevated Cdx-2 mRNA expression was maintained during the whole 24 h experimental procedure Considering the PKA deficient nature of this cell line, the above observation would suggest that the activation by forskolin ⁄ IBMX on Cdx-2 expression in the proglucagon producing endocrine cell lines is not a PKA dependent event (see further examination below) In an effort to examine Cdx-2 expression profiles in different cell lines, we were unable to detect Cdx-2 mRNA expression by northern blotting in two colon FEBS Journal 272 (2005) 2746–2759 ª 2005 FEBS * Cdx-2/GAPDH Fig Examination of the effect of forskolin ⁄ IBMX on Cdx-2 mRNA expression in HT-29 cell line by real time RT-PCR The nonendocrine colon cancer cell line HT-29 (A), or the endocrine cell line GLUTag (B), or the primary cell culture FRIC (C,D) were treated with either the control medium (with ethanol as the vehicle, V), or the same medium plus 10 lM forskolin and 10 lM IBMX (F ⁄ I) at indicated h before harvesting Total RNA was extracted and real time RT-PCR experiments were conducted against Cdx-2 genes (A–C) or proglucagon gene (D), as described in the Experimental procedures section Results obtained were normalized using GAPDH as the control (Cdx-2 ⁄ GAPDH) N ¼ *P < 0.01; **P < 0.005 FRIC/Proglucagon V F/I 6 V F/I 24 24 Treatment V F/I Time (h) 2 V F/I 6 V F/I 24 24 cancer cell lines, HT-29 and SW480 (data not shown) We, however, could detect Cdx-2 mRNA expression in the human colon cancer Caco-2 cell line As shown in Fig 1D, forskolin ⁄ IBMX treatment generated no substantial effect on Cdx-2 mRNA expression in the Caco-2 cell line We then developed a real time RT-PCR approach to examine the effect of forskolin ⁄ IBMX on Cdx-2 mRNA expression in the HT-29 cell line, while the gut endocrine GLUTag cell line was utilized as the positive control As shown in Fig 2A, in HT-29 cells there is no significant effect on Cdx-2 mRNA expression by forskolin ⁄ IBMX treatment for 2, 4, 6, and 16 h In contrast, Cdx-2 mRNA expression in the GLUTag cell line was significantly activated by an 8- h treatment (Fig 2B), indicating that the real time RT-PCR 2749 Activation of Cdx-2 expression by cAMP approach utilized here could detect elevated Cdx-2 mRNA expression The nonendocrine cell lines utilized in this study are colon cancer cells of human origin To investigate whether the lack of response to forskolin ⁄ IBMX on Cdx-2 expression in these cell lines is associated with their cancerous status, we conducted further examination using the primary fetal rat intestinal cell (FRIC) cultures It has been reported that 99% of FRIC cells represent the nonendocrine intestinal cells, while 1% population represents the proglucagon producing endocrine L cells [27] Proglucagon mRNA expression in the endocrine L cell lines and in the FRIC cultures can be activated by forskolin ⁄ IBMX [28–31] As shown in Fig 2C, Cdx-2 mRNA expression in the FRIC cultures was not apparently affected by forskolin ⁄ IBMX treatment for and h, and the 24-h treatment repressed Cdx-2 mRNA expression On the other hand, proglucagon mRNA expression in the FRIC cultures was significantly stimulated by forskolin ⁄ IBMX treatment for and 24 h (Fig 2D) The above real time RT-PCR results further supported our suggestion that forskolin ⁄ IBMX specifically upregulates Cdx-2 expression in the proglucagon producing endocrine cells Forskolin ⁄ IBMX may repress, or at least not activate, Cdx-2 expression in nonendocrine intestinal cells It should be pointed out that when FRIC cells were examined using the real time RT-PCR approach, large S.D values were generated in each set of assay This is understandable because of the heterogeneity of the FRIC cultures When, however, HT-29 was examined, the S.D values in each set of experiments were also relatively high We have no proper explanation for this observation at this time Forskolin ⁄ IBMX or cAMP stimulates Cdx-2 protein expression in the proglucagon producing endocrine cells We next examined whether forskolin ⁄ IBMX activates Cdx-2 protein expression The GLUTag cell line was examined first As shown in Fig 3A, after a h treatment, forskolin ⁄ IBMX substantially activated Cdx-2 protein expression To our surprise, virtually no activation was observed after or 12 h treatment (Fig 3A) This is in contrast with the activation profile by forskolin ⁄ IBMX treatment at the Cdx-2 mRNA level (Fig 1B,C) We then focused on assessing the activation within h period Figure 3B shows the substantial activation by forskolin ⁄ IBMX treatment on Cdx-2 protein expression in the GLUTag cell line at 1, 2, 3, and h 2750 L Chen et al To investigate whether the activation of Cdx-2 protein expression by forskolin ⁄ IBMX is caused by increasing intracellular levels of cAMP, the cell membrane permeable cAMP analogue, 8-Br-cAMP, was utilized for the InR1-G9 cell line (Fig 3C) After the cells were treated with forskolin ⁄ IBMX or 8-Br-cAMP for or h, Cdx-2 protein expression was elevated substantially, suggesting that the intracellular level of cAMP plays a role in the regulation of Cdx-2 expression To our surprise, the cell membrane permeable cGMP analogue, 8-Br-cGMP, considered as a negative control in our experimental design, also activated Cdx-2 protein expression substantially (Fig 3C) The above observations also indicated that the vehicle utilized in this study (from a to 12 h period) had virtually no effect on Cdx-2 protein expression Our further examinations were then conducted using the vehicle as the