Cloning of type cannabinoid receptor in Rana esculenta reveals differences between genomic sequence and cDNA Rosaria Meccariello1, Rosanna Chianese2, Gilda Cobellis2, Riccardo Pierantoni2 and Silvia Fasano2 ` Dipartimento di Studi delle Istituzioni e dei Sistemi Territoriali, Universita di Napoli ‘Parthenope’, Naples, Italy ` Dipartimento di Medicina Sperimentale, Sez ‘F Bottazzi’, II Universita di Napoli, Naples, Italy Keywords cannabinoid receptor; frog; nonsynonymous mutations; post-transcriptional modifications; synonymous mutations Correspondence R Pierantoni, Dipartimento di Medicina ` Sperimentale, Sez ‘F Bottazzi’, II Universita di Napoli, via Costantinopoli 16, 80138 Napoli, Italy Fax: +39 081 5667536 00 Tel: +39 081 5667617 E-mail: riccardo.pierantoni@unina2.it Database The sequences reported in this paper have been deposited in the GenBank database under the accession numbers AM113546, AM260468 and AM260467 for frog cnr1 brain, testis cDNA and genomic DNA, respectively (Received January 2007, revised April 2007, accepted April 2007) doi:10.1111/j.1742-4658.2007.05824.x The endocannabinoid system is a conserved system involved in the modulation of several physiologic processes, from the activity of the central nervous system to reproduction Type cannabinoid receptor (CNR1) cDNA was cloned from the brain and testis of the anuran amphibian, the frog Rana esculenta Nucleotide identity ranging from 62.6% to 81.9% is observed among vertebrates The reading frame encoded a protein of 462 amino acids (FCNR1) with all the properties of a membrane G-coupled receptor Alignments of FCNR1 with those of other vertebrates revealed amino acid identity ranging from 61.9% to 88.1%; critical domains for CNR1 functionality were conserved in the frog As nucleotide differences of cnr1 cDNA were observed in brain and testis, the genomic sequence of the cnr1 gene was also determined in the same tissue preparations Nucleotide changes in codons 5, 30, 70, 186, 252 and 408 were observed when cDNA and genomic DNA were compared; the nucleotide differences did not affect the predicted amino acid sequences, except for changes in codons 70 and 408 Interestingly, the predicted RNA folding was strongly affected by different nucleotide sequences Comparison of cnr1 mRNA sequences available in GenBank with the corresponding genomic sequences revealed that also in human, rat, zebrafish and pufferfish, nucleotide changes between mRNA and genomic sequences occurred Furthermore, amino acid sequences deduced from both mRNA and the genome were compared among vertebrates, and also in pufferfish the nucleotide changes corresponded to modifications in the amino acid sequence The present results indicate for the first time that changes in nucleotides may occur in cnr1 mRNA maturation and that this phenomenon might not be restricted to the frog Cannabinoid receptors (CNRs) bind D9-tetrahydrocannabinol, the major active constituent of the marijuana plant, Cannabis sativa, and some endogenous lipidic mediators collectively termed ‘endocannabinoids’ [1,2] The best known endogenous ligands for CNRs are anandamide (arachidonoylethanolamide, AEA), 2-arachidonoylglycerol, the noladin ether (2-arachidonyl glyce- rylether), virodhamine (o-arachidonoylethalamine), and N-arachidonoyldopamine [1,2] Apart from CNRs and their ligands, the endocannabinoid system comprises a specific AEA membrane transporter, a fatty acid amide hydrolase, responsible for AEA degradation to ethanolamine and arachidonic acid, and an N-acyl-phosphatidylethanolamines-hydrolyzing phospholipase D, Abbreviations AEA, arachidonoylethanolamide; CD, cytoplasmic domain; CNR, cannabinoid receptor; ED, extracellular domain; TM, transmembrane domain FEBS Journal 274 (2007) 2909–2920 ª 2007 The Authors Journal compilation ª 2007 FEBS 2909 Cloning of cnr1 in frog R Meccariello et al enzymatic machinery that is responsible for the release, on demand, of AEA from membrane N-acyl-phosphatidylethanolamines [3] Currently, two CNR subtypes have been characterized: type (CNR1) is widely expressed in the nervous system and in several peripheral tissues, including the pituitary gland and reproductive tissues [4,5]; type (CNR2) is mainly expressed in the immune system [6,7] Splice variants of CNR1 (named CNR1a and CNR1b), with different pharmacologic effects and expression rates, have been described in humans [5,8] Furthermore, the presence of additional CNR subtypes (CNRx) has been postulated in mice [9] The endocannabinoid system is highly conserved in evolution Orthologs of the human CNR1 receptor gene (cnr1) have been cloned and sequenced in mammals [10] Furthermore, cnr1 orthologs have been cloned and sequenced in fish [11–13], in urodele and anuran amphibians [14,15], and in birds [16] Reptilian species have not yet been investigated As well as in vertebrates, the cnr1 gene has been cloned in an urochordate, the sea squirt Ciona intestinalis [17], and its high expression has been described in the cerebral ganglion, branchial pharynx, heart and testis [18] In invertebrates, the occurrence of endocannabinoid receptor activity has been reported in sea urchins, molluscs, annelids and cnidarians [19–21] In addition, the investigation of cnr1 orthologs in the genomes of Drosophila melanogaster and Caenorhabditis elegans was unsuccessful, and no binding sites for CNR1 synthetic ligands have been found in several insect species [21] In this respect, the