Homologous expression of a bacterial phytochrome The cyanobacterium Fremyella diplosiphon incorporates biliverdin as a genuine, functional chromophore Benjamin Quest 1, *, Thomas Hu ¨ bschmann 2 , Shivani Sharda 1 , Nicole Tandeau de Marsac 3 and Wolfgang Ga ¨ rtner 1 1 Max-Planck-Institute for Bioinorganic Chemistry, Mu ¨ lheim, Germany 2 Institute for Biology, Humboldt-University, Berlin, Germany 3 Unite ´ des Cyanobacteries, De ´ partement de Microbiologie, Institut Pasteur (URA-CNRS 2172), Paris, France Keywords bacteriophytochrome; biliverdin IXa; photoreceptor; phycocyanobilin; two- component signal transduction Correspondence W. Ga ¨ rtner, Max-Planck-Institute for Bioinorganic Chemistry, Stiftstr. 34–36, D-45470 Mu ¨ lheim, Germany Fax: +49 208306 3951 Tel: +49 208306 3693 E-mail: gaertner@mpi-muelheim.mpg.de *Present address Institut de Biologie Structurale, Jean Pierre Ebel (UMR5075 CNRS-CEA-UJF), Grenoble, France (Received 5 October 2006, revised 17 January 2007, accepted 20 February 2007) doi:10.1111/j.1742-4658.2007.05751.x Bacteriophytochromes constitute a light-sensing subgroup of sensory kin- ases with a chromophore-binding motif in the N-terminal half and a C-ter- minally located histidine kinase activity. The cyanobacterium Fremyella diplosiphon (also designated Calothrix sp.) expresses two sequentially very similar bacteriophytochromes, cyanobacterial phytochrome A (CphA) and cyanobacterial phytochrome B (CphB). Cyanobacterial phytochrome A has the canonical cysteine residue, by which covalent chromophore attach- ment is accomplished in the same manner as in plant phytochromes; how- ever, its paralog cyanobacterial phytochrome B carries a leucine residue at that position. On the basis of in vitro experiments that showed, for both cyanobacterial phytochrome A and cyanobacterial phytochrome B, light- induced autophosphorylation and phosphate transfer to their cognate response regulator proteins RcpA and RcpB [Hu ¨ bschmann T, Jorissen HJMM, Bo ¨ rner T, Ga ¨ rtner W & deMarsac NT (2001) Eur J Biochem 268, 3383–3389], we aimed at the identification of a chromophore that is incor- porated in vivo into cyanobacterial phytochrome B within the cyanobacte- rial cell. The approach was based on the introduction of a copy of cphB into the cyanobacterium via triparental conjugation. The His-tagged puri- fied, recombinant protein (CphBcy) showed photoreversible absorption bands similar to those of plant and bacterial phytochromes, but with remarkably red-shifted maxima [k max 700 and 748 nm, red-absorbing (P r ) and far red-absorbing (P fr ) forms of phytochrome, respectively]. A com- parison of the absorption maxima with those of the heterologously gener- ated apoprotein, assembled with phycocyanobilin (k max 686 and 734 nm) or with biliverdin IXa (k max 700 and 750 ± 2 nm), shows biliverdin IXa to be a genuine chromophore. The kinase activity of CphB cy and phos- photransfer to its cognate response regulator was found to be strictly P r -dependent. As an N-terminally located cysteine was found as an alternative covalent binding site for several bacteriophytochrome photore- ceptors that bind biliverdin and lack the canonical cysteine residue (e.g. Agrobacterium tumefaciens and Deinococcus radiodurans), this correspond- ing residue in heterologously expressed cyanobacterial phytochrome B was mutated into a serine (C24S); however, there was no change in its spectral Abbreviations BphP, bacteriophytochrome photoreceptor; BV, biliverdin; Cph, cyanobacterial phytochrome; CphBcy, CphB from homologous expression in Fremyella diplosiphon SF 33; PCB, phycocyanobilin; PEB, phycoerythrobilin; PFB, phytochromobilin. 