control for the longest time point Figure 3D shows the activation of forskolin ⁄ IBMX treatment on Cdx-2 protein expression in the gut endocrine STC-1 cell line at 1, and h, but not at h We then examined the effect of forskolin ⁄ IBMX on Cdx-2 protein expression in the Caco-2 cell line As shown in Fig 3E, no activation was observed In conducting this examination, we included the Epac pathway specific cAMP analogue 8pMeOPT-2¢O-Me-cAMP This analogue also generated no stimulatory effect on both Cdx-2 protein expression and ERK1 ⁄ phosphorylation (see below) The activation may not be mediated by PKA As indicated above, the InR1-G9 cell line may carry a defect in its PKA signaling pathway Forskolin ⁄ IBMX failed to stimulate the expression of proglucagon gene mRNA and its promoter in this cell line, in contrast to significant activation by forskolin ⁄ IBMX in primary pancreatic islet cell cultures or in intestinal endocrine L cell lines [26,29–31] Based on those observations, we further investigated the involvement of PKA in Cdx-2 expression First, we compared the effects of PKAc cotransfection on the expression of the Cdx-2 promoter vs the proglucagon gene promoter PKAc cotransfection generated no significant effect on Cdx-2 promoter expression in InR1-G9 (Fig 4A, left panel) and GLUTag cells (data not shown) PKAc cotransfection, however, significantly activated the expression of the proglucagon gene promoter in InR1-G9 (Fig 4A, right panel) and GLUTag cells (data not shown) Similar to what has been observed for the GLUTag cell line shown in Fig 1A, forskolin ⁄ IBMX treatment activated Cdx-2 gene promoter, approximately 2.5fold, in the InR1-G9 cell line (Fig 4B) Further LUC reporter gene analyses were conducted using different FEBS Journal 272 (2005) 2746–2759 ª 2005 FEBS L Chen et al A Activation of Cdx-2 expression by cAMP B GLUTag 12 Time (h) 12 GLUTag 1 2 3 4 Time (h) Cdx-2 Cdx-2 Actin Actin - - + + - + + - + + F/I - + - - + - - + - - V 92 3.1 2.9 1.1 - - + - + - + F/I + 94 1.2 99 1.2 fold + - + - + - + - V 3.6 2.9 3.7 3.5 InR1-G9 C STC-1 D 2h C 4h Time (h) V Cdx-2 E + - - + - - + - - 1.9 2.9 2.7 + + 89 2.4 - + - + - 2.3 2.7 F/I cGMP cAMP V fold Time (h) Cdx-2 Actin - - - - + 97 fold Actin 3.9 2.7 1.4 0.7 fold Caco-2 V F/I Epac Cdx-2 Actin pERK ERK Fig Comparison of the effect of forkolin ⁄ IBMX on Cdx-2 protein expression in endocrine cell lines vs the nonendocrine HT-29 cell line (A,B) GLUTag cells were grown in the presence of ethanol (vehicle, V) or 10 lM forskolin plus 10 lM IBMX (F ⁄ I) for the indicated h before the cells were harvested for examination of Cdx-2 protein expression by western blotting The same membranes were stripped and followed by hybridization with an anti-(b-actin) Ig (loading control) (C) InR1-G9 cells were grown in the presence of ethanol (vehicle, V) or 10 lM forskolin plus 10 lM IBMX (F ⁄ I), or 0.25 mM 8-Br-cGMP (cGMP), or 0.25 mM 8-Br-cAMP (cGMP), for the indicated h before the cells were harvested for examination of Cdx-2 protein expression by western blotting The same membranes were stripped and hybridized with an anti-(bactin) Ig (D) The response to forskolin ⁄ IBMX treatment on Cdx-2 expression in the STC-1 cell line (E) Caco-2 cells were treated with 10 lM forskolin and IBMX, or 10 lM Epac pathway specific cAMP analogue (8-pMeOPT-2¢O-Me-cAMP) and their effects on Cdx-2 expression and ERK1 ⁄ phosphorylation were examined Antibodies against b-actin and total ERK1 ⁄ were utilized to ensure equal loading sized Cdx-2 ⁄ LUC fusion gene constructs [20] for both InR1-G9 and GLUTag cell lines for the identification of cis-element(s) that mediates forskolin ⁄ IBMX treatFEBS Journal 272 (2005) 2746–2759 ª 2005 FEBS ment, and our results indicate that it is unlikely that a putative CRE element in the Cdx-2 gene promoter is involved (data not shown) 2751 Activation of Cdx-2 expression by cAMP InR1-G9 InR1-G9 NS Rep -769 Cdx-LUC 1.0 PKAc pCDNA3 1.0 InR1-G9 B Relative LUC Activity * Rep -769 Cdx-LUC + F/I Relative LUC Activity NS ** ** Rep -472 GLU-LUC PKAc pCDNA3 1.0 1.0 C Relative PKA Activity (%) Relative LUC Activity PKAc 300 200 InR1-G9 GLUTag A L Chen et al 100 - - + Fig PKAc cDNA cotransfection has different effects on Cdx-2 promoter vs proglucagon gene promoter expression in the PKA deficient InR1-G9 cell line (A) InR1-G9 cells were cotransfected with 3.0 lg )769 Cdx-LUC (left panel) or 3.0 lg )472 GLU-LUC (right panel), plus the indicated amount of PKAc and ⁄ or pCDNA3 (vector for PKAc) Cells were harvested 20 h after the transfection, and relative LUC reporter gene activity was calculated as the fold increase with the activity in the cells received no PKAc transfection, defined as onefold (mean ± SE, n ¼ 3) (B) InR1-G9 cells were transfected with lg )769 Cdx-2 ⁄ LUC fusion gene plasmid ()769 Cdx-LUC) Forskolin ⁄ IBMX (F ⁄ I, 10 lM each), or ethanol (vehicle, V) was added 20 h before the cells were harvested for LUC reporter gene analysis Relative LUC activity was calculated as the fold increase with the activity in the vehicle treated cells defined as onefold (mean ± SE, n ¼ 3) (C) PKA activities in GLUTag and InR1G9 cells, and PKAc transfected InR1-G9 cells were assayed Approximately 3.0 mg total cell lysates were utilized for immunoprecipitation, and one third of the precipitate was used for the PKA assay Relative PKA activity in untransfected and PKAc transfected InR1-G9 cells was calculated as the percentage of that obtained from GLUTag cells (mean ± SE, n ¼ 5) We then investigated