first appearance of the endocannabinoid system might be evolutionarily related to that in deuterostomian organisms [10,21] CNR1 is a membrane G-protein coupled receptor with seven transmembrane-spanning regions [22] The signal transduction pathway elicited by CNR1 comprises inhibition of adenylylcyclase via Gi protein and consequent activation ⁄ inhibition of Ca2+ and K+ channels; activation of mitogen-activated protein kinase has also been reported [23] Besides the classical CNR1 and CNR2 receptors, AEA interacts with K+ and Ca2+ channels, as well as 5-hydroxytryptamine-3 receptor and the type vanilloid receptor, a ligand-gated and nonselective cationic channel [24] Furthermore, AEA produced after Ca2+ mobilization has recently been proposed as an intracellular messenger regulating ion channel activity by binding the type vanilloid receptor channels on the cytoplasmic bilayer interface [25] Interestingly, CNR1 homodimerization and heterodimerization [26] represent a further amplification of cannabinergic signalling potency 2910 Therefore, due to the great complexity of the endocannabinoid system, the widespread distribution outside the nervous system and the high degree of evolutionary conservation, detailed CNR1 molecular characterization among species may be useful to elucidate the activity of endocannabinoids at multiple levels As a previous report indicates that the endocannabinoid system operates in the brain and testis of the frog Rana esculenta [27], we took advantage of this model to obtain knowledge of the molecular cloning and characterization of CNR1 We report for the first time the detection of nucleotide differences among brain cDNA, testis cDNA and genomic sequences, together with the corresponding amino acid variations We have also investigated whether or not this phenomenon is present in other vertebrate species studied so far Results cnr1 molecular cloning and receptor characterization from brain preparations R esculenta cnr1 partial cDNA was obtained by a combination of RT-PCR and 3¢-RACE (Table 1) The characterized R esculenta brain cnr1 cDNA (fcnr1) is 1586 bp long, and comprises: (a) a 5¢-UTR 12 bp long; (b) a coding region of 1389 bp encoding a protein of 462 amino acids; and (c) a complete 3¢-UTR 169 bp long containing a canonical polyadenylation site at 1522 bp The fcnr1 nucleotide sequence was compared with those of other vertebrates [mammals (cat, rat, mouse, chimp, monkey and human), amphibians (the anuran Xenopus laevis and the urodele Taricha granulosa), birds (the zebrafinch Taeniopygia guttata) and teleost fish (Fugu rubripes, whose genome contains a cnr1 gene named cnr1a and a paralogous gene named cnr1b, and Danio rerio)] as well as invertebrates (the urochordate sea squirt C intestinalis) cnr1 sequences from other vertebrates and invertebrates containing only a partial coding sequence were not considered in this study Alignments, conducted by lalign and clustalw multiple alignments, revealed a nucleotide identity ranging from 62.6% to 81.9% among vertebrates, and 46.5% against C intestinalis (Table 2) A protein of 462 amino acid residues with a predicted molecular mass of 51.89 kDa was deduced from the nucleotide sequence Also, the deduced CNR1 amino acid sequence of R esculenta (FCNR1) was compared with those of known CNR1s, revealing an amino acid identity ranging from 61.9% to 88.1% among vertebrates and of 21.5% in C intestinalis (Table 2) A complete FEBS Journal 274 (2007) 2909–2920 ª 2007 The Authors Journal compilation ª 2007 FEBS R Meccariello et al Cloning of cnr1 in frog Table Primer sequences and PCR programs used for genomic and cDNA fcnr1 amplification Primer Source Primer sequence (5¢– to 3¢) PCR program P1 P2 X laevis X laevis CAGTTCTTCCTCTGTTTGGGTGGAAC CCATAAGAGGGCCCCAACAAATG P3 P2 Degenerate R esculenta GCTTCATGATTCT(GT)A(AC)(CT)CC(AC)AG CCATAAGAGGGCCCCAACAAATG P5 P6 X laevis R esculenta AAAACTGGGGTAATGAAGTC AGTAAATGTACCCAGGGTTA P7 P8 R esculenta Degenerate ATTGGGGTAACCAGTGTTCT T(GC)GC(AG)ATCTTAAC(AG)GTGCT P9 AP R esculenta ACGGTCAGAACAGACATGCG GGCCACGCGTCGACTAGTAC(T) 17 95 94 58 72 72 95 94 50 72 94 45 72 72 95 94 50 72 94 54 72 72 95 94 52 72 94 48 72 72 95 94 62 72 72 alignment of known CNR1 proteins is reported in Fig 1; interestingly, the lowest amino acid identity is in the N-terminal region of the receptor (amino acids 1–72) (Fig 1) A rooted phylogenetic tree was constructed using the phylip drawgram method and exported by clustalw (Fig 2) On the basis of the estimated phylogenetic relationship among the CNR1s in vertebrates, we confirm a relative divergence between CNR1 sequences of the anuran and the urodele amphibians [15] bioinformatic was then used for further characterization of FCNR1 Seven hydrophobic domains, typical of the G-coupled transmembrane receptor, were predicted by tmap and tmhmm software (Fig 3) The four extracellular domains (ED1–4) comprise amino acid residues 1–109 (ED1), 168–181 (ED2), 248–266 (ED3), and 360–368 (ED4); transmembrane domains °C, min; °C for 30 s, °C for 45 s, °C for min, 35 cycles; °C for °C for min; °C for 45 s, °C for 45 s, °C for 45 s, cycles; °C for 45 s, °C for 45 s, °C for 45 s, 30 cycles; °C for s °C for min; °C for 30 s, °C for 30 s, °C for 45 s, cycles; °C for 30 s, °C for 30 s, °C for 45 s, 35 cycles; °C for °C for min; °C for 30 s, °C for 30 s, °C for min, cycles; °C for 30 s, °C for 30 s, °C for min, 25 cycles; °C for °C for min; °C for 