Constitutive expression of the human peroxiredoxin V gene contributes to protection of the genome from oxidative DNA lesions and to suppression of transcription of noncoding DNA Andrey Kropotov 1,2,3 , Vladimir Serikov 1 , Jung Suh 1 , Alexandra Smirnova 2 , Vladimir Bashkirov 4 , Boris Zhivotovsky 3 and Nikolai Tomilin 1,2 1 Children’s Hospital Oakland Research Institute, CA, USA 2 Institute of Cytology, Russian Academy of Sciences, St Petersburg, Russia 3 Institute of Environmental Medicine, Division of Toxicology, Karolinska Institutet, Stockholm, Sweden 4 Applied Biosystems, Foster City, CA, USA Peroxiredoxins belong to the family of ubiquitously expressed proteins involved in antioxidant defense and redox signaling [1]. In mammals, six different peroxire- doxins have been identified (PRDX1–PRDX6), which show little sequence homology. Homozygous inactiva- tion of the PRDX1 gene in mice leads to accumulation of 8-oxoguanine (8-oxoG) in cell DNA, a decrease in lifespan, and an increase in tumor incidence [2]. PRDX2 knockout in mice affects the lifespan of erythrocytes [3], and this protein also regulates platelet-derived growth factor signaling [4]. Mitochondrial PRDX3 regulates apoptotic signaling [5] and has an important antioxi- dant function in the cardiovascular system [6]. PRDX4 plays a regulatory role in the activation of the trans- cription factor NF-kappaB [7], and PRDX6 knockout mice have a significantly lower survival rate [8]. Keywords heterochromatin; oxidative stress; 8-oxoguanine; peroxiredoxin V; transcription Correspondence N. V. Tomilin, Institute of Cytology, Russian Academy of Sciences, 194064 St Petersburg, Russia Fax: +7 812 2470341 Tel: +7 812 2475512 E-mail: nvtom@hotmail.com (Received 20 March 2006, accepted 10 April 2006) doi:10.1111/j.1742-4658.2006.05265.x Peroxiredoxins belong to a family of antioxidant proteins that neutralize reactive oxygen species. One member of this family, peroxiredoxin I (PRDX1), suppresses DNA oxidation. Peroxiredoxin V (PRDX5) has been cloned as a transcriptional corepressor, as a peroxisomal ⁄ mitochondrial antioxidant protein, and as an inhibitor of p53-dependent apoptosis. Pro- moters of mammalian PRDX5 genes contain clusters of antioxidant response elements, which can bind the transcription factor NRF2. How- ever, we found that expression of the human PRDX5 gene in situ was not stimulated by the oxidative agent menadione. Silencing of the NRF2 gene in the absence of oxidative stress by specific siRNA did not decrease PRDX5 protein concentration. We also constructed clones of human lung epithelial cells A549 with siRNA-mediated knockdown of the PRDX5 gene. This led to a significant increase in 8-oxoguanine formation in cell DNA. In the PRDX5 knockdown clone, an increase in transcripts containing sequences of alpha-satellite and satellite III DNAs was also detected, sug- gesting that this protein may be required for silencing of heterochromatin. Together, these results suggest that constitutively expressed PRDX5 gene plays an important role in protecting the genome against oxidation and may also be involved in the control of transcription of noncoding DNA. Abbreviations ARE, antioxidant response element; CSE, cigarette smoke extract; EpRE, electrophile response element; FITC, fluorescein isothiocyanate; GFP, green fluorescent protein; NRF2, nuclear factor erythroid-derived 2-like 2; 8-oxoG, 7,8-dihydro-8-oxoguanine; PRDX5, peroxiredoxin V; siRNA, small interfering RNA. FEBS Journal 273 (2006) 2607–2617 ª 2006 The Authors Journal compilation ª 2006 FEBS 2607 Mammalian PRDX5 was initially identified as a tran- scriptional corepressor [9–11], a peroxisomal antioxidant protein [12], a mitochondrial antioxidant protein, per- oxynitrite reductase [13,14] and an inhibitor of p53- dependent apoptosis [15]. Antiapoptotic activity of the human recombinant PRDX5 gene has also been detec- ted in transfected muscle cells from dystrophin-deficient mice [16] and in transfected human tendon cells [17]. Recent data indicate that this protein suppresses accu- mulation of etoposide-induced DNA double-strand breaks and may be involved in the global regulation of transcription through its association with Cajal bodies [18] where transcription complexes are assembled [19]. It has been also shown that overexpression of human PRDX5 in mitochondria of Chinese hamster cells decreases formation of 8-oxoG in mitochondrial DNA [20], but the role of this protein in protecting nuclear DNA from oxidation in human cells and the mecha- nisms of regulation of the PRDX5 gene are not estab- lished. In mammalian cells, the transcriptional response to antioxidants and electrophiles is governed by promo- ter-associated antioxidant response elements (AREs), which are identical with electrophile response elements (EpREs), which bind a common set of transcription factors and thus induce Phase II enzymes and stress proteins [21]. Of the ARE ⁄ EpRE-binding proteins, an important role belongs to the nuclear factor erythroid- derived 2-like 2 (NFE2L2; GenBank accession number NM_006164) also termed NRF2 [21,22]. This protein is kept inactive by KEAP1, phosphorylated during stress, and binds to ARE ⁄ EpRE motifs replacing BACH1, a negative regulator of these elements [21,23]. It has recently been suggested that a balance between active NRF2 and BACH1 inside the nucleus influences up-regulation or down-regulation of ARE-mediated gene expression [24]. PRDX1 gene expression is known to be activated in mouse macrophages in a NRF2- dependent manner by oxidative stress and electrophilic agents [25] and in mouse lungs by cigarette smoke [22]. Induction of the PRDX1 gene depends on conserved ARE ⁄ EpREs in this gene which apparently positively respond to binding of NRF2. We