2088 FEBS Journal 274 (2007) 2088–2098 ª 2007 The Authors Journal compilation ª 2007 FEBS Sensing of light quality is of paramount importance for all photosynthetic organisms. Higher and lower plants employ phytochromes [1] for determining the quality, quantity and direction of light in the long- wavelength range. The recent finding of phytochrome- like chromoproteins in phototrophic [2] and even heterotrophic [3,4] bacteria has extended the occur- rence and utilization of this efficient photoreceptor sys- tem into the prokaryotic phylum. Besides the sequence similarities to plant phytochromes in the N-terminal half, many of the bacteriophytochrome photoreceptors (BphPs) so far identified exhibit a histidine kinase activity in their C-terminal half. Typically, the BphP- encoding genes form an operon together with genes encoding their cognate response regulators, thus add- ing light as a trigger to the bacterial two-component signal transduction [5,6]. However, the finding of pro- karyotic phytochromes has not only extended the vari- ation in protein sequences, but has also shown a greater variety in the chromophores employed in these photoreceptors, and also in the type of chromophore binding. The first BphP identified, cyanobacterial phyto- chrome (Cph) 1 from Synechocystis PCC6803, is fur- nished in vivo with phycocyanobilin (PCB), and in vitro is able to bind the open-chain tetrapyrroles phytochro- mobilin (PFB), PCB and phycoerythrobilin (PEB) in a covalent manner via a thioether linkage to a cysteine residue, identical to that found in plant phytochromes. Also, it undergoes light-induced reactions similar to those undergone by the phytochromes [7,8]. Homologs of Cph1 have been found in a number of other cyano- bacteria [9], e.g. Calothrix PCC7601 [10] and Anabaena PCC7120, and also in proteobacteria s uch a s Deinococcus radiodurans, Pseudomonas aeruginosa [3,11] and Agro- bacterium tumefaciens [12–14]. Interestingly, these proteobacterial BphPs all lack the plant phytochrome- specific cysteine in the chromophore-binding domain, and make use of another cysteine residue, located at the N-terminal end within the first 30 amino acids, to bind covalently biliverdin (BV) IXa as chromophore. This unusual type of binding was confirmed by a recently presented three-dimensional structure of the GAF-PHY domain of D. radiodurans [15]. Evidence for a light-modulated phosphorelay between histidine kinase and a response regulator was first found for Cph1 [16], and this was also demonstra- ted for heterologously expressed CphA and CphB, after they had been assembled with tetrapyrrole chromo- phores. They undergo red ⁄ far-red light-modulated auto- phosphorylation in a similar fashion to Cph1, and perform remarkably selective transphosphorylation to their cognate response regulators, RcpA and RcpB [17]. The finding of two bacteriophytochromes in one organism, Calothrix PCC7601 [9,10], caused some con- fusion in our understanding of this novel group of prokaryotic photoreceptors, in particular because only CphA carries the canonical cysteine residue that, ana- logously to plant phytochromes, accomplishes covalent binding of the tetrapyrrole chromophore by formation of a thioether linkage. CphB, instead, has a leucine at that position (Fig. 1C). This exchange (leucine instead of cysteine) apparently prevents CphB from covalently binding the chromophore (in the phytochrome-typical fashion; Fig. 1A); however, incubation of CphB with tetrapyrrole chromophores, e.g. PCB, generated photo- chemically active chromoproteins reminiscent of the plant phytochromes, but with slightly red-shifted absorption maxima [10]. Even more surprisingly, the replacement of only that particular leucine residue of CphB by a cysteine yielded a covalently binding BphP with spectral properties very similar to those of its paralog, CphA [10]. Like the above-mentioned BphPs, CphB also has a cysteine at position 24, which would be able to bind BV. However, we showed recently that in chromophore competition experiments, heterologously expressed apo-CphB binds BV very tightly and with preference over PCB, but could be expelled from the binding site upon extended incubation with PCB [18]. The various chromophores that have been identified in prokaryote phytochromes and the different types of binding or incorporation led us to investigate which chromophore is incorporated in vivo. The homologous expression of Cph1 [19] has revealed that Synechocystis furnishes this protein with PCB, and this most prob- ably also holds true for the closely related CphA from Calothrix. Up to now, however, no BphP lacking the canonical cysteine as the chromophore attachment site has been homologously expressed in its genuine host organism. Here, we describe the