30 s, °C for s, °C for 30 s, 35 cycles; °C for Size (bp) 339 780 378 528 (TM1–7) comprise amino acid residues 110–132 (TM1), 145–167 (TM2), 182–204 (TM3), 225–247 (TM4), 267–289 (TM5), 337–359 (TM6), and 369–391 (TM7); the four cytoplasmic domains (CD1–4) comprise amino acid residues 133–144 (CD1), 205–224 (CD2), 290–336 (CD3), and 392–462 (CD4) Although the highest nucleotide and amino acid identity was observed among amphibians, a lower degree of conservation was detected in ED1; in particular, in R esculenta, seven consecutive amino acid residues were completely missing as compared with other amphibian species (Fig 1) Several putative high-confidence phosphorylation residues (serine, threonine and thyrosine) were predicted by netphos 2.0 software (Fig 3) Critical domains for CNR1 functionality in the other vertebrates were conserved in the frog (Fig 3) Among them were: (a) dual sites for N-linked FEBS Journal 274 (2007) 2909–2920 ª 2007 The Authors Journal compilation ª 2007 FEBS 2911 Cloning of cnr1 in frog R Meccariello et al Table Nucleotide and amino acid identity (%) between the frog Rana esculenta CNR1 receptor and other CNR1 and CNR2 receptors Nucleotide identity is referred to the coding sequences Accession numbers in the NCBI GenBank for cnr1 nucleotide sequences: Ciona intestinalis, AB087259; Fugu rubripes cnr1a, X94401; Fugu rubripes cnr1b, X94402; Danio rerio, AY148349; Taricha granulosa, AF181894; Xenopus laevis, AY098532; Taeniopygia guttata, AF255388; Mus musculus, AF153345; Rattus norvegicus, U40395; Felis catus, U94342; Macaca mulatta, AF286025; Pan troglodytes, NM_001013017; Homo sapiens, NM_016083; Homo sapiens cnr1a, NM_033181; Homo sapiens cnr1b, AY766182 Accession numbers in the NCBI GenBank for cnr2 nucleotide sequences: Danio rerio, NM_212964; Mus musculus, NM_009924; Rattus norvegicus, NM_020543; Homo sapiens, NM_001841 CNRs Cnr1 Ciona intestinalis Danio rerio Fugu rubripes cnr1a Fugu rubripes cnr1b Taricha granulosa Xenopus laevis Taenyopigia guttata Felis catus Mus musculus Rattis norvegicus Pan troglodytes Macaca mulatta Homo sapiens Homo sapiens cnr1a Homo sapiens cnr1b Cnr2 Danio rerio Mus musculus Rattus norvegicus Homo sapiens % Nucleotide identity Coding length (nucleotides) % Amino acid identity Amino acid residues 46.5 64.9 68.2 62.6 76.6 81.9 74.2 73 73.4 73.2 72.2 72.6 72.5 66.6 70.8 1272 1428 1407 1413 1422 1413 1422 1419 1422 1422 1419 1419 1418 1236 1320 21.5 70.7 73.9 61.9 82.9 88.1 84.4 82.2 83.3 83.3 82.4 82.4 82.4 74.4 80.2 423 475 467 470 473 470 473 472 473 473 472 472 472 411 439 48.9 45.7 44.4 48.4 1038 1044 1033 1082 44.0 35.6 36.3 35.6 345 347 360 360 glycosylation in the N-terminal extracellular domain; (b) potential sites for protein kinase C phosphorylation in the first and the third intracellular regions; (c) a conserved lysine in the third transmembrane domain (TMD3) whose importance for receptor interaction with bicyclic but not aminoalkylindole classes of cannabinoid agonists has been reported [28,29]; (d) a TQK motif in the third cytoplasmic loop that is critical in rat for CNR1 receptor activation of K+ and Ca2+ channels [30]; (e) a leucine and alanine pair in the C-terminus of the third cytoplasmic loop implicated in the interaction with Gs in rat [31]; (f) two serine residue within the intracellular tail, corresponding to rat amino acid residues 426 and 430 involved in receptor desensitization [32]; (g) a TVK sequence corresponding to a potential protein kinase C phosphorylation site within the intracellular tail region; and (h) a TMS motive in the intracellular tail, corresponding to rat amino acid residues 460–463, required for WIN552122-mediated receptor internalization in AtT20-transfected cells [33] 2912 fcnr1 molecular cloning from testis preparations A fragment of 1384 bp (codons 1–447) was cloned by RT-PCR from frog testis Alignment between R esculenta brain and testis cDNA revealed two nucleotide differences in codons 186 (GGG in testis and GGA in brain) and 252 (CTC in testis and CTA in brain) Such modifications were constantly observed from the sequences of three different clones isolated from different cDNA preparations and did not correspond to amino acid differences fcnr1 genomic DNA sequence analysis To assess the possibility of post-transcriptional modifications, we cloned the whole R esculenta coding region of cnr1 from genomic DNA preparations obtained from the same homogenates used to prepare cDNA Similar results were obtained from genomic DNA sequences from testis, brain and muscle clustalw alignments of brain cDNA, testis FEBS Journal 274 (2007) 2909–2920 ª 2007 The Authors Journal compilation ª 2007 FEBS R Meccariello et al Cloning of cnr1 in frog Fig Alignments of complete CNR1 amino acid sequences Completely conserved amino acid residues are in black boxes; identical amino acid residues are in light gray boxes; similar amino acid residues are in medium gray boxes; different amino acid residues are in white boxes Similarity ⁄ differences have been highlighted with the BOX-SHADE alignments graphic program cDNA and genomic sequence revealed several nucleotide differences (Fig 4) Brain cDNA differed from the genomic cnr1 sequence in codons 5, 30, 70, 186, 252, and 408 Testis cDNA differed from the genomic cnr1 coding sequence in codons 5, 30, 70, and 408 Owing to genomic code degeneration, these nucleotide differences did not change the amino acid sequence except for