investigated transcriptional regulation of the PRDX5 gene the promoter of which contains ARE ⁄ EpRE and can bind transcription factor NRF2. How- ever, we found that expression of PRDX5 protein is not induced in several human cell lines by oxidative stress. Using previously made plasmids for small inter- fering RNA (siRNA)-mediated silencing of the human PRDX5 gene, we also constructed stable clones of the cultured airway epithelial cell line A549, which has significant down-regulation of this gene clone, and analyzed the concentration of 8-oxoG and transcrip- tion of some families of DNA repeats in these clones. Results PRDX5 expression is not induced by oxidative stress in human cell lines Treatment of cells with menadione (2-methyl-1,4-naph- thoquinone) leads to enhanced formation of active oxygen species and depletion of cellular glutathione, GSH [29]. Menadione induced oxidative stress in A549 cells, which was evident from an increase in 2¢,7¢- dichlorofluorescein diacetate fluorescence (Fig. 1A) and from depletion of glutathione (GSH; not shown), induced by 3 h incubation in 50 lm menadione. We further examined whether PRDX5 protein is induced by menadione in A549 cells and found that treatment with 50 lm menadione did not significantly affect the PRDX5 protein concentration (Fig. 1B,C). To ensure that this effect was not specific to A549 cells, the PRDX5 concentration after treatment of other human cell lines (U1810, HeLa, A431 and HEF4) was ana- lyzed. None showed an increase in PRDX5 concentra- tion after treatment with menadione (Fig. 1D). Similar A B DC Fig. 1. No induction of PRDX5 by the oxidative agent menadione. (A) 2¢,7¢-dichlorofluorescein diacetate fluorescence (indicative of oxi- dative stress) in A549 cells treated for 3 h with 50 l M menadione or 0.5 m M H 2 O 2 . For methods see ref [18]. (B) Representative im- munoblot of A549 cells. (C) Quantitation of relative PRDX5 amounts 3 h after menadione obtained in three independent experiments (mean ± SD). (D) PRDX5 immunoblotting results obtained in experi- ments with four other human cell lines (U1810, HEF4, A431 and HeLa). Transcription of noncoding DNA A. Kropotov et al. 2608 FEBS Journal 273 (2006) 2607–2617 ª 2006 The Authors Journal compilation ª 2006 FEBS results were also reproducibly obtained at different times after treatment of A549 and U1810 cells with 0.1–1.0 mm H 2 O 2 (not shown), indicating that expres- sion of the human PRDX5 gene did not apparently respond to oxidative stress under these conditions. It is known that, in mouse macrophages, expression of the PRDX1 gene is induced by oxidative stress agents including menadione, and this induction depends on the transcription factor NRF2 [25]. As the consensus sequence of ARE ⁄ EpRE, which binds NRF2, is known (RTGAYNNNGCR) [22], the location of the AREs in mammalian PRDX5 genes was examined using the pro- gram patser. Data presented in Fig. 2 show that clus- ters of potential AREs are present near CpG islands in human, mouse and rat PRDX5 genes, suggesting that ARE-binding transcription factors may be involved in the regulation of these genes. It should be noted that, although the exact positions of the AREs are not con- served between different mammalian species, at least 50% of all AREs in all of these genes are located within promoter CpG islands (Fig. 2), despite significant diver- gence of their noncoding sequences (not shown). To study whether NRF2 is actually required for basal expression of the human PRDX5 gene in the absence of oxidative stress, we used specific siRNA introduced into A549 cells by transient transfection. NRF2 is required not only for inducible but also for constitutive expression of some genes [23]. About 20-fold silencing of NRF2 expression was reproducibly detected 72 h after NRF2 siRNA transfection of A549 cells (Fig. 3A), but this did not significantly decrease the amount of PRDX5 protein (Fig. 3B). This indi- Fig. 2. Distribution of potential AREs in mammalian PRDX5 genes predicted by the computer program PATSER (http://rsat.ulb.ac.be/rsat/). PATSER was run with the following command line options: bin ⁄ patser -A a:t 0.3 c:g 0.2 –m mp ⁄ patser.2005-08-11.202429. matrix -b 1 -c -d1 -ls 6 -f tmp ⁄ patser. CpG islands (CpGi) were predicted using a program available at http://cpgislands.usc.edu/with default settings (55% GC, 0.65 ratio ObsCpG ⁄ ExpCpG, 500-bp length, 100-bp gap between adjacent islands). Genomic sequences and intron–exon structures were extracted from the Ensemble Genome Browser (http://www.ensembl.org). A B EDC Fig. 3. Modulation of NRF2 and PRDX5 expression. (A,B) Results of introduction into A549 cells of NRF2 siRNA. RNA transfection agent and antibodies to NRF2 were obtained from Santa Cruz Bio- tech. Tranfections were performed according to the manufacturer’s instructions in 12-well plates, and immunoblots were performed 72 h after transfection. (C,D) Inhibition of NRF2 and PRDX5 by CSE in A549 cells. CSE was prepared as described in ref [30]. (D) Mean ± SD values relative to control (taken as 1) obtained in three experiments. (E) Immunoblotting results were obtained using two stable clones of A549 cells (Control and KD-1, lanes 1 and 2; their isolation is described in the legend to Fig. 5), and A549 cells transi- ently transfected with plasmid (lane 3, 48 h after transfection) expressing under the control of the CMV promoter the short ( 17 kDa) form of PRDX5 (S-PRDX5) started from its second initi- ation codon [11]. This is the main form of the PRDX5 protein detectable by immunoblotting in human cells. It can be seen that down-regulation (lane 2) or up-regulation (lane 3) of PRDX5 slightly affects the amount of NRF2. A. Kropotov et al. Transcription of noncoding DNA FEBS Journal 273 (2006) 2607–2617 ª 