whether the InR1-G9 cell line is indeed PKA deficient, and whether PKAc cotransfection would trigger the PKA pathway in this cell line We examined the PKA kinase activity in PKAc 2752 transfected InR1-G9 cells along with untransfected InR1-G9 and GLUTag cells A representative result is shown in Fig 4C Without the PKAc transfection, PKA kinase activity in the InR1-G9 cell line was barely detectable, compared with that detected in the GLUTag cell line Nevertheless, the PKA protein expression for both cell lines was readily detected by Western blotting (data not shown) However, when the InR1-G9 cells were transfected with the PKAc expression plasmid, the PKA kinase activity was significantly elevated These results confirm that the InR1-G9 cell line is defective in PKA activity and cotransfection of PKAc restores its PKA activity Finally we tested the effect of H-89, a known inhibitor of PKA, on the expression of both the proglucagon gene promoter and the Cdx-2 gene promoter in the PKA active GLUTag cell line As shown in Fig 5, the effects of H-89 on these two promoters are apparently different At the concentrations of either 0.1 or lm, H-89 significantly repressed the basal expression of the proglucagon gene promoter, although forskolin ⁄ IBMX stimulated expression cannot be completely blocked (left panel) However, at the same concentrations, H-89 failed to repress the Cdx-2 promoter Thus, H-89 inhibits the proglucagon gene promoter presumably by blocking the PKA signaling pathway That the expression of the Cdx-2 gene promoter was not affected by H-89, is probably due to the fact that pathway(s) other than PKA is ⁄ are responsible for mediating the activation by forskolin ⁄ IBMX and membrane permeable cAMP treatment Dominant negative Ras represses the Cdx-2 gene promoter Numerous recent reports suggested that the second messenger cAMP may use the cAMP-Epac-Ras ⁄ RapMEK-MAPK signaling pathway to regulate gene expression and other cellular functions [32,33] In addition, it has been suggested that in colon cancer cell lines, Cdx-2 expression could be down regulated by oncogenic Ras [34] We therefore investigated the effect of a dominant negative Ras molecule on Cdx2 promoter expression in the proglucagon producing endocrine cell lines Figure shows that the dominant negative Ras significantly inhibited Cdx-2 promoter in the InR1-G9 cell line (right panel) In contrast, significant repression was not observed when either the TK promoter (data not shown) or the proglucagon gene promoter (left panel) was tested These results indicate that Ras could be a positive factor for Cdx-2 expression in proglucagon producing endocrine cells FEBS Journal 272 (2005) 2746–2759 ª 2005 FEBS L Chen et al Activation of Cdx-2 expression by cAMP Fig Comparison of the effect of H-89 on expression of the proglucagon and Cdx-2 gene promoters Three micrograms )476 GLU-LUC (left panel) or )769 Cdx-2-LUC reporter gene plasmid was transfected into the GLUTag cell line Ten micromolar forskolin plus 10 lM IBMX (F ⁄ I) was added to the cells 20 h before harvesting, with or without indicated amount of H-89 (added 45 before the addition of forskolin ⁄ IBMX) Relative LUC reporter gene activity was calculated as the fold increase with the activity in the untreated cells defined as onefold (mean ± SE, n ¼ 3) 1.8 1.4 Relative LUC Activity NS Relative LUC Activity - F /I H-89(µM) - + - - 1 1.0 0.5 ** + + Cdx-2/LUC + + + - - + PeDHA3 + - PeDHA3 Ras-PRSv - + Ras-PRSv Fig The effect of a dominant negative ras cDNA cotransfection on Cdx-2 promoter expression InR1-G9 cells were cotransfected with lg )476 GLU ⁄ LUC (left panel) or )769 Cdx-2 ⁄ LUC, and 1.5 lg pCDNA3 (vector), or 1.5 lg dominant negative ras cDNA Cells were harvested 20 h later for LUC reporter gene analysis Relative LUC reporter gene activity was calculated as the fold increase with the activity in the untreated cells defined as onefold (mean ± SE, n ¼ 3) Forskolin/IBMX stimulates ERK1/2 phosphorylation in proglucagon producing cell lines As a small GTPase, Ras may utilize MAP kinase to carry out its signaling and biological functions We then investigated the effect of forskolin ⁄ IBMX treatment on the phosphorylation status of one of the MAP kinases, ERK1 ⁄ in proglucagon producing cell lines FEBS Journal 272 (2005) 2746–2759 ª 2005 FEBS Glu/LUC + + 1.5 1.2 Glu/LUC Relative LUC Activity Relative LUC Activity 0.1 0.1 - Cdx-2/LUC + - + - + H-89(µM) - - 0.1 0.1 1 F /I Forskolin ⁄ IBMX treatment was found to stimulate ERK1 ⁄ phosphorylation in GLUTag, STC-1, and InR1-G9 cell lines A representative result from the InR1-G9 cell line is shown in Fig 7A The expression level of phosphorylated ERK1 ⁄ was elevated after forskolin ⁄ IBMX treatment, while the effect on total ERK1 ⁄ expression was not appreciable In this particular experiment, forskolin ⁄ IMBX treatment for 120 did not activate ERK1 ⁄ phosphorylaton (lane 5) We, however, observed substantial activation for this time course for three other experiments (data not shown) The activation of ERK1 ⁄ phosphorylation by forskolin ⁄ IBMX treatment was associated with elevated Cdx-2 protein expression, consistent with the result shown in Fig 3B When PD98059, a MEK-1 inhibitor, was included, forskolin ⁄ IBMX mediated ERK1 ⁄ phosphorylation was significantly inhibited, starting from 30 (lanes 9–12) PD98059 also inhibited the basal expression of phosphorylated ERK1 ⁄ (comparing lane with lane 7) Although the basal expression of phosphorylated ERK1 ⁄ was