those concerning codon 70 and codon 408 In fact, at the genomic level, TCA70 and AAA408 encoded serine (S70) and lysine (K408), respectively; in the cDNA, GCA70 and GAA408 encoded alanine (A70) and glutamic acid (E408), respectively A70 is located in the first extracellular loop, just in the conserved N-linked glycosylation domain; E408 is located in the cytoplasmic tail, in a region suggested to be sensitive for Gi coupling in rat [23] To assess whether or not similar nucleotide differences among cnr1 cDNA and the corresponding genomic sequences exist in vertebrates, we blasted the mRNA sequences deposited in GenBank against the corresponding genome database Amino acid sequences deduced from mRNA sequences were then compared to those deduced from the corresponding genomic sequences The results of our search are summarized in Table For rat, human, zebrafish and pufferfish cnr1b, differences between mRNA and genomic sequences are reported In particular, in F rubripes cnr1b, such nucleotide differences also corresponded to amino acid differences Northern and Southern blot analysis Northern blot analysis of R esculenta brain and testis mRNA was carried out using an antisense RNA probe of 780 bp A signal of 2.2 kb was observed in brain and testis (Fig 5A) Southern blot analysis revealed a single signal of kb in frog genomic DNA, previously digested by EcoRI, indicating that fcnr1 is a single-copy gene (Fig 5B) FEBS Journal 274 (2007) 2909–2920 ª 2007 The Authors Journal compilation ª 2007 FEBS 2913 Cloning of cnr1 in frog R Meccariello et al Fig (Continued) RNA folding analysis A difference between brain and testis mRNA secondary structure emerged (Fig 6A,B, asterisks); several differences in the secondary structure predicted from brain ⁄ testis mRNA and the mRNA sequence deduced from genomic DNA were also observed (Fig 6C, arrows) Discussion In this article, we report the molecular cloning of cnr1 from R esculenta brain and testis fcnr1 and FCNR1 2914 have high nucleotide and amino acid identity (ranging from 62.6% to 81.9% and from 61.9% to 88.1%, respectively) as compared to those of other vertebrates Several critical domains for CNR1 functionality are present in frog, suggesting an evolutionarily conserved activity Furthermore, analysis of cnr1 gene organization suggests that the cnr1 coding region is contiguous and not interrupted by intronic sequences as reported for other vertebrates [5,8,34] In fact, splice donor– acceptor sites detected in mouse, rat and human, responsible for cnr1a and cnr1b splice forms, are not conserved in frog Interestingly, comparison between genomic DNA and cDNA, both obtained from frog FEBS Journal 274 (2007) 2909–2920 ª 2007 The Authors Journal compilation ª 2007 FEBS R Meccariello et al Fig Phylogenetic analysis of the known vertebrate CNR1 receptor A rooted phylogenetic tree was constructed using the PHYLIP’S DRAWGRAM method and exported by CLUSTALW Branch lengths are proportional to the estimated evolutionary distance among the receptors Cloning of cnr1 in frog brain and testis, suggests the existence of nucleotide changes in cDNA sequences Four single-nucleotide polymorphisms responsible for the modulation of striatal response to happy faces have been reported in the human cnr1 gene [35,36] In the present study, we think that the possibility of polymorphic sites may be excluded, in that DNA and RNA preparations were derived from the same tissue preparations collected from five animals per month at least, and we always confirmed our results Furthermore, sequences obtained from brain and testis genomic DNA were identical In addition, to avoid any sequence deduction from 3¢-overlapping ends, sequencing was conducted on both strands from three separate clones no more than 800 bp long Interestingly, only alterations in codons 70 and 408 are effective in changing amino acid residues A70 and E408 are located in the first extracellular domain, just in the conserved N-linked glycosylation domain, and in the cytoplasmic tail, a region suggested to be sensitive for Gi coupling in rat Fig Frog CNR1 receptor characterization Extracellular domains are in Courier New; transmembrane domains are in bold characters; intracellular domains are in italics *Putative high-confidence phosphorylation sites; dual sites for N-linked glycosylation in the N-terminal extracellular domain are underlined ^The conserved lysine in the third transmembrane domain (TMD3) °°Leucine and alanine pair in the C-terminus of the third cytoplasmic loop implicated in the interaction with Gs in rat; the light gray box indicates the TQK motif in the third cytoplasmic loop that is critical in rat for CB1 receptor activation of K+ and Ca2+ channels; the medium gray box indicates two serine residues within the intracellular tail that in rat are phosphorylated and involved in receptor desensitization; the dark gray box indicates a TVK sequence corresponding to a potential protein kinase C phosphorylation site within the intracellular tail region; the black box indicates a TMS motive in the intracellular tail that is required in rat for WIN55212-2-mediated receptor internalization in AtT20-transfected cells; the white boxes indicate possible editing sites, and different amino acid residues predicted from brain cDNA and genomic DNA are in bold italic characters FEBS Journal 274 (2007) 2909–2920 ª 2007 The Authors Journal compilation ª 2007 FEBS 2915 Cloning of cnr1 in frog