2006 The Authors Journal compilation ª 2006 FEBS 2609 cates that NRF2 is not required for basal expression of the PRDX5 gene, or that the effect of NRF2 is masked by other transcription factors. NFR2 may be still be required for maintenance of high PRDX5 gene expression under conditions of oxi- dative stress. We previously found that expression of the PRDX5 gene is strongly inhibited by treatment of human or rat cells with cigarette smoke extract (CSE) [30], which can be potentially explained by CSE-medi- ated down-regulation of NRF2. Here we examined how CSE affects expression of NRF2, and found (Fig. 3C,D) that 3 h treatment with 5% CSE induces an approximately fivefold decrease in NRF2 protein, which is consistent with the view that NRF2 may be required for maintenance of high PRDX5 expression during CSE-mediated stress. To exclude a possible inverse effect of PRDX5 down-regulation on NRF2 expression, we examined NRF2 in A549 cells overex- pressing PRDX5 and in A549 KD-1 cells with siRNA- mediated knockdown of the PRDX5 gene (described below). NRF2 concentration was not significantly changed in cells with down-regulated PRDX5 (Fig. 3E, lane 2) or in overexpressing cells (Fig. 3E, lane 3), indicating that NRF2 expression does not depend on PRDX5. It appears therefore that inhibition of PRDX5 by CSE can be explained by a CSE-induced decrease in NRF2 (Fig. 3C,D). Role of PRDX5 in suppression of DNA oxidation (formation of 8-oxoG) To study the potential significance of PRDX5 in pro- tection of the human genome (nuclear DNA) from oxi- dation, we constructed a stable clone of A549 cells (KD-1) with greatly decreased expression of this gene mediated by specific siRNA (Fig. 4). KD-1 cells prolif- erated normally, but were more sensitive to menadi- one-induced cell death, which was measured by quantitation of the population of SubG1 cells 24 h after exposure to 50 lm menadione (Fig. 4C). 8-OxoG was analysed in the KD-1 clone using a flow cytometric method based on the ability of 8-oxoG to bind avidin [27]. As a control, we used a stable clone of A549 cells obtained after transfection of the plasmid encoding green fluorescent protein (GFP)- siRNA which showed a normal level of expression of the PRDX5 gene (see above). Figure 5A (left bars) shows the results of analysis of 8-oxoG in the control and KD-1 cells. In the KD-1 cells, the concentration of endogenous 8-oxoG was significantly increased, indicating that PRDX5 contributed to the genome def- ense against spontaneous oxidative lesions in DNA induced by endogenous factors. However, we were unable to detect a significant decrease in GSH in this clone compared with control cells under standard con- ditions (not shown). This indicates that the increased spontaneous DNA oxidation (Fig. 5A) may depend on a GSH-independent mechanism. KD-1 cells were also characterized by a minor increase in 8-oxoG as a result of a 3-h treatment with 50 lm menadione (Fig. 5A). This increase may be underestimated, if menadione suppresses the knockdown effect of PRDX5 siRNA, but we found that the decrease in PRDX5 observed in KD-1 cells was not affected by menadione (Fig. 5B). A small effect of PRDX5 on menadione-induced DNA oxidation was also found when human recombin- ant full L-PRDX5 (Long-PRDX5) was added to the medium [Dulbecco’s modified Eagle’s medium (DMEM) without serum and phenol red] in which cells were exposed to 50 lm menadione (data not shown). This protein, expressed in Escherichia coli (Fig. 5C) showed catalase-like activity (Fig. 5D). However, in the presence of another oxidative agent, CSE, significant suppression of DNA oxidation by L-PRDX5 was detec- ted (Fig. 5E). This suppression may be caused by neutralization of oxidative compounds of CSE in the medium by L-PRDX5. Also, L-PRDX5 may act inside cells, as it is capable of penetrating membranes because of the A BC Fig. 4. Construction of a plasmid expressing PRDX5 siRNA and isolation of the PRDX5 stable knockdown clone. The control clone was obtained after transfection of A549 cells with a plasmid encod- ing GFP–siRNA, and the KD-1 clone was isolated after transfection of A549 cells with a plasmid encoding PRDX5 siRNA (A). The relat- ive amount of PRDX5 protein but not PRDX1 protein is greatly decreased in KD-1 cells as seen in (B), lane 2. The KD-1 clone also shows higher sensitivity to cell death induced by 24 h of treatment with 50 l M menadione (C), which was detected by analysis of SubG1 cells using flow cytometry as described in ref [18]. Other details are described in Experimental procedures. Transcription of noncoding DNA A. Kropotov et al. 2610 FEBS Journal 273 (2006) 2607–2617 ª 2006 The Authors Journal compilation ª 2006 FEBS presence of a full N-terminus-covering mitochondrial targeting signal [13]. Taken together, our results indicate that PRDX5 may be involved in defense against sponta- neous DNA oxidation and DNA oxidation induced by CSE, and can suppress menadione-induced cell death, making a small contribution to protection from oxida- tion of nuclear DNA induced by menadione. Transcription of satellite DNA in the PRDX5 knockdown clone The human PRDX5 gene was originally cloned as an in vitro corepressor of transcription of Alu repeats [11]. Later we also detected colocalization of this protein with Cajal bodies [18] where transcription complexes are assembled [19]. Here using real-time PCR, we stud- ied whether changes in the PRDX5 KD-1 clone influ- ence the level of transcripts complementary to human DNA repeats. A similar approach has been recently used by others to show increased transcription of some mouse DNA repeats in cells deficient in H3-K9-specific histone methyltransferase Suv39 h [33] and mouse cells deficient in the ribonuclease Dicer [34], which is involved in