inhibited by PD98059, the basal Cdx-2 expression was not affected (comparing lane with lane 1) However, PD98059 inhibited activated Cdx-2 protein expression by forskolin ⁄ IBMX treatment for h (comparing lane 12 with lane 6), despite the absence of the repression at the other time courses It should be pointed out that if phosphorylated ERK1 ⁄ mediates forskolin ⁄ IBMX stimulated Cdx-2 transcription, further phosphorylation events on transcription factor(s) should be involved Inhibition of ERK1 ⁄ phosphorylation by PD98059, may not affect the factors ⁄ mediators that have already been phosphorylated 2753 Activation of Cdx-2 expression by cAMP A L Chen et al InR1-G9 10 11 12 Cdx-2 Actin phosphorylation to that induced by forskolin ⁄ IBMX treatment As we have already presented in Fig 3E, such stimulatory effects were not observed when the colon cancer cell line Caco-2 was examined pERK1/2 ERK1/2 F/I (min) PD98059 - B - - + + 30 60 120 240 - Several groups have investigated signaling molecules or pathways that may up or down regulate Cdx-2 expression in the nonendocrine intestinal epithelia [34,37–41] Cdx-2 expression was found to be down regulated by the oncogenic Ras [34], and up regulated by butyrate [39] It has also been reported that Cdx-2 expression cannot be detected in the adnomatous polyposis coli (APC) mutated colon cancer cell lines, while introducing wild type APC cDNA into an APC mutated cell line rendered it to re-express Cdx-2 mRNA [37] However, a recent immunohistochemistry study indicated that Cdx-2 expression in the mouse gut was not altered by APC or Ras status, or by butyrate treatment [40] Another study by Kim et al linked Cdx-2 expression with the tumor suppressor PTEN (phosphatase and tension homologue deleted from chromosome 10), and the phosphatidylinositol 3-kinase (PI3K) signaling pathway [38] However, little is known about signaling molecules and pathways that may regulate Cdx-2 expression in the proglucagon producing endocrine cells In this study, we examined the effects of forskolin ⁄ IBMX on Cdx-2 expression, and investigated possible signaling pathways that mediate such expression We found that Cdx-2 expression could be activated by forskolin ⁄ IBMX Using a reporter gene assay and northern blotting, we demonstrated that this activation occurs at the transcriptional ⁄ mRNA level Additionally, Cdx-2 protein expression was also elevated by forskolin ⁄ IBMX as detected by western blotting However, the activation only takes place in the proglucagon producing endocrine cell lines, but not in the nonendocrine colon cancer cell lines Those data collectively suggested that activation of Cdx-2 expression by forskolin ⁄ IBMX occurs in a cell type specific manner The InR1-G9 cell line may be PKA deficient [26] We found that indeed PKA kinase activity in this cell line is significantly low, compared with that in the GLUTag cell line (Fig 4C) The observations that forskolin ⁄ IBMX activates the Cdx-2 promoter with or without a putative CRE element (data not shown), and that Cdx-2 promoter and endogenous Cdx-2 mRNA and protein expression in the InR1-G9 cell line were also activated by forskolin ⁄ IBMX treatment (Figs 1C, 3C and 4B), led to the hypothesis that the activation is not mediated by PKA We found that in three proglucagon producing cell lines, cotransfection 30 60 120 240 - Discussion + + + + - - InR1-G9 V F/I 4 Epac Cdx-2 Actin pERK ERK Fig The effect of forskolin ⁄ IBMX and Epac pathway specific cAMP analogue on the phosphorylation status of ERK1 ⁄ and Cdx2 protein expression A InR1-G9 cells were grown in the presence of ethanol (vehicle for forskolin ⁄ IBMX, V) or 10 lM forskolin plus 10 lM IBMX (F ⁄ I) for the indicated time before the cells were harvested for examination of Cdx-2 and phosphorylated ERK ⁄ ⁄ expression by western blotting For one set of cells, the MEK inhibitor PD98059 (50 lM) was added 45 before the addition of F ⁄ I The same membranes were stripped and followed by hybridization with an anti-(b-actin) Ig (loading control), and the antibody against total ERK1 ⁄ B InR1-G9 cells were grown in the presence of 10 lM 8-pMeOPT-2¢O-Me-cAMP [F ⁄ I as the positive control, and vehicle (V) as the negative control] Cdx-2 expression and ERK1 ⁄ phosphorylation were then examined Antibodies against b-actin and total ERK1 ⁄ were utilized to ensure equal loading by active ERK1 ⁄ Therefore, it is reasonable to accept a 2- to 3-h time delay to attenuate Cdx-2 protein expression in response to the inhibition on ERK1 ⁄ phosphorylation (see the Discussion section for our further interpretation) Epac pathway specific cAMP analogue stimulates Cdx-2 protein expression and ERK 1/2 phosphorylation Finally, we initiated an examination of whether the Epac signaling pathway [35,36] specific cAMP analogue would also stimulate Cdx-2 protein expression in the InR1-G9 cell line As shown in Fig 7B, 10 lm 8-pMeOPT-2¢O-Me-cAMP generated comparable effects on both Cdx-2 protein expression and ERK1 ⁄ 2754 FEBS Journal 272 (2005) 2746–2759 ª 2005 FEBS L Chen et al of a dominant negative Ras expression plasmid significantly repressed Cdx-2 expression, but not the proglucagon gene promoter, indicating that Ras is a positive factor This is in contrast with the previous report that Ras is a negative factor for Cdx-2 expression in colon cancer cell lines [34] In addition, we found that forskolin ⁄ IBMX specifically stimulates ERK1 ⁄ phosphorylation in proglucagon producing cell lines, and MEK inhibition attenuated