R Meccariello et al Fig Differences among fcnr1 sequences obtained from genomic DNA and cDNA isolated from brain and testis Alignment of frog cnr1 nucleotide sequences from frog brain genome and brain and testis cDNA Deduced amino acid sequences are in italics Codons with nucleotide differences are underlined; bold characters indicate nucleotide and amino acid differences Table cnr1 mRNA versus cnr1 genomic DNA in vertebrates: nucleotide (nt) and deduced amino acid sequence difference comparison Accession numbers in the NCBI GeneBank for cnr1 mRNA sequences are the same as in Table 2; putative Fugu rubripes cnr1a and cnr1b mRNA sequences were deduced from the cloned gene sequences [11] Accession numbers in the NCBI GeneBank for cnr1 genomic sequences: Fugu rubripes cnr1a, CAAB01001440.1; Fugu rubripes cnr1b, CAAB01001484.1; Danio rerio, NW_634056.1; Mus musculus, NT_109315.2; Rattus norvegicus, NW_047711.2; Felis catus, NM_001009331.1; Pan troglodytes, NW_107960.1; Homo sapiens, NT_086697.1 Genome mRNA (nucleotides) Species Homo sapiens CNR1A Homo sapiens CNR1B Pan troglodytes Rattus norvegicus Mus musculus Felis catus Danio rerio Fugu rubripes CNR1A Fugu rubripes CNR1B Genome cDNA (amino acids) – nt606 (G–A) – nt915 (T–C) – – nt462 (G–T) nt510 (T–A) nt681 (T–C) nt777 (G–T) nt798 (G–A) – nt728 (C–A) nt1388 (A–C) – – – – – – – – – – – – A241–E241 D463–A463 [23]; in this respect, a role in the modulation of CNR1 activity is not excluded Finally, Southern and northern blot analysis demonstrate that cnr1 is a 2.2 - testis KB B brain A KB -3.0 18S Fig Northern blot and Southern blot analysis (A) A band of 2200 bp is observed in both brain (1) and testis (2) mRNA by northern blot experiments (B) A single band of 3000 bp is observed from high-mass genomic DNA previously digested with EcoRI, indicating that fcnr1 is a single-copy gene 2916 single-copy gene, and therefore the corresponding messenger is detected in both brain and testis To verify whether or not cnr1 differences between genomic and cDNA sequences occur in other vertebrates, we blasted all the nucleotide sequences deposited in NCBI GenBank with the corresponding genomic available sequences; in addition, we compared all the amino acid sequences deduced from both genomic DNA and mRNA It is worth noting that similar nucleotide changes occur in other species and are quite scattered among vertebrates However, as in the frog, most changes not influence the amino acid composition Only in the F rubripes cnr1b gene nucleotide changes, in codons 241 and 463, change the amino acid composition predicted by the analysis of different genomic DNA sequences In both mammals and invertebrates, RNA editing is an elaborate and precise form of post-transcriptional RNA processing, powering genetic diversification [37] In mammals, there are two main classes of editing enzymes able to deaminate encoded nucleotides: the former generates I (inosine) from A (adenosine), and the latter generates U (uridine) from C (cytidine) [38,39] In the first case, genomically encoded A is read as G in RNA-cDNA sequences Currently, the literature concerning mRNA editing is limited to a relatively few examples In particular, all currently known A-to-I edited transcripts of both mammals and invertebrates encode membrane proteins in nervous tissue These proteins function as voltage-gated or ligand-gated ion channels or as G protein-coupled receptors [e.g serotonin (5-hydroxytryptamine 2c) receptor, non-N-methyl-d-aspartate glutamate receptor channels in mammals, and squid K+ channels in invertebrates] [40] Interestingly, if the editing process occurs in frog, a GAA408 codon corresponds to the genomic AAA408 in the cDNA, and this might be considered as an A-to-I editing example With respect to the significance of nucleotide changes in cDNA that not change the amino acid composition predicted by the genomic sequence, we have no explanation at present Synonymous mutations in the human dopamine receptor D2 FEBS Journal 274 (2007) 2909–2920 ª 2007 The Authors Journal compilation ª 2007 FEBS R Meccariello et al Cloning of cnr1 in frog Fig mRNA folding analysis Secondary structure of the overlapping fragments of 1354 bp from brain mRNA (A), testis mRNA (B) and the mRNA sequence deduced from genomic DNA (C) Hatched circles mark the regions with the main differences between the cloned mRNA and the mRNA sequence deduced from genomic DNA Asterisks indicate the difference between brain and testis mRNA; arrows indicate the main differences in mRNA deduced from genomic DNA Bold circles mark the magnification of the secondary structure of brain and testis mRNA Structures have been selected on the basis of minimal dG (free energy) values affect mRNA stability and synthesis of the receptor [41] Accordingly, in the present study, synonymous and nonsynonymous mutations weakly alter the putative mRNA folding between brain and testis mRNA; by contrast, the secondary structure of the mRNA predicted from the genomic sequence is substantially different from the secondary structure of brain and testis mRNA In this respect, we speculate that the nucleotide changes observed in this study may affect RNA folding and therefore its stability and turnover In conclusion, apart from molecular cloning of cnr1 in R esculenta, this is the first report showing that changes in nucleotides occur during mRNA maturation Furthermore, we find that this phenomenon is not restricted