first expression and isolation of such a bacteriophytochrome, CphB, in Calothrix PCC7601, its photochemistry, and its light- induced kinase activity. The homologous expression was of particular interest, as Calothrix synthesizes large properties. On the other hand, the mutation of His267, which is located directly after the canonical cysteine, into alanine (H267A), caused com- plete loss of the capability of cyanobacterial phytochrome B to form a chromoprotein. B. Quest et al. Homologously expressed bacteriophytochrome FEBS Journal 274 (2007) 2088–2098 ª 2007 The Authors Journal compilation ª 2007 FEBS 2089 amounts of PCB (and PEB) for its light-harvesting complexes, in which process BV appears as only a transient intermediate at much lower concentrations. Results Homologous expression of cphB The cyanobacterium Calothrix PCC7601 expresses two bacteriophytochromes, CphA and CphB [9]. Whereas CphA binds bilin chromophores (PCB and P FB) in a covalent, phytochrome-typical manner via a thioether linkage with a cysteine residue of the protein, this essential amino acid is replaced in CphB by a leucine. In vitro, heterologously expressed apo-CphB is able to form photochemically active complexes with PCB and also with BV IXa [28]. As both of these tetrapyrroles, and also PEB, are present in the cyanobacterium, it was of interest to determine which chromophore is added to the apoprotein by the cyanobacterial cell. The cphB gene was furnished with an oligonucleotide providing a His6-tag at its 5¢-end, and was cloned under the control of the tac promoter (plasmid pPL9b; see Experimental procedures). The plasmid pPL9b was transferred to Fremyella diplosiphon SF33, by triparen- tal conjugation. The cyanobacteria were grown in a 12 L fermenter, and yielded, after 5 days, 15 g of cell pellet (wet weight), from which  3 mg of CphBcy could be purified via affinity chromatography, followed by a gel filtration step. When purified, CphBcy was subjected to Zn-gel elec- trophoresis. The protein showed a strong fluorescence in the molecular mass range of the holoprotein (molecular mass  87 kDa; Fig. 2, right panel). The comigration of the chromophore-induced fluorescence is evidence for a covalently bound tetrapyrrole. The heterologously expressed apo-CphB, assembled with PCB, does not show the Zn-induced fluorescence after the purification (data not shown). The lower affinity of apo-CphB for PCB has been formerly observed during affinity purification of CphB–PCB adducts [28] and recently confirmed by competition experiments [18]. The purified holoprotein showed an absorption band at 700 nm that could be converted by irradiation into an even further red-shifted absorption band at 748 nm (Fig. 2). This photochemistry could be repeated several times without any loss of absorption. A comparison of Fig. 2. Absorption and absorption difference spectra (P r ) P fr )of CphBcy from homologous expression in F. diplosiphon SF33. Inset: Comparison of CphBcy with CphB from heterologous expression, assembled with BV. Coomassie-stained Scha ¨ gger-PAGE and Zn-gel of CphBcy are also shown. A B C Fig. 1. (A) Covalent attachment of PCB to a cysteine residue of an apophytochrome. The photochemistry of phytochromes (Z fi E photoisomerization of the methine bridge between rings C and D) is also indicated. The protonated state of the chromophore in the pro- tein-bound form has been demonstrated by resonance Raman spectroscopy [33]. (B) Structures of tetrapyrrole compounds (in nonprotein-bound form) serving as chromophores in phyto- chromes (PFB, phytochromobilin; BV, biliverdin IXa). Note that (a) BV has one additional double bond in the A-ring as compared to the other chromophores, and (b) one double bond ) of the 3¢-ethylidene substituent ) is lost upon covalent attachment to the protein via thioether linkage formation in PCB and PFB. (C) Sequence comparison of representative bacteriophytochromes in the region of the chromophore-binding site (Cph1 from Synechocys- tis PCC6803; CphA and CphB from Calothrix PCC7601; AphA ⁄ B from Anabaena PCC7120; Bph1 from Deinococcus radiodurans; and BphP from Pseudomonas aeruginosa). Sequences of Arabidopsis thaliana PhyA and PhyB have been added to demonstrate