processing and formation of siRNA. We compared cDNAs synthesized using random pri- mer on total RNAs from the PRDX5 KD-1 clone and from the control clone. The sequences of primers used in real-time PCR are shown in Table 1. Control and KD-1 cDNAs showed in real-time PCR almost identical amplification curves with primers to the human b-actin gene (Fig. 6A), indicating uniform reverse transcription of both RNA samples. Similar results were obtained with primers amplifying internal Alu sequences, but primers against a-satellite and satellite III DNA (ampli- fication products are seen in Fig. 6B) showed consistent differences between threshold cycles for KD-1 and A B E DC Fig. 5. Analysis of 7,8-dihydro-8-oxoguanine (8-oxoG) in the PRDX5 knockdown clone KD-1 (A,B) and in A549 cells treated with recombinant human L-PRDX5 (C–E). (A) Results of flow cytometry: the ordinate shows the shift (M1 gate) in the green fluorescence histogram obtained after incubation of cells with FITC–avidin as described in Experimental procedures. The M1 gate was adjusted to  1 with the control clone C (expressing GFP–siRNA) in the absence of menadione. Values are mean ± SD obtained from four experiments. Student’s test for the left pair of bars (no treatment) showed P ¼ 0.0032, and for the right pair of bars (menadione) the P ¼ 0.032. In (B) KD-1 cells were treated with 50 l M menadione (MEN) for 3 h, and immunoblotting was carried out as described in the legend to the Fig. 2. (C) Purity of recombinant L-PRDX5 ( 23 kDa) determined by electrophoresis in a 10% acrylamide gel stained with Coomassie Brilliant Blue. (D) Catalase activity of L-PRDX5. Reaction mixtures (0.5 mL) contained 100 l M Hepes buffer, pH 7.5, 2 mM dithiothreitol, the indicated amount of PRDX5 per ml, and 100– 130 l M H 2 O 2 . The reaction was stopped by mixing 100 mL aliquots with 0.75 mL 12.5% trichloroacetic acid. Then 200 lL10mM Fe(NH 4 ) 2 (SO 4 ) 2 and 100 lL2.5M KSCN were added, and A 450 was measured. Cells grown on plastic in DMEM containing 10% fetal calf serum and phenol red were washed with NaCl ⁄ P i , and the DMEM without fetal calf serum and phenol red was added (2 mL per 60-mm dish) followed by the addition of CSE (2% final concentration) and L-PRDX5 (50 lgÆmL )1 final concentration). After incubation at 37 °CinaCO 2 incu- bator for 3 h, cells were washed with NaCl ⁄ P i , detached from the plastic using trypsin ⁄ EDTA, and 8-oxoG was analysed as described above. A. Kropotov et al. Transcription of noncoding DNA FEBS Journal 273 (2006) 2607–2617 ª 2006 The Authors Journal compilation ª 2006 FEBS 2611 control cDNA probes (Fig. 6B, right section, Fig. 6C) with KD-1 samples reaching the amplification threshold about two cycles earlier than the controls at different dilutions. This corresponds to an approximately four- fold higher abundance of a-satellite and satellite III RNA in KD-1 cells than in control cells (Fig. 6C). Therefore, knockdown of the PRDX5 gene stimulated transcription of some families of human satellite DNA, which may be caused by direct involvement of PRDX5 in silencing of the transcription of heterochromatin. Discussion In this study we found that PRDX5 gene expression in cultured human A549 cells as well as in several other human cell lines is not induced by oxidative stress. This happens despite the presence of the conserved cluster of potential AREs, which can serve as binding sites for the transcription factor NRF2 in the 5¢ pro- moter region of mammalian PRDX5 genes. NRF2 is known to be involved in oxidative stress-induced acti- vation of the PRDX1 gene in mouse macrophages [25] and mouse lungs [22]. NRF2 is also involved in activa- tion of many other antioxidant response genes [21]. As NRF2 sites in the PRDX5 promoter may be involved in the maintenance of constitutive expression of PRDX5 in the absence of oxidative stress, we exam- ined whether it can be inhibited by specific NRF2 siRNA, but found that PRDX5 gene expression was not silenced by NRF2 siRNA. This indicates that other transcription factors may control constitutive (basal) expression of the PRDX5 gene. It should be noted that the potential binding site for the ubiquitous transcription factor NF-1 is located 1 kb upstream of the PRDX5 transcription start. Higher expression of PRDX5 than other peroxire- doxins in different types of normal human tissues was found using Affimetrix gene expression arrays; the relevant information is available free at http:// www.GeneCards.org. Apparently, human PRDX5 gene promoter has efficient transcription cis-regulatory ele- ments for its high constitutive expression, which may be required for neutralization of reactive oxygen species continuously produced by mitochondria [31]. A signifi- cant fraction of PRDX5 is known to be located in mitochondria [13] and associated with the mitochond- rial matrix (A. V. Kropotov et al., unpublished results). However, NRF2 may be required for the maintenance of high PRDX5 gene expression under oxidative stress, as we found that NRF2 was strongly down-regulated by CSE, as well as PRDX5 in our earlier study [30]. Here we also constructed a clone of human cells with siRNA-mediated down-regulation of PRDX5 (KD-1) and found a significantly increased concentra- tion of endogenous 8-oxoG in this clone. This suggests that constitutive basal expression of the PRDX5 gene contributes to the antioxidant defense of the human genome. The 8-oxoG content of nuclear DNA from mouse tissues estimated by quantitative analysis (HPLC and electrospray detection in isolated DNA) is 0.1–0.4 per 10 6 bp [32]. Assuming that the basal steady-state concentration of 8-oxoG in control A549 cells is the same as in mouse tissues and that the dip- loid genome size is  7000 Mbp, it can be calculated that the