to the frog Whether or not editing processes may generate different cnr1 mRNA molecules (with different activity ⁄ stability) in different tissues, leading to pharmacologic applications, should be further investigated Experimental procedures Animals and tissue collection Five male frogs of R esculenta were collected monthly from September until July in the neighborhood of Naples (Italy) The animals were killed under anesthesia with MS222 (Sigma-Aldrich Corp., St Louis, MO) Brain, testis (for genomic and cDNA studies) and muscle were removed and stored appropriately at ) 80 °C until used This research was approved by the Italian Ministry of University and Scientific and Technological Research Total RNA preparation A pool of total RNA was extracted from R esculenta tissues (n ¼ per month) using TRIZOL Reagent (Invitrogen Life Technologies, Paisley, UK), following the manufacturer’s instructions Total RNA was treated for 30 at 37 °C with DNaseI (10 U per sample) (Amersham Pharmacia Biotech, Chalfont St Giles, UK) to avoid any contamination of genomic DNA; total RNA purity and integrity were determined by spectrophotometer analyses at 260 ⁄ 280 nm and by electrophoresis Isolation of R esculenta complete cnr1 coding sequence Pools of total RNA were reverse transcribed to prepare cDNA The reverse transcription was carried out using lg of total RNA, 0.5 lg of anchor oligonucleotide (AP), 10 mm dNTP, 0.01 m dithiothreitol, · first-strand buffer (Invitrogen Life Technologies), 40 U of RNase Out (Invitrogen Life Technologies), and 200 U of SuperScript-III RNaseH– reverse transcriptase (Invitrogen Life Technologies), in a final volume of 20 lL, following the manufacturer’s instructions As negative control, total RNA not treated with reverse transcriptase was used Complementary DNA was used for PCR analysis A frog cDNA fragment of 339 bp corresponding to transmembrane segments and was obtained using primers designed from X laevis cnr1 cDNA (P1 and P2, Table for details) Afterwards, rat, mouse, African clawed frog and zebrafish cnr1 complete nucleotide sequences were aligned by clustalw, and degenerate upper and reverse primers were selected in highly conserved regions To extend the 5¢ ⁄ 3¢ sequence, combinations of degener- FEBS Journal 274 (2007) 2909–2920 ª 2007 The Authors Journal compilation ª 2007 FEBS 2917 Cloning of cnr1 in frog R Meccariello et al ate ⁄ specific primers were used Primer sequences and PCR program details are summarized in Table All PCR analyses were conducted in an Applied Biosystem Thermocycler apparatus using lL of diluted cDNA or 100 ng of genomic DNA and the high-fidelity TaKaRa Ex Taq (Cambrex Bio Science, Milan, Italy) Amplification products were subcloned in pGEM-T Easy Vector (Promega Corporation, Madison, WI) DH5a high-efficiency competent cells were transformed, and recombinant colonies were identified by blue ⁄ white color screening Plasmidic DNA was extracted by NucleoBond Plasmid extraction kit (Macherey-Nagel, Duren, Germany), and insert size was ă controlled by restriction analysis with EcoRI (Fermentas GmbH, St Leon-Rot, Germany) DNA was then sequenced on both strands by Primm Sequence Service (Primm srl, Naples, Italy) Finally, frog cnr1 mRNA and genomic nucleotide sequences were obtained by comparing overlapping fragments, and amino acid sequences were deduced Sequence analysis Nested amplification products, obtained independently from separate amplification reactions, were sequenced in both forward and reverse strands, and the cnr1 mRNA sequence was deduced by comparing overlapping fragments of the two complementary strands On the basis of the nucleotide sequence, the R esculenta CNR1 amino acid sequence was deduced In order to establish the degree of CNR1 identity among vertebrates, both the nucleotide coding sequence and the amino acid sequence of R esculenta CNR1 were aligned with other known CNR1 ⁄ CNR2 complete coding sequences and amino acid sequences available in the NCBI GenBank by align and clustalw multiple alignments After alignments of vertebrate CNR1 amino acid sequences, a phylogenetic tree was constructed using phylip’s drawgram and exported from clustalw Finally, putative transmembrane domains, N-linked glycosylation sites and phosphorylation sites were predicted by using, respectively, tmap, tmhmm, netnglyc 1.0 Server, and netphos 2.0 Server, available at SDSC Biology Workbench (http://workbench.sdsc.edu/) and at ExPASy Proteomics Server (http://au.expasy.org/) cnr1 sequences and compared to those predicted from cDNA Northern blot Ten micrograms per lane of total brain and testis RNA previously denatured with glyoxal and dimethylsulfoxide was electrophoresed on 1.4% agarose gel and blotted on nylon membranes (Nytran; Amersham Pharmacia Biotech) An antisense RNA probe complementary to the cloned 780 bp fragment of fcnr1 mRNA was produced using the nonradioactive, digoxigenin (DIG)-based system DIG RNA Labelling Kit (SP6 ⁄ T7) (Roche, Mannhein, Germany), following the manufacturer’s instruction In brief, lg of pGEM-Tfcb1 recombinant plasmid was linearized by digestion with Pst1 (Fermentas GmbH), and transcription was carried out in vitro using T7 RNA polymerase and a mixture of dNTP and DIG-11-UTP Blots were prehybridized and probed at 65 °C in Church’s buffer (0.5 m NaCl ⁄ Pi, pH 7.4, 7% SDS, 0.5 mm EDTA, and 100 mgỈmL)1 sonicated salmon sperm); 100 ngỈmL)1 labeled probe was then added in hybridization