forskolin ⁄ IBMX activated Cdx-2 protein expression at h (Fig 7) These observations collectively suggest the involvement of cAMP-Epac-Ras ⁄ Rap-MEK-MAPK signaling pathway (see below) We noticed the discrepancy regarding the effects of forskolin ⁄ IBMX on Cdx-2 expression at the mRNA and protein levels First, the activation of Cdx-2 protein expression could be observed as early as 30 Such an early response would suggest that, in addition to stimulating Cdx-2 mRNA expression, forskolin ⁄ IBMX might also play a role in stabilizing Cdx-2 protein Consistently, we found that PD98059 repressed forskolin ⁄ IBMX activated Cdx-2 protein expression only at h, but not within the first h One may speculate that forskolin ⁄ IBMX may stabilize Cdx-2 protein via a yet to be identified mechanism, and this effect cannot be blocked (or immediately blocked) by MEK inhibition Activated ERK1 ⁄ 2, however, may stimulate Cdx-2 transcription via phosphorylating its transcriptional activators, and this event would take longer time, and it could be blocked by MEK inhibition Second, activation by forskolin ⁄ IBMX at the protein level was not observed beyond h However, the activation at the mRNA level was detectable by northern blot analysis during the whole 2–24 h experimental period for the InR1-G9 cell line (Fig 1C) One may postulate the existence of a negative feedback loop at the Cdx-2 protein expression level to explain such a difference To our surprise, both 8-Br-cAMP and 8-Br-cGMP were found to activate Cdx-2 protein expression in InR1-G9 cells A possible explanation would be the involvement of a nucleotide gated ion channel [32,42,43] in these endocrine cell lines We made an attempt to identify the existence of such channel in the InR1-G9 cell line without success However, we did observe that treating InR1-G9 cells with 45 mm potassium chloride (inducing membrane depolarization) led to enhanced Cdx-2 protein expression The discrepancy between the responses of Cdx-2 protein and mRNA expression to forskolin ⁄ IBMX treatment further indicated the complexity of the corresponding regulatory networks One may suggest that this discrepancy and the presence of negative feedback loops may partially explain why opposite results have been obtained by different research FEBS Journal 272 (2005) 2746–2759 ª 2005 FEBS Activation of Cdx-2 expression by cAMP groups in assessing the role of APC, Ras status, and butyrate treatment on Cdx-2 expression [34,37–41] An important observation in this study is that the activation of Cdx-2 promoter by forskolin ⁄ IBMX took place only in the proglucagon producing endocrine cells Such a finding supported our overall hypothesis that signaling molecules and ⁄ or pathways involved in Cdx-2 expression differ in the endocrine cells from that in the nonendocrine intestinal epithelia However, as the nonendocrine cell lines utilized in this study are cancerous cells of human origin, we employed the primary FRIC culture system for conducting real time RT-PCR examinations (Fig 2) A majority of epithelial cells (99%) in FRIC cultures are nonendocrine [28,29] Such cultures therefore would represent primary nonendocrine intestinal cells Lack of the response to forskolin ⁄ IBMX treatment in the FRIC cultures on Cdx-2 mRNA expression supported our overall hypothesis that the second messenger cAMP activates Cdx-2 expression only in the proglucagon producing endocrine cells Although the second messenger cAMP has long been shown to mediate specific intracellular signaling events through PKA [44,45], more recent observations have suggested that PKA does not account for all of the intracellular targets of cAMP, especially in endocrine cells [32,33,42,43] Furthermore, the identification of novel cAMP binding proteins that exhibit guanine nucleotide exchange (GEF) activities (cAMP-GEFs, or Epac) has opened a new research direction for understanding the function of the second messenger cAMP [32,35,36,40] A GEF molecule may serve as a bridge between cAMP and small GTPases, including Ras, Rap1 and Rap2, leading to the activation of Raf and the mitogen activated protein kinase (MAPK) signaling pathway [32] The observation that ras may serve as a positive factor for Cdx-2 expression (Fig 6), and both the Epac pathway specific cAMP analogue and forskolin ⁄ IBMX stimulate ERK1 ⁄ phosphorylation and Cdx-2 expression collectively suggest the involvement of the Epac-Ras ⁄ Rap-ERK pathway in regulating Cdx-2 expression To examine the expression profile of Epac molecules in pancreatic and intestinal proglucagon producing cells, and to identify whether Ras and ⁄ or Rap are indeed involved in regulating Cdx-2 expression would further our understanding on this cell type specific gene expression event Experimental procedures Materials Tissue culture medium, calf serum and oligonucleotides were purchased from Invitrogen Life Technology Inc 2755 Activation of Cdx-2 expression by cAMP (Burlington, Ontario, Canada) Radioisotopes were obtained from Amersham Pharmacia Biotech (Baie d’Urfe, Quebec, Canada) Forskolin, dideoxyforskolin, 3-isobutyl-1-methylxanthine (IBMX), 8-Bromoadenosine 3¢, 5¢-cyclin monophoshate (8-Br-cAMP), 8-Bromoguampsome 3¢, 5¢-cyclin monophoshate (8-Br-cGMP), all trans retinoic acid (ATRA, RA), and 12-O-tetraadecanoylphorbol 13-acetate (TPA) were purchased from Sigma-Aldrich (Oakville, Ontario, Canada) The mitogen activated protein kinase (MAPK) kinase (MEK) inhibitor PD98059 was purchased from Calbiochem (EMD Biosciences, Inc., San