the simi- larity to plant phytochromes. The arrowhead indicates the position of covalent binding in the case of a cysteine residue being present. Homologously expressed bacteriophytochrome B. Quest et al. 2090 FEBS Journal 274 (2007) 2088–2098 ª 2007 The Authors Journal compilation ª 2007 FEBS these absorption maxima with heterologously exp- ressed apo-CphB, incubated with either PCB or BV IXa, gave practically complete agreement with the absorption of the BV IXa adduct [BV IXa adduct, k max ¼ 702 nm and 754 nm, red-absorbing (P r ) and far red-absorbing (P fr ) form of phytochrome, respectively; PCB adduct: k max ¼ 686 nm and 734 nm, P r and P fr ]. As also seen for heterologously expressed CphB [18], the photochemically generated P fr form of CphBcy exhibited remarkable thermal stability when kept in darkness at ambient temperature. A fraction of only 25% of CphBcy-P fr converted back to P r within 2 days. Excess PCB added to CphBcy–BV adduct did not alter its spectroscopic properties (data not shown). Identification of CphBcy by HPLC and MS CphBcy was unambiguously identified by MALDI-TOF MS after SDS ⁄ PAGE, excision of the band from the gel, and tryptic digestion. The peptide mixture of a tryptic digest of purified CphBcy represented 95% of all theoretically predicted peptides. Among these, the peptide spanning the putative chromophore-binding site (positions 262–277 with the conserved histidine at position 267) could also be identified in the MS analysis; however, no peptide with a bound chromo- phore was detected. When the tryptic digestion mixture was subjected to LC-MS analysis, the inspection of the LC trace (chromatographic separation precedes MS identification) revealed three peaks with similarly strong absorptions at k max ¼ 370 and 680 nm (elution times 17.03 min and, for the double peak, 17.72 min), indicat- ive of the presence of a peptide with a bound chromo- phore (Fig. 3). None of these peaks matched the retention time of a free chromophore control sample. Subsequently, one of these peaks was identified by MS analysis as the above-mentioned putative chromo- peptide, although without its chromophore. We fur- thermore observed that the free chromophore is not detected by MS analysis; thus, we conclude that the bound ⁄ incorporated BV IXa molecule remains attached to the peptide during the tryptic digest and the LC, but is apparently lost during the conditions of MS analysis. Light-induced autophosphorylation and transphosphorylation of CphBcy As previously reported for the heterologously expressed CphB [17], the homologously expressed CphBcy was 280 nm 17.03 17.72 19.13 100 % 0 100 % 0 250 300 350 400 450 500 550 600 650 700 750 800 nm 15.00 CphBcy peptide at 17.750 min diode array spectrum 280 375 688 15.50 16.00 16.50 17.00 17.50 18.00 18.50 19.00 19.50 20.00 20.50 21.00 Time (min) 680 nm Fig. 3. MS identification of chromopeptide from CphBcy after tryptic digestion and HPLC separation. B. Quest et al. Homologously expressed bacteriophytochrome FEBS Journal 274 (2007) 2088–2098 ª 2007 The Authors Journal compilation ª 2007 FEBS 2091 subjected to light-induced autophosphorylation and phosphotransfer to its cognate response regulator RcpB. Phosphorylation of CphBcy, after it had been converted into the P r or the P fr form and then incuba- ted in the dark with ATP, took place relatively slowly and was complete after 40–60 min, when the auto- phosphorylation reached a plateau (Fig. 4, left). The kinase activity of the P r form of CphBcy was clearly stronger than the activity of the P fr form, which reached, maximally, 20% of that of the P r form. Tak- ing into account the maximal conversion of P r into P fr of  70%, due to the partial overlap of their absorp- tion spectra, it is concluded that the P r form is selec- tively active in CphBcy, and that the residual kinase activity of the P fr form can be ascribed to the amount of P r left in the irradiation mixture. When the response regulator RcpB was added to the maximally phosphory- lated CphBcy, a nearly immediate phosphate transfer took place (Fig. 4, right). The transphosphorylation reaction driven from the P r form of CphBcy was twice as high as the transphosphorylation driven from the