buffer The membrane was washed twice at room temperature for in low-stringency buffer (2 · NaCl ⁄ Cit, 0.1% SDS), and then twice at 65 °C in high-stringency buffer (0.2 · NaCl ⁄ Cit, 0.1% SDS) The chemiluminescent protocol for the detection of DIG-labeled probes suggested by Roche was then used After incubation with the chemiluminescent alkaline phosphatase substrate CSPD (Roche), the filter was exposed for a suitable time to Hyperfilm Kodak (Rochester, NY) autoradiographic film Genomic DNA extraction and Southern blot analysis High molecular mass DNA was extracted and purified by standard techniques [42] from frog tissues (n ¼ per month) Genomic DNA extracted from muscle (10 lg) was digested with EcoRI, BamHI or HindIII (Fermentas GmbH) and analyzed by electrophoresis and Southern blot using a 780 bp frog fcnr1 DIG-labeled probe The probe was labeled by random priming, and hybridization was conducted at 50 °C using the DIG-High Prime DNA Labelling and Detection Starter Kit II (Roche), following the manufacturer’s instruction cnr1 ORF prediction from genomic sequences of several vertebrate mRNA folding analysis To assess the presence of nucleotide differences between cDNA and the corresponding genomic sequences in vertebrates, cnr1 cDNA sequences deposited in NCBI GenBank were blasted against the corresponding genomic database (see Table for details) Amino acid sequences were deduced from the corresponding genomic Prediction of the secondary structure of RNA and DNA was conducted by using mfold software, available at http://www.bioinfo.rpi.edu/applications/mfold/rna/form1.cgi [43,44] This analysis was restricted to the overlapping fragments of 1354 bp from testis mRNA, brain mRNA and genomic DNA 2918 FEBS Journal 274 (2007) 2909–2920 ª 2007 The Authors Journal compilation ª 2007 FEBS R Meccariello et al Cloning of cnr1 in frog Acknowledgements This work was supported by grants from PRIN-Pierantoni 2002 and 2005, Regione Campania L.5 13 References Mechoulam R (2002) Discovery of endocannabinoids and some random thoughts on their roles in neuroprotection and aggression Prostaglandins Leukot Essent Fatty Acids 66, 93–99 De Petrocellis L, Cascio MG & Di Marzo V (2004) The endocannabinoid system: a general view and latest additions Br J Pharmacol 141, 765–774 Okamoto Y, Morishita J, Tsuboi K, Tonai T & Ueda N (2004) Molecular characterization of a phospholipase D generating anandamide and its congeners J Biol Chem 279, 5298–5305 Galiegue S, Mary S, Marchand J, Dussossoy D, Carriere D, Carayon P, Bouaboula M, Shire D, Le Fur G & Casellas P (1995) Expression of central and peripheral cannabinoid receptors in human immune tissues and leukocyte subpopulations Eur J Biochem 232, 54–61 Shire D, Carillon C, Kaghad M, Calandra B, Rinaldi-Carmona M, Le Fur G, Caput D & Ferrara P (1995) An amino-terminal variant of the central cannabinoid receptor resulting from alternative splicing J Biol Chem 270, 3726–3731 Shire D, Calandra B, Rinaldi-Carmona M, Oustric D, Passegue B, Bonnin-Cabanne O, Le Fur G, Caput D & Ferrara P (1996) Molecular cloning, expression and function of the murine CB2 peripheral cannabinoid receptor Biochim Biophys Acta 1307, 132–136 Brown SM, Wager-Miller J & Mackie K (2002) Cloning and molecular characterization of the rat CB2 cannabinoid receptor Biochim Biophys Acta 1576, 255–264 Ryberg E, Vu HK, Larsson N, Groblewski T, Hjorth S, Elebring T, Sjogren S & Greasley PJ (2005) Identification and characterization of a novel splice variant of the human CB1 receptor FEBS Lett 57, 259–264 Wiley JL & Martin BR (2002) Cannabinoid pharmacology: implications for additional cannabinoid receptor subtypes Chem Phys Lipids 121, 57–63 ` 10 Elphick MR & Egertova M (2001) The neurobiology and evolution of cannabinoid signalling Philos Trans R Soc Lond B Biol Sci 356, 381–408 11 Yamaguchi F, Macrae AD & Brenner S (1996) Molecular cloning of two cannabinoid type 1-like receptor genes from the puffer fish Fugu rubripes Genomics 35, 603–605 12 Cottone E, Forno S, Campantico E, Guastalla A, Viltono L, Mackie K & Franzoni MF (2005) Expression and distribution of CB1 cannabinoid receptors in the 14 15 16 17 18 19 20 21 22 23 24 25 central nervous system of the African cichlid fish Pelvicachromis pulcher J Comp Neurol 485, 293–303 Valenti M, Cottone E, Martinez R, De Pedro N, Rubio M, Viveros MP, Franzoni MF, Delgrado MJ & Di Marzo V (2005) The endocannabinoid system in the brain of Carassius auratus and its possible role in the control of food intake J Neurochem 95, 662– 672 Soderstrom K, Leid M, Moore FL & Murray TF (2000) Behavioural, pharmacological, and molecular characterization of an amphibian cannabinoid receptor J Neurochem 75, 413–423 Cottone E, Salio C, Conrath M & Franzoni MF (2003) Xenopus laevis CB1 cannabinoid receptor: molecular cloning and mRNA distribution in the central nervous system J Comp Neurol 464, 487–496 Soderstrom K & Johnson F (2001) Zebra finch CB1 cannabinoid receptor pharmacology and in vivo and in vitro effects of activation J Pharmacol Exp Ther 297, 189–197 Elphick MR, Satou Y & Satoh N (2003) The invertebrate ancestry of endocannabinoid signalling: an orthologue of the vertebrate cannabinoid receptors in the urochordate Ciona intestinalis Gene 302, 95–101 Matias I, McPartland JM & Di Marzo V (2005) Occurrence and possible biological role of the endocannabinoid system in the sea squirt Ciona intestinalis J Neurochem 93, 1141–1156 Chang