Diego, California) The Epac pathway specific cAMP analogue 8-pMeOPT2¢O-Me-cAMP was purchased from BIOLOG life Science Institute (Bremen, Germany) Plasmids The Cdx-2 ⁄ Luciferase (LUC) fusion gene constructs, and the proglucagon ⁄ LUC (GLU ⁄ LUC) fusion gene constructs were generated in previous studies, using the promoterless LUC reporter gene plasmid pBLUC as the cloning vector [4,20,46] The catalytic subunit of PKA expression plasmid (PKAc), in which the expression of the rat PKAc is driven by a CMV promoter, and the dominant negative Ras expression plasmid, in which the V12 mutant of H-Ras is driven by the RSV promoter were provided by X Fang (MD Andersen Cancer Institute, Houston, TX, USA) [47] Cell culture, plasmid DNA transient transfection, and LUC reporter gene analysis The hamster pancreatic islet cell line InR1-G9, the mouse intestinal proglucagon producing endocrine cell lines GLUTag and STC-1, and the human colon cancer cell lines HT29, Caco-2 and SW480, were maintained in the Dulbecco’s modified Eagle’s medium (DMEM), supplemented with appropriate serum as described previously [4,20,21,46] InR1-G9, HT29, Caco-2, and SW480 cells were transfected by the method of calcium phosphate precipitation [4,20] GLUTag and STC-1 cell lines were transfected by the procedure using LipofectAMINE (Invitrogen Life Technology Inc) Cells were harvested for LUC reporter gene analysis, 20 h after the transfection procedure [4,46] L Chen et al The method for preparing the primary fetal rat intestinal cell (FRIC) cultures has been described in our previous studies [27–29], using 19–21 day gestation fetal Wistar rats (Charles River Canada, Saint Constant, Quebec, Canada) For this study, FRIC cells were grown in the absence or presence of 10 lm forskolin plus 10 lm IBMX for the indicated period of time Total RNA was extracted for real time RT-PCR analysis against the Cdx-2 and proglucagon genes In FRIC cultures, the proglucagon producing endocrine L cells account for approximately 1% of the cell numbers [28] Northern blot analysis RNA from cultivated cell lines was extracted using the TRIzol reagent (Invitrogen Life Technology Inc), per manufacturer’s instruction Methods for northern blot analysis were described previously, using the hamster Cdx-2 cDNA as the probe to detect Cdx-2 mRNA expression, and the mouse tubulin cDNA as the probe to detect tubulin mRNA expression [4] Western blot analysis Anti-Cdx-2 Ig was generated in our previous studies [20,48] For western blot analysis, whole cell lysate containing approximately 20 lg proteins from each of the cultivated cell lines were size-fractionated by 10% SDS ⁄ PAGE and transferred to a nitrocellulose membrane (Protran, Schleicher & Schuell) Cdx-2 immunoreactive protein was detected with an ECL western blot analysis system (Amersham Pharmacia Biotech), per manufacturer’s instruction, with the peroxidase-linked anti-(rabbit IgG) Ig as the second antibody Anti-actin Ig was purchased from SigmaAldrich, while antibodies against phosphorylated ERK1 ⁄ (sc-7383) and total ERK1 ⁄ (sc-94) were purchased from Santa Cruz Biotechnology, Inc (Santa Cruz, CA) Reverse transcription of RNA templates and real-time PCR Single-strand cDNA synthesis was carried out using the Superscript II kit, purchased from Invitrogen Life Technol- Table Primers utilized in real time RT-PCR Orientation is 5¢)3¢ Gene Forward primer Reverse primer Rat Cdx-2 Mouse Cdx-2 Human CDX2 Rat GAPDH Mouse GAPDH Human GAPDH Rat proglucagon AAACCAGGACGAAAGACAAATACC GGACGTGAGCATGTATCCTAGCT CCTCGGCAGCCAAGTGAA TGATTCTACCCACGGCAAGT AACGACCCCTTCATTGAC TGCACCACCAACTGCTTAG GCCATTCACAGGGCACATTC CCTCCTGATGGTGATGTATCGA TAACCACCGTAGTCCGGGTACT AGCGACTGTAGTGAAACTCCTTCTC AGCATCACCCATTTGATGT TCCACGACATACTCAGCAC GACGCAGGGATGATGTTC CCGGTTCCTCTTGGTGTTCA 2756 FEBS Journal 272 (2005) 2746–2759 ª 2005 FEBS L Chen et al ogy Inc (Burlington, Ontario, Canada) per instruction Real time PCR analyses were conducted using the machine by Applied Biosystems (ABI PrismTM 7900HT, Foster City, CA) Each assay included a standard curve of five serial dilutions of a known concentration of cDNA and a nontemplate control All assays were performed in triplicates The expression levels of the genes were normalized with the house keeping gene glyceraldehyde-3-phosphate dehydrogenase (GAPDH) PCR primers were designed using the Primer Express 2.0 software (Applied Biosystems, Foster City, CA) and purchased from ACGT Corp (Toronto, Ontario, Canada) All primers utilized in conducting the real time PCR are shown in Table PKA activity assay A rabbit polyclonal antibody (SC903, C20) against PKAc and the PKA substrate were purchased from Santa Cruz Biotechnology, Inc (Santa Cruz, CA) PKA assay was conducted on pancreatic InR1-G9 and intestinal GLUTag cell lines, along with InR1-G9 cells transfected with PKAc cDNA, according to manufacture’s instruction Briefly, cells were harvested in cold NaCl ⁄ Pi and lysed in a RIPA buffer Testing sample was prepared by immunoprecipitation using the anti-PKA Ig The kinase assay was carried out in a kinase buffer containing 0.3 mm ATP, mm MgCl2, 0.5 lCi [32P]ATP[cP], 200 ng PKA substrate, and the testing sample After an incubation at 30 °C for 60 min, the reaction was stopped and spotted on the P81 phosphor-cellulose paper Unutilized [32P]ATP[cP] was washed away with 1% phosphoric acid and the radioactivity remained on the P81 paper was measured The data in Fig 4C represent independent experiments Data analysis All data (relative luciferase