observed relative  2.5-fold increase in 8-oxoG in the PRDX5 KD-1 clone (Fig. 5A) corresponds to > 1000 additional potentially mutagenic DNA lesions per nucleus in PRDX5 knockdown cells. PRDX5 may also be involved in defense against DNA oxidation induced in A549 cells by external stress Table 1. Sequences of primers used in real-time PCR. B-ACT, beta actin; ASAT, alpha-satellite; ALU, Alu repeat; S3T, satellite III. D, direct; R, reverse. Name Primer length (nt) Sequence (5¢ to 3¢) PCR product length (nt) B-ACT-D 21 CATGTACGTTGCTATCCAGGC B-ACT-R 21 CTCCTTAATGTCACGCACGAT 250 ASAT-D 22 TCTTTGTGATGTGTGCATTCAA ASAT-R 20 TATTCCCGTTTCCAACGAAG 132 ALU-D 20 ACGAGGTCAGGAGATCGAGA ALU-R 19 GATCTCGGCTCACTGCAAG 174 S3T-D 19 AATCAACCCGAGTGCAATC S3T-R 22 TCCATTCCATTCCTGTACTCGG 160 Fig. 6. Real-time PCR analysis of transcription in PRDX5 knockdown clone. (A, left section) Photograph of a 3% acrylamide gel with amplifi- cation products obtained with b-actin primers (Table 1) using two different dilutions (1 : 9 and 1 : 729) of template cDNA from the control clone (lanes 1 and 3) and the same dilutions of cDNA from the KD-1 clone (lanes 2 and 4). Control reactions with b-actin primers but without template are shown in lanes 5 and 6. Size markers (25-bp ladder from Invitrogen) are shown in lane 7. (A, right section) Kinetics of real-time DNA amplification with numbers corresponding to the lanes in the left section. (B, left section) Photograph of a 3% agarose gel with amplifi- cation products obtained with alpha-satellite (ASAT, lane 1) and satellite III (S3T, lane 3) primers (Table 1) of cDNA from the control clone (dilution 1 : 200). Lane 2 shows size markers. The expected size of the product with ASAT primers is 132 bp and with S3T primers )160 bp. (B, right section) Kinetics of amplification with ASAT primers of identical amounts of cDNA (1 : 25 dilution) from the control clone (curve P) and from the KD-1 clone (curve D). (C) Fold difference between cDNA isolated from the control and KD-1 clones calculated from standard curves. Mean ± SD values of four to six PCRs are shown. Transcription of noncoding DNA A. Kropotov et al. 2612 FEBS Journal 273 (2006) 2607–2617 ª 2006 The Authors Journal compilation ª 2006 FEBS A B C A. Kropotov et al. Transcription of noncoding DNA FEBS Journal 273 (2006) 2607–2617 ª 2006 The Authors Journal compilation ª 2006 FEBS 2613 agents such as CSE (Fig. 5E) and in suppression of cell death induced by menadione (Fig. 4C). However, the contribution of PRDX5 to menadione-induced DNA oxidation was small (Fig. 5A), indicating that other fac- tors may be more important in this menadione effect than PRDX5. As PRDX5 was originally isolated as a transcript- ional corepressor [11], we studied whether transcript- ion is affected in KD-1 cells. No change in the abundance of b-actin gene transcripts or of transcripts containing Alu or LINE1 sequences was found in the KD-1 clone, but a significant increase in the abundance of transcripts of a-satellite and satellite III DNA was reproducibly detected. Strong induction of transcrip- tion of satellite III DNA (which is located in hetero- chromatin of chromosome 9) by heat shock has been documented by other groups [33,34]. In real-time PCR analysis of Alu transcripts, primers matching very con- served internal Alu subsequences were used, which are present in 3¢ untranslated segments of mRNA of many different genes and can mask possible contributions of RNA polymerase III-dependent Alu transcripts. How- ever, inserts of conserved a-satellite and satellite III sequences are present in a very small number of entries of the human dbEST database (< 10 per  7 · 10 6 sequences), indicating that the detected increase in abundance of satellite DNA transcripts is probably associated with a true increase in heterochromatin tran- scription in cells with down-regulated PRDX5. The mechanism of this increase remains unclear. Transcription of heterochromatin is known to be controlled by a negative regulatory loop involving siRNA produced by the nuclease Dicer and histone H3-K9 trimethylation [35–37]. If PRDX5 is involved in maturation of these RNA-induced transcription silencing complexes, its knockdown may lead to activa- tion of heterochromatin transcription. Alternatively, an increased transcription of some satellite DNAs in the PRDX5 knockdown clone may be an indirect con- sequence of changes in cellular redox state, affecting a redox-sensitive transcription factor, e.g. NF-kappaB. This factor regulates gene expression of a large number of cytokine and other immune response genes [38], but its role in transcription of heterochromatin is not known. Experimental procedures Cell culture Human lung carcinoma line A549 and epidermoid carci- noma line A431 were obtained from ATCC and cultured in DMEM containing d-glucose (4.5 g Æ L )1 ) supplemented with 10% fetal calf serum, 100 UÆmL )1 penicillin, and 100 lgÆmL )1 streptomycin (complete DMEM) in a CO 2 incubator at 37 °C. Human embryonic fibroblasts HEF4 and HeLa cells were obtained from the Cell Culture Collec- tion of the Institute of Cytology RAS (St Petersburg), and the nonsmall cell lung carcinoma line U1810 was obtained from the Cell Line Collection of the Karolinska Institutet (Stockholm). Construction of siRNA plasmids Vector mU6pro with U6 RNA gene promoter was obtained from D. L. Turner [26] (http://sitemaker.umich.edu/ dLturner.vectors/rna_interference_vectors). NEO gene was amplified using PCR from the Rc-CMV plasmid (Strata- gene, La Jolla, CA, USA) and subcloned into mU6pro between ApaI and HindIII sites upstream of the U6 promo- ter. Hairpin oligonucleotides for RNAi were subcloned between BbsI and XbaI restriction sites immediately down- stream from the U6 promoter. Sequences (5¢ to 3¢)of