MK, Berkery D, Schuel R, Laychock SG, Zimmerman AM, Zimmerman S & Schuel H (1993) Evidence for a cannabinoid receptor in sea urchin sperm and its role in blockade of the acrosome reaction Mol Reprod Dev 36, 507–516 De Petrocellis L, Melck D, Bisogno T, Milone A & Di Marzo V (1999) Finding of the endocannabinoid signalling system in Hydra, a very primitive organism: possible role in the feeding response Neuroscience 92, 377–387 Salzet M & Stefano GB (2002) The endocannabinoid system in invertebrates Prostaglandins Leukot Essent Fatty Acids 66, 353–361 Matsuda LA, Lolait SJ, Brownstain MJ, Young AC & Bonner TI (1990) Localization of cannabinoid receptor mRNA in rat brain J Comp Neurol 346, 561–564 Mukhopadhyay S, Shim JY, Assi AA, Norford D & Howlett AC (2002) CB(1) cannabinoid receptor–G protein association: a possible mechanism for differential signalling Chem Phys Lipids 121, 91–109 Di Marzo V, De Petrocellis L, Fezza F, Ligresti A & Bisogno T (2002) Anandamide receptors Prostaglandins Leukot Essent Fatty Acids 66, 377–391 van der Stelt M, Trevisani M, Vellani V, De Petrocellis L, Schiano Morello A, Campi B, McNaughton P, Geppetti P & Di Marzo V (2005) Anandamide acts as FEBS Journal 274 (2007) 2909–2920 ª 2007 The Authors Journal compilation ª 2007 FEBS 2919 Cloning of cnr1 in frog 26 27 28 29 30 31 32 33 34 R Meccariello et al an intracellular messenger amplifying Ca(2+) influx via TRPV1 channels EMBO J 24, 3517–3528 Mackie K (2005) Cannabinoid receptor homo- and heterodimerization Life Sci 77, 1667–1673 Meccariello R, Chianese R, Cacciola G, Cobellis G, Pierantoni R & Fasano S (2006) Type-1 cannabinoid receptor expression in the frog, Rana esculenta, tissues: a possible involvement in the regulation of testicular activity Mol Reprod Dev 73, 551–558 Song ZH & Bonner TI (1996) A lysine residue of the cannabinoid receptor is critical for receptor recognition by several agonists but not WIN55212-2 Mol Pharmacol 49, 891–896 Chin CN, Lucas-Lenard J, Abadji V & Kendall DA (1998) Ligand binding and modulation of cyclic AMP levels depend on the chemical nature of residue 192 of the human cannabinoid receptor J Neurochem 70, 366–373 Garcia DE, Brown S, Hille B & Mackie K (1998) Protein kinase C disrupt cannabinoid action by phosphorylation of the CB1 cannabinoid receptor J Neurosci 18, 2834–2841 Abadji V, Lucas-Lenard JM, Chin C & Kendall DA (1999) Involvement of the carboxyl terminus of the third intracellular loop of the cannabinoid CB1 receptor in constitutive activation of Gs J Neurochem 72, 2032–2038 Jin W, Brown S, Roche JP, Hsieh C, Celver JP, Kovoor A, Chavkin C & Mackie K (1999) Distinct domains of the CB1 cannabinoid receptor mediate desensitization and internalization J Neurosci 19, 3773–3780 Hsieh C, Brown S, Derleth C & Mackie K (1999) Internalization and recycling of the CB1 cannabinoid receptor J Neurochem 73, 493–501 Abood ME, Ditto KE, Noel MA, Showalter VM & Tao Q (1997) Isolation and expression of a mouse CB1 cannabinoid receptor gene Biochem Pharmacol 53, 207–214 2920 35 Zhang PW, Ishiguro H, Ohtsuki T, Hess J, Carillo F, Walther D, Onaivi ES, Arinami T & Uhl GR (2004) Human cannabinoid receptor 1: 5¢exons, candidate regulatory regions, polymorphisms, haplotypes and association with poly-substance abuse Mol Psychiatry 9, 916–931 36 Chakrabarti B, Kent L, Suckling J, Bullmore E & Baron-Cohen S (2006) Variations in the human cannabinoid receptor (CNR1) gene modulate striatal responses to happy faces Eur J Neurosci 23, 1944–1948 37 Wedekind JE, Dance GSC, Sowden MP & Smith HC (2003) Messenger RNA editing in mammals: new members of the APOBEC family seeking roles in the family business Trends Genet 19, 207–216 38 Seeburg PH (2002) A-to-I editing: new and old sites, functions and speculations Neuron 35, 17–20 39 Blanc V & Davidson NO (2003) C-to-U RNA editing: mechanisms leading to genetic diversity J Biol Chem 278, 1395–1398 40 Seeburg PH & Hartner J (2003) Regulation of ion channel ⁄ neurotransmitter receptor function by RNA editing Curr Opin Neurobiol 13, 279–283 41 Duan J, Wainwright MS, Comeron JM, Saitou N, Sanders AR, Gelernter J & Gejman PV (2003) Synonymous mutations in the human dopamine receptor D2 (DRD2) affect mRNA stability and synthesis of the receptor Hum Mol Genet 12, 205–216 42 Sambrook J, Fritsch EF & Maniatis T (1989) Molecular Cloning: a Laboratory Manual, 2nd edn, pp 280–281 Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY 43 Zuker M (2003) Mfold web server for nucleic acid folding and hybridization prediction Nucleic Acids Res 31, 3406–3415 44 Mathews DH, Sabina J, Zuker M & Turner DH (1999) Expanded sequence dependence of thermodynamic parameters improves prediction of RNA secondary structure J Mol Biol 288, 911–940 FEBS Journal 274 (2007) 2909–2920 ª 2007 The Authors Journal compilation ª 2007 FEBS ... 64.9 68.2 62.6 76.6 81. 9 74.2 73 73.4 73.2 72.2 72.6 72.5 66.6 70.8 12 72 14 28 14 07 14 13 14 22 14 13 14 22 14 19 14 22 14 22 14 19 14 19 14 18 12 36 13 20 21. 5 70.7 73.9 61. 9 82.9 88 .1 84.4 82.2 83.3 83.3... CNR1 amino acid sequence of R esculenta (FCNR1) was compared with those of known CNR1s, revealing an amino acid identity ranging from 61. 9% to 88 .1% among vertebrates and of 21. 5% in C intestinalis... have been cloned and sequenced in mammals [10 ] Furthermore, cnr1 orthologs have been cloned and sequenced in fish [11 ? ?13 ], in urodele and anuran amphibians [14 ,15 ], and in birds [16 ] Reptilian species