activity and relative PKA activity) are expressed as mean ± SD, n > ⁄ ¼ Statistic differences between samples were assessed using Student T-test Significance was assumed at P < 0.05 Acknowledgements We thank Drs Donald Branch, Denize Belsham, Harry Elsholtz, David Irwin and Weiyang Lu for useful discussions, Dr Xianjun Fang for providing the PKAc and dominant negative Ras cDNAs, and Dr Zuyao Ni for technical assistance This work was supported by operating grants from the Canadian Institute of Health Research (CIHR, MOP-62745G), and Canadian Diabetes Association (CDA, 1198) to TJ, and CIHR and CDA operating grants to PLB PLB is a Canadian Research Chair, LC is a recipient of Banting and Best Diabetes Center Novartis Graduate Award, and PD is FEBS Journal 272 (2005) 2746–2759 ª 2005 FEBS Activation of Cdx-2 expression by cAMP a recipient of the CIHR Canadian Digestive Health Foundation and Ontario Graduate Scholarship Award References James R & Kazenwadel J (1991) Homeobox gene expression in the intestinal epithelium of adult mice J Biol Chem 266, 3246–3251 James R, Erler T & Kazenwadel J (1994) Structure of the murine homeobox gene cdx-2 Expression in embryonic and adult intestinal epithelium J Biol Chem 269, 15229–15237 Suh E, Chen L, Taylor J & Traber PG (1994) A homeodomain protein related to caudal regulates intestine-specific gene transcription Mol Cell Biol 14, 7340–7351 Jin T & Drucker DJ (1996) Activation of proglucagon gene transcription through a novel promoter element by the caudal-related homeodomain protein Cdx-2 ⁄ Mol Cell Biol 16, 19–28 German MS, Wang J, Chadwick RB & Rutter WJ (1992) Synergistic activation of the insulin gene by a LIM-homeo domain protein and a basic helix-loop-helix protein: building a functional insulin minienhancer complex Genes Dev 6, 2165–2176 Laser B, Meda P, Constant I & Philippe J (1996) The caudal-related homeodomain protein Cdx-2 ⁄ regulates glucagon gene expression in islet cells J Biol Chem 271, 28984–28994 Hussain MA & Habener JF (1999) Glucagon gene transcription activation mediated by synergistic interactions of pax-6 and cdx-2 with the p300 co-activator J Biol Chem 274, 28950–28957 Chawengsaksophak K, James R, Hammond VE, Kontgen F & Beck F (1997) Homeosis and intestinal tumours in Cdx2 mutant mice Nature 386, 84–87 Tamai Y, Nakajima R, Ishikawa T, Takaku K, Seldin MF & Taketo MM (1999) Colonic hamartoma development by anomalous duplication in Cdx2 knockout mice Cancer Res 59, 2965–2970 10 Drummond F, Sowden J, Morrison K & Edwards YH (1996) The caudal-type homeobox protein Cdx-2 binds to the colon promoter of the carbonic anhydrase gene Eur J Biochem 236, 670–681 11 Lambert M, Colnot S, Suh ER, L’Horset F, Blin C, Calliot ME, Raymondjean M, Thomasset M, Traber PG & Perret C (1996) Cis-Acting elements and transcription factors involved in the intestinal specific expression of the rat calbindin-D9K gene: binding of the intestine-specific transcription factor Cdx-2 to the TATA box Eur J Biochem 236, 778–788 12 Troelsen JT, Mitchelmore C, Spodsberg N, Jensen AM, Noren O & Sjostrom H (1997) Regulation of lactasephlorizin hydrolase gene expression by the caudal-related homoeodomain protein Cdx-2 Biochem J 322, 833–838 2757 Activation of Cdx-2 expression by cAMP 13 Taylor JK, Levy T, Suh ER & Traber PG (1997) Activation of enhancer elements by the homeobox gene Cdx2 is cell line specific Nucl Acids Res 12, 2293–2300 14 Mitchelmore C, Troelsen JT, Spodsberg N, Sjostrom H & Noren O (2000) Interaction between the homeodomain proteins Cdx2 and HNF1alpha mediates expression of the lactase-phlorizin hydrolase gene Biochem J 346, 529–535 15 Park J, Schulz S & Waldman SA (2000) Intestine-specific activity of the human guanylyl cyclase C promoter is regulated by Cdx2 Gastroenterol 19, 89–96 16 Yamamoto H, Miyamoto K, Li B, Taketani Y, Kitano M, Inoue Y, Morita K, Pike JW & Takeda EJ (1999) The caudal-related homeodomain protein Cdx-2 regulates vitamin D receptor gene expression in the small intestine Bone Miner Res 14, 240–247 17 Hinoi T, Lucas PC, Kuick R, Hanash S, Cho KR & Fearon ER (2002) CDX2 regulates liver intestinecadherin expression in normal and malignant colon epithelium and intestinal metaplasia Gastroenterol 123, 1565–1577 18 Yamamoto H, Bai YQ & Yuasa Y (2003) CDX2 regulates liver intestine-cadherin expression in normal and malignant colon epithelium and intestinal metaplasia Biochem Biophys Res Commun 300, 813–818 19 Isshiki S, Kudo T, Nishihara S, Ikehara Y, Togayachi A, Furuya A, Shitara K, Kubota T, Watanabe M, Kitajima M & Narimatsu H (2003) Lewis type antigen synthase (beta3Gal-T5) is transcriptionally regulated by homeoproteins J Biol Chem 278, 36611–36620 20 Xu F, Li H & Jin T (1999) Cell type-specific autoregulation of the Caudal-related homeobox gene Cdx-2 ⁄ J Biol Chem 274, 34310–34316 21 Jin T & Li H (2001) POU homeodomain protein OCT1 is implicated in the expression of the caudal-related homeobox gene Cdx-2 J Biol Chem 276, 14752–14758 22 Gautier-Stein A, Domon-Dell C, Calon A, Bady I, Freund JN, Milthieux G & Rajas F (2003) Differential regulation of the glucose-6-phosphatase TATA box by intestine-specific homeodomain proteins CDX1 and CDX2 Nucleic Acids Res 31, 5238–5246 23 Bai YQ, Miyake S, Iwai T & Yuasa Y (2003) CDX2, a homeobox transcription factor, upregulates transcription of the p21 ⁄ WAF1 ⁄ CIP1 gene Oncogene 22, 7942–7949 24 Kim SP, Park JW, Lee SH, Lim JH, Jang BC, Lee SH, Jang IH, Freund JN, Suh SI, Mun KC, Song DK, Ha EM, Lee WJ & Kwon TK (2004) Homeodomain protein CDX2 regulates COX-2 expression in colorectal cancer Biochem Biophys Res Commun 315, 93–99 25 Uesaka T, Kageyama N & Watanabe H (2004) Identifying target genes regulated downstream of Cdx2 by microarray analysis J Mol Biol 337, 647–669 26 Drucker DJ, Campos R, Reynolds R, Stobie K & Brubaker PL (1991) The rat glucagon gene is regulated by a 2758 L Chen et al 27 28 29 30 31 32 33 34 35 36 37 38 39 protein kinase A-dependent pathway in pancreatic islet cells Endocrinol 128, 394–400 Anini Y, Hansotia T & Brubaker PL (2002) Muscarinic receptors control postprandial release of glucagon-like peptide-1: in vivo and in vitro studies in rats Endocrinol 143, 2420–2426 Ni Z, Anini Y, Fang X, Mills G, Brubaker PL & Jin T (2003) Transcriptional activation of the proglucagon gene by lithium and beta-catenin in intestinal endocrine L cells J Biol Chem 278, 1380–1387 Drucker DJ & Brubaker PL (1989) Proglucagon gene expression is regulated by a cyclic AMP-dependent pathway in rat intestine Proc Natl Acad Sci USA 86, 3953–3957 Drucker DJ, Jin T, Asa SL, Young TA & Brubaker PL (1994) Activation of proglucagon gene transcription by protein kinase-A in a novel mouse enteroendocrine cell line Mol Endocrinol 8, 1646–1655 Gajic D & Drucker DJ (1993) Multiple cis-acting domains mediate basal and adenosine 3¢,5¢-monophosphate-dependent glucagon gene transcription in a mouse neuroendocrine cell line Endocrinol 132, 1055–1062 Richards JS (2001) New signaling pathways for hormones and cyclic adenosine 3¢,5¢-monophosphate action in endocrine cells Mol Endocrinol 15, 209–218 Kupperman E, Wen W & Meinkoth JL (1993) Inhibition of thyrotropin-stimulated DNA synthesis by microinjection of inhibitors of cellular Ras and cyclic AMP-dependent protein kinase Mol Cell Biol 13, 4477–4484 Lorentz O, Cadoret A, Duluc I, Capeau J, Gespach C, Cherqui G & Freund JN (1999) Downregulation of the colon tumour-suppressor homeobox gene Cdx-2 by oncogenic ras Oncogene 18, 87–92 de Rooij J, Zwartkruis FJ, Verheijen MH, Cool RH, Nijman SM, Wittinghofer A & Bos JL (1998) Epac is a Rap1 guanine-nucleotide-exchange factor directly activated by cyclic AMP Nature 396, 474–477 Ebinu JO, Bottorff DA, Chan EY, Stang SL, Dunn RJ & Stone JC (1998) RasGRP, a Ras guanyl nucleotidereleasing protein with calcium- and diacylglycerol-binding motifs Science 280, 1082–1086 da Costa LT & He TC., YuJ, Sparks AB, Morin PJ, Polyak K, Laken S, Vogelstein B & Kinzler KW (1999) CDX2 is mutated in a colorectal cancer with normal APC ⁄ beta-catenin signaling Oncogene 18, 5010–5014 Kim S, Domon-Dell C, Wang Q, Chung DH, Di Cristofano A, Pandolfi PP, Freund JN & Evers BM (Year?) PTEN and TNF-alpha regulation of the intestinal-specific Cdx-2 homeobox gene through a PI3K, PKB ⁄ Akt, and NF-kappaB-dependent path Gastroenterol 123, 1163–1178 Domon-Dell C, Wang Q, Kim S, Kedinger M, Evers BM & Freund JN (2002) Stimulation of the intestinal Cdx2 homeobox gene by butyrate in colon cancer cells Gut 50, 525–529 FEBS Journal 272 (2005) 2746–2759 ª 2005 FEBS L Chen et al 40 Christensen AE, Selheim F, de Rooij J, Dremier S, Schwede F, Dao KK, Martinez A, Maenhaut C, Bos JL, Genieser HG & Døskeland SO (2003) cAMP analog mapping of Epac1 and cAMP kinase Discriminating analogs demonstrate that Epac and cAMP kinase act synergistically to promote PC-12 cell neurite extension J Biol Chem 278, 35394–35402 41 Qualtrough D, Hinoi T, Fearon E & Paraskeva C (2002) Expression of CDX2 in normal and neoplastic human colon tissue and during differentiation of an in vitro model system Gut 51, 184–190 42 Kaupp UB & Seifert R (2002) Cyclic nucleotide-gated ion channels Physiol Rev 82, 769–824 43 Dremier S, Kopperud R, Doskeland SO, Dumont JE & Maenhaut C (2003) Search for new cyclic AMP-binding proteins FEBS Lett 546, 103–107 44 Drucker DJ, Philippe J, Mojsov S, Chick WL & Habener JF (1987) Glucagon-like peptide I stimulates insulin gene expression and increases cyclic AMP levels in a FEBS Journal 272 (2005) 2746–2759 ª 2005 FEBS Activation of Cdx-2 expression by cAMP 45 46 47 48 rat islet cell line Proc Natl Acad Sci USA 84, 3434– 3438 Vallejo M, Penchuk L & Habener JF (1992) Somatostatin gene upstream enhancer element activated by a protein complex consisting of CREB, Isl-1-like, and alpha-CBF-like transcription factors J Biol Chem 267, 12876–12884 Jin T & Drucker DJ (1995) The proglucagon gene upstream enhancer contains positive and negative domains important for tissue-specific proglucagon gene transcription Mol Endocrinol 9, 1306–1320 Fang X, Yu SX, Lu Y, Bast RC Jr, Woodgett JR & Mills GB (2000) Phosphorylation and inactivation of glycogen synthase kinase by protein kinase A Proc Natl Acad Sci USA 97, 11960–11965 Trinh KY, Jin T & Drucker DJ (1999) Identification of domains mediating transcriptional activation and cytoplasmic export in the caudal homeobox protein Cdx-3 J Biol Chem 274, 6011–6019 2759 ... its PKA activity Finally we tested the effect of H-89, a known inhibitor of PKA, on the expression of both the proglucagon gene promoter and the Cdx-2 gene promoter in the PKA active GLUTag cell. .. al Activation of Cdx-2 expression by cAMP Fig Comparison of the effect of H-89 on expression of the proglucagon and Cdx-2 gene promoters Three micrograms )476 GLU-LUC (left panel) or )769 Cdx-2- LUC... factors and signaling molecules that regulate the expression of this promoter We found that cotransfection of the Cdx-2 cDNA led to upregulation of the expression of the Cdx-2 gene promoter in cell