complementary hairpin oligonucleotides targeting PRDX5 cDNA (exons 5 and 6 underlined) were: TTT GAGA ACCTCTTGAGACGTCGATGACGTCTCAAGAGGTTC TCTTTTT (top strand) and CTAGAAAAAGAGAA CCTCTTGAGACG TCATC GACGTCTCAAGAGGTTCT (bottom strand). Targeted segments are present in all spli- cing variants of PRDX5 mRNA and therefore should silence all these variants. For the control plasmid, we used hairpin oligonucleotides targeting GFP (sequences under- lined) gene: TTT GAAGAAGTCGTGCTGCTTCATGGA AGCAGCACGACTTCTTCTTTTT (top strand) and CTA GAAAAA GAAGAAGTCGTGCTGCTTCCATAAGCAG CACGACTTCTT (bottom strand). Bacterial clones with insertions in these oligonucleotides were identified using PCR and sequenced with vector primers GCTACATTTTA CATGATAGGCTTGG (U6-forward) and CACAGGAAA CAGCTATGACCAT (M13-rev). Isolation of stable PRDX5 knockdown (KD) and control clones of A549 cells The cells, grown on 24-well plates, were transfected with mU6neo plasmids, which expressed siRNA against PRDX5 or GFP using Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA). Plasmid DNA (0.8 lg) or Lipofectamine (1.6 lL) was diluted in 50 lL Opti-MEM, incubated for 5 min, then mixed and incubated for 20 min before addition to cells. After overnight incubation at 37 °CinaCO 2 incubator, DMEM with 10% fetal calf serum was added, and incuba- tion was continued for 10 h. Then cells were replated at 1 : 10–1 : 40 dilution on to the six-well plates and selection with G418 (1 mgÆmL )1 ) was started the next day. Individual clones growing on G418 were analyzed using western blot- ting with antibodies to PRDX5 as well as the control clone obtained after transfection of A549 cells with GFP siRNA expressing mU6neo plasmid. One of the clones (KD-1) which Transcription of noncoding DNA A. Kropotov et al. 2614 FEBS Journal 273 (2006) 2607–2617 ª 2006 The Authors Journal compilation ª 2006 FEBS showed > 90% inhibition of PRDX5 protein on blots (com- pared with the control during several passages after isolation) was used for further experiments. PRDX5 KD-1 cells derived from the A549 line showed normal morphology, normal GSH ⁄ GSSG ratio, and growth characteristics in the medium with G418 similar to cells of the control clone. Therefore, down-regulation of the PRDX5 gene did not significantly affect proliferation of A549 and cell cycle progression. Expression of PRDX5 in E. coli To express full-length PRDX5 (L-PRDX5) starting from the first AUG codon in its coding sequence, the corresponding DNA fragment was PCR-amplified from a plasmid with full PRDX5 cDNA using primers BE-1 (GGCGGATCCATGG GACTAGCTGGCGTGTGCG) and BE-2 (GGCGA ATTCTTATCAGAGCTGTGAGATGATATTGGG) and DNA polymerase PfuI. The resulting fragment was purified, treated with Bam H1 ⁄ EcoRI, subcloned into the BamH1 ⁄ EcoRI-cleaved GST-fusion vector pGEX-6P-1, and trans- formed into E. coli BL21. Bacteria were grown at 30 °Cin Luria–Bertani medium until A 600 ¼ 1.0. GST-fusion protein synthesis was induced with 1.0 mm isopropyl b-d-thiogal- actoside (final concentration), and bacteria were further grown for 3–4 h. Cells were harvested by centrifugation, and the pellet was resuspended and washed with TB buffer (9.1 mm Hepes, 55 mm MgCl 2 ,15mm CaCl 2 , 250 mm KCl, adjusted to pH 6.7). The cell pellet containing GST-fusion protein was resuspended in NaCl ⁄ P i lysis buffer (140 mm NaCl, 2.7 mm KCl, 10 mm Na 2 HPO 4 , 1.8 mm KH 2 PO 4 adjusted to pH 7.4) supplemented with lysozyme (1 mgÆmL )1 ; Sigma, St Louis, MO, USA), Complete TM Protease Inhibitor Cocktail (Roche, Alameda, CA, USA), 10 mm MgCl 2 , and DNAse I (10 UÆmL )1 ; Roche). Cells were effectively lysed by repeated freezing ⁄ thawing. The lysate was cleared by centrifugation at 70 000 g and 4 °C. The supernatant was loaded on to a GSTrap FF column (Amersham Biosciences, Piscataway, NJ, USA; Glutathione Sepharose TM 4 Fast Flow). After GST-fusion protein bind- ing to the column, bound material was washed with NaCl ⁄ P i , pH 7.4. Then the buffer was replaced with PreScission Prote- ase buffer (50 mm Tris ⁄ HCl, 100 mm NaCl, 1 mm EDTA, 1mm dithiothreitol, pH 8.0), and rapid on-column GST- fusion protein cleavage was performed. The enzyme contains a noncleavable GST-affinity tag for optimum on-column cleavage, and the column remains online, connected to the purification system, eliminating the loss of any material. Proteolytic digestion used 2 U enzyme per 100 lg bound GST-fusion protein. PreScission Protease was diluted in 4.5 mL PreScission buffer and manually injected on to the column at an increased flow rate of 5–7 mLÆmin )1 , and the system was incubated for 12–16 h at 4 °C. Before elution, a 1-mL GSTrap FF column (pre-equilibrated with PreScission buffer) was connected downstream to the GSTrap FF pro- teolytic cleavage column. The GSTrap FF affinity column acts as a filter to capture any released cleaved GST protein, uncleaved GST-fusion protein, and unbound PreScission Protease. Cleaved protein is eluted immediately upon flow startup with PreScission buffer. The elution peak containing the cleaved target protein (L-PRDX5) was eluted first through the 1-mL buffering GSTrap column. Analysis of 8-oxoG in DNA This analysis is based on previous observations that avidin binds with high affinity to 8-oxoG in DNA [27,28]. This approach was efficiently used previously for detection of 8-oxoG in mouse knockout cells with targeted disruption of the PRDX1 gene [2]. Here we used fluorescein isothiocya- nate (FITC)–avidin (Sigma) and flow cytometry (Beckton– Dickinson, Franklin Lakes, NJ, USA; FACS Calibur) for detection of 8-oxoG. Cells were treated with the oxidative agent menadione (50 lm; Sigma) for the indicated times in serum-free and phenol red-free DMEM (Invitrogen), detached from the plastic with trypsin ⁄ EDTA, washed in NaCl ⁄ P i , and fixed in 2% formaldehyde at 4 °C and then in 80% ethanol at )20 °C. Other steps before FACS analy- sis were performed as described in the instructions to the OxyDNA fluorimetric kit (catalogue no. 500095) produced by Calbiochem (San Diego, CA, USA). FITC–avidin bind- ing was quantified by relative peak shift (M1 gate) in the FACS histograms obtained. Immunoblotting Cells were scraped off into cold lysis buffer composed of 1% Triton X-100, 2 mm EDTA, 2 mm dithiothreitol, 0.25 mgÆmL )1 leupeptin, 0.25 mgÆmL )1 pepstatin A, 0.4 mgÆmL )1 aprotinin and 0.1 mm phenylmethanesulfonyl fluoride. Samples were separated by SDS ⁄ PAGE (10% gels), and then separated proteins were transferred to membranes, where they were blocked overnight at 4 °C with 5% nonfat dry milk in TBST (10 mm Tris ⁄ HCl, pH 8.0 ⁄ 150 mm NaCl ⁄ 0.1% Tween 20). The blot was rinsed twice with TBST and incubated for 2 h at room temperature with rabbit poly- clonal PRDX5 antibody (1 : 2000 dilution) [11] or commer- cial antibodies to actin and NRF2 (1 : 1000 dilution) in TBST containing 5% BSA. The membrane was washed for 15 min with TBST and incubated with goat anti-mouse IgG conjugated with horseradish peroxidase in 5% milk for 1 h, and then washed three times with TBST and developed with enhanced chemiluminescence reagent (Amersham). Bands on radioautographs were quantified using the Image J program (NIH). Transfections of A549 cells with NRF2 siRNA Here we used siRNA, antibodies, transfection reagents and protocols produced and recommended by Santa Cruz A. Kropotov et al. Transcription of noncoding DNA FEBS Journal 273 (2006) 2607–2617 ª 2006 The Authors Journal compilation ª 2006 FEBS 2615 Biotechnology (Santa Cruz, CA, USA). In preliminary experiments, the efficiency of RNA transfection of A549 cells was examined using FITC-labeled short RNA and analysis by flow cytometry. In these experiments, a significant shift in mean fluorescence was detected 24 h after transfection, indi- cating high efficiency of RNA uptake by A549 cells. RNA extraction, cDNA synthesis, and real-time PCR Total RNA was extracted from A549 cells using Trizol Reagent (Invitrogen). cDNA was synthesized using the Invitrogen SuperScript III First Strand Synthesis System with random hexamer primers for 50 min at 50 °C. After being heated for 5 min at 85 °C and hydrolysed with RNase H for 20 min at 37 °C, the resulting cDNA was used in real-time PCR (Universal PCR SYBR Mastermix; Applied BioSystems) in a final volume of 25 l L in 96-well plates in an automated fluorimeter (ABI PRISM 7000). Standard amplification conditions were used: 2 min at 50 °C, 10 min at 95 °C, 40 cycles of 15 s at 95 °C and 60 s at 60 °C. Sequences of oligonucleotide primers used in RT-PCR are shown in Table 1. Computational approaches Genomic sequences were exported from the Ensemble Data- base (http://www.ensemble.org) along with  2 kb of flank- ing sequences on both sides of the genes. To analyze the distribution of binding sites for NRF2 in PRD5X genes, the patser program (http://rsat.ulb.ac.be/rsat/) was used with the following command line options: bin ⁄ patser -A a:t 0.3 c:g 0.2 -m tmp ⁄ patser.2005-08-11.202429.matrix -b 1 -c -d1 -ls 6 -f tmp ⁄ patser with the lower threshold estimation through the weight score 6. The position ⁄ weight matrix for NRF2 was composed using known consensus binding sequences for NRF2 [22]. The position of the CpG islands in the PRDX genes was determined using a program avail- able at http://cpgislands.usc.edu/at default settings (55% GC, 0.65 ratio ObsCpG ⁄ ExpCpG, 500-bp length, 100-bp gap between adjacent islands). Acknowledgements This research was supported in part by Philip Morris USA Inc. and by Philip Morris International (to V.S.), by Swedish (3829-B04–09XAC) and Stockholm (041502) Cancer Societies, Swedish Research Council (K2006–31X-02471-39-3) and INTAS Genomics (05-1000004-7755) grants (to B.Z.), and by the Russian Fund of Basic Research grants 04-04-49292 and 04-04- 293 (to N.T.). A.K. was also supported by a grant from the Institute of Environmental Medicine, Kar- olinska Institutet, from the Wenner-Gren Foundation (Sweden), and the Russian Science Foundation. References 1 Wood ZA, Poole LB & Karplus PA (2003) Peroxire- doxin evolution and the regulation of hydrogen perox- ide signaling. Science 300, 650–653. 2 Neumann CA, Krause DS, Carman CV, Das S, Dubey DP, Abraham JL, Bronson RT, Fujiwara Y, Orkin SH & Van Etten RA (2003) Essential role for the peroxiredoxin Prdx1 in erythrocyte antioxidant defence and tumour suppression. Nature 424, 561–565. 3 Lee TH, Kim SU, Yu SL, Kim SH, Park DS, Moon HB, Dho SH, Kwon KS, Kwon HJ, Han YH, et al. (2003) Peroxiredoxin II is essential for sustaining life span of erythrocytes in mice. Blood 101, 5033–5038. 4 Choi MH, Lee IK, Kim GW, Kim BU, Han YH, Yu DY, Park HS, Kim KY, Lee JS, Choi C, et al. (2002) Regulation of PDGF signalling and vascular remodel- ling by peroxiredoxin II. Nature 435, 347–353. 5 Chang TS, Cho CS, Park S, YuS, Kang SW & Rhee SG (2004) Peroxiredoxin III, a mitochondrion-specific peroxidase, regulates apoptotic signaling by mitochon- dria. J Biol Chem 279, 41975–41984. 6 Araki M, Nanri H, Ejima K, Murasato Y, Fujiwara T, Nakashima Y & Ikeda M (1999) Antioxidant function of the mitochondrial protein SP-22 in the cardiovascular system. J Biol Chem 274, 2271–2278. 7 Zhang Y, Emmanuel N, Kamboj G, Chen J, Shurafa M, Van Dyke DL, Wiktor A & Rowley JD (2004) PRDX4, a member of the peroxiredoxin family, is fused to AML1 (RUNX1) in an acute myeloid leukemia patient with a t (X; 21) (p22;q22). Genes Chromosomes Cancer 40, 365–370. 8 Wang X, Phelan SA, Forsman-Semb K, Taylor EF, Petros C, Brown A, Lerner CP & Paigen B (2003) Mice with targeted mutation of peroxiredoxin 6 develop nor- mally but are susceptible to oxidative stress. J Biol Chem 278, 25179–25190. 9 Kropotov AV & Tomilin NV (1996) A human B-box- binding protein downregulated in adenovirus 5-trans- formed human cells. FEBS Lett 386, 43–46. 10 Kropotov AV & Tomilin NV (1997) Evidence for a reg- ulatory protein complex on RNA polymerase III pro- moter of human retroposons of Alu family. Genetica (Dortrecht) 98, 223–233. 11 Kropotov A, Sedova V, Ivanov V, Sazeeva N, Tomilin A, Krutilina R, Oei SL, Griesenbeck J, Buchlow G & Tomi- lin N (1999) A novel human DNA-binding protein with sequence similarity to a subfamily of redox proteins which is able to repress RNA-polymerase-III-driven tran- scription of the Alu-family retroposons in vitro. Eur J Biochem 260, 336–346. 12 Yamashita H, Avraham S, Jiang S, London R, Van Veldhoven PP, Subramani S, Rogers RA & Avraham H (1999) Characterization of human and murine PMP20 Transcription of noncoding DNA A. Kropotov et al. 2616 FEBS Journal 273 (2006) 2607–2617 ª 2006 The Authors Journal compilation ª 2006 FEBS [...]... 37–45 Kropotov AV, Grudinkin PS, Pleskach NM, Gavrilov BA, Tomilin NV & Zhivotovsky B (2004) Downregulation of peroxiredoxin V stimulates formation of etoposide-induced double-strand DNA breaks FEBS Lett 572, 75–79 Gall JG (2001) A role for Cajal bodies in assembly of the nuclear transcription machinery FEBS Lett 498, 164–167 Banmeyer I, Marchand C, Clippe A & Knoops B (2005) Human mitochondrial peroxiredoxin. .. Ostapenko OV, Tomilin NV & Baranov VS (2002) The BCL-xL and ACR-1 genes promote differentiation and reduce apoptosis in muscle fibers of mdx mice Genetika (Moscow) 38, 1445–1450 Yuan J, Murrell GA, Trickett A, Landtmeters M, Knoops B & Wang MX (2004) Overexpression of antioxidant enzyme peroxiredoxin 5 protects human tendon cells against apoptosis and loss of cellular function during oxidative stress Biochim... S (1985) Oxidative stress studied in intact mammalian cells Philos Trans R Soc Lond B Biol Sci 311, 673–677 Serikov VB, Leutenegger C, Krutilina RI, Kropotov AV & Tomilin NV (2006) Cigarette smoke extract inhibits expression of antioxidant protein peroxiredoxin V Inhal Toxicol 18, 79–92 Balaban RS, Nemoto S & Finkel T (2005) Mitochondria, oxidants, and aging Cell 120, 483–495 Hamilton ML, Van Remmen... NAD(P)H:quinone oxidoreductase 1 Transcription of noncoding DNA 25 26 27 28 29 30 31 32 33 34 35 36 37 38 gene expression and induction in response to antioxidants J Biol Chem 280, 16891–16900 Ishii T, Itoh K, Takahashi S, Sato H, Yanagawa T, Katoh Y, Bannai S & Yamamoto M (2000) Transcription factor Nrf2 coordinately regulates a group of oxidative stress-inducible genes in macrophages J Biol Chem... (2004) Human peroxiredoxin 5 is a peroxynitrite reductase FEBS Lett 571, 161–165 Zhou Y, Kok KH, Chun AC, Wong CM, Wu HW, Lin MC, Fung PC, Kung H & Jin DY (2000) Mouse peroxiredoxin V is a thioredoxin peroxidase that inhibits p53-induced apoptosis Biochem Biophys Res Commun 268, 921–927 Mikhailov VM, Kropotov AV, Zelenin AV, Krutilina RI, Kolesnikov VA, Zelenina IA, Baranov AN, Shtein GI, Ostapenko OV, Tomilin... (2001) Does oxidative damage to DNA increase with age? Proc Natl Acad Sci USA 98, 10469–10474 Jolly C, Metz A, Govin J, Vigneron M, Turner BM, Khochbin S & Vourc’h C (2004) Stress-induced transcription of satellite III repeats J Cell Biol 164, 25–33 Rizzi N, Denegri M, Chiodi I, Corioni M, Valgardsdottir R, Cobianchi F, Riva S & Biamonti G (2004) Transcriptional activation of a constitutive heterochromatic... in mice J Clin Invest 114, 1248–1259 Nguyen T, Sherratt PJ, Nioi P, Yang CS & Pickett CB (2005) Nrf2 controls constitutive and inducible expression of ARE-driven genes through a dynamic pathway involving nucleocytoplasmic shuttling by Keap1 J Biol Chem 280, 32485–32492 Dhakshinamoorthy S, Jain AK, Bloom DA & Jaiswal AK (2005) Bach1 competes with Nrf2 leading to negative regulation of the antioxidant... constitutive heterochromatic domain of the human genome in response to heat shock Mol Biol Cell 15, 543–551 Martens JH, O’Sullivan RJ, Braunschweig U, Opravil S, Radolf M, Steinlein P & Jenuwein T (2005) The profile of repeat-associated histone lysine methylation states in the mouse epigenome EMBO J 24, 800–812 Kanellopoulou C, Muljo SA, Kung AL, Ganesan S, Drapkin R, Jenuwein T, Livingston DM & Rajewsky K (2005)... are defective in differentiation and centromeric silencing Genes Dev 19, 489–501 Murchison EP, Partridge JF, Tam OH, Cheloufi S & Hannon GJ (2005) Characterization of Dicer-deficient murine embryonic stem cells Proc Natl Acad Sci USA 102, 12135–12140 Kabe Y, Ando K, Hirao S, Yoshida M & Handa H (2005) Redox regulation of NF-kappaB activation: distinct redox regulation between the cytoplasm and the nucleus... Kropotov et al 13 14 15 16 17 18 19 20 21 22 23 24 peroxisomal proteins that exhibit antioxidant activity in vitro J Biol Chem 274, 29897–29904 Knoops B, Clippe A, Bogard C, Arsalane K, Wattiez R, Hermans C, Duconseille E, Falmagne O & Bernard A (1999) Cloning and characterization of AOEB166, a novel mammalian antioxidant enzyme of the peroxiredoxin family J Biol Chem 274, 30451–30458 Dubuisson M, Vander . Constitutive expression of the human peroxiredoxin V gene contributes to protection of the genome from oxidative DNA lesions and to suppression of transcription of noncoding DNA Andrey Kropotov 1,2,3 ,. basal expression of the PRDX5 gene contributes to the antioxidant defense of the human genome. The 8-oxoG content of nuclear DNA from mouse tissues estimated by quantitative analysis (HPLC and. 37–45. 18 Kropotov AV, Grudinkin PS, Pleskach NM, Gavrilov BA, Tomilin NV & Zhivotovsky B (2004) Downregulation of peroxiredoxin V stimulates forma- tion of etoposide-induced double-strand DNA breaks. FEBS