P fr form of CphBcy, indicating that both the autophos- phorylation and the transphosphorylation reactions are P r -dependent processes. Heterologously expressed mutated CphB The recently identified BphPs from A. tumefaciens, Agp1 [4,7] and from D. radiodurans, DrBphP [3,11], were reported to carry BV as chromophore, covalently bound to an N-terminally located cysteine (position 20 in Agp1, and position 24 in DrBphP). We investigated a putative role of this amino acid in the chromophore- binding capacity of CphB, which also carries an N-ter- minally located cysteine mutated into a serine (C24S). This in vitro expressed mutated protein, when incuba- ted with BV, showed identical absorption properties to the wild-type CphBm (spectra not shown), indicating that this position is of no importance for the forma- tion of the CphB chromoprotein. Inspection of phytochrome sequences reveals, besides the presence of a chromophore-binding cys- teine residue in the GAF domain, a highly conserved histidine, directly after the canonical chromophore- binding position. This residue, H267 in CphB, was mutated into alanine (H267A). After the addition of PCB to the heterologously expressed, purified apopro- tein CphB-H267A, no photochemically active bacterio- phytochrome was obtained (Fig. 5). However, a slightly visible shoulder at around 700 nm indicates a very weak interaction of PCB with CphBm-H267A (Fig. 5, inset). Upon assembly with BV in the dark, the broad unstructured absorption band of free chro- mophore (BV and t 0 in Fig. 6) slowly converted into a structured P r -like absorption band around 700 nm within 36 min. This absorption was lost upon red light illumination (Fig. 6), and could not be restored either by illumination with far-red light or by pro- longed incubation in the dark (data not shown). Thus, we conclude that the histidine residue is of utmost importance for chromophore incorporation and the maintenance of the spectral properties of CphB. Fig. 5. CphBm H267A assembled with a 2.5 molar excess of PCB and PCB control sample. Inset: Zoom of the region 625–775 nm. The arrow highlights the observed shoulder of the initial dark- assembled PCB adduct. A B Fig. 4. Autophosphorylation of CphBcy and transphosphorylation to its cognate response regulator RcpB. (A) Kinetics of autophosphory- lation (left) and the corresponding blot (right). The arrow indicates the addition of RcpB to the autophosphorylation reaction. (B) Kinet- ics of transphosphorylation from CphBcy to RcpB (left) and the cor- responding blot (right). Homologously expressed bacteriophytochrome B. Quest et al. 2092 FEBS Journal 274 (2007) 2088–2098 ª 2007 The Authors Journal compilation ª 2007 FEBS Discussion The identification of phytochrome-like photoreceptors (BphPs) in many bacterial and cyanobacterial species has not only extended the occurrence of bilin-based light perception into the prokaryote kingdom, but has also shed light on the many stimuli of the two- component signal transduction pathways. The finding of genes encoding BphPs with strong sequence simi- larities to phytochromes, but without the covalently binding cysteine in the GAF domain [3], raised the question of whether a different type of chromophore and ⁄ or a different binding mechanism occurred in these proteins. Whereas for D. radiodurans and A. tumefaciens, covalent attachment of BV via its 3¢-position has been confirmed, CphB from Calothrix appears to be an exception to all other phytochromes described so far. Although it shows all the features of an interaction with BV, i.e. the lack of the canon- ical cysteine and the presence of an alternative cys- teine residue within the first 30 amino acids at its N-terminus, noncovalent binding was proposed on the basis of competition between PCB and BV [18]. In fact, the data on the C24S mutant, presented here, demonstrate that the overall shape of the protein cavity is already sufficient to incorporate a tetrapyrrole and to allow photochemistry. Because, for heterolo- gously expressed CphB, binding of both PCB and BV IXa has been reported [10], the nature of the native chromophore incorporated by the cyanobacte- rial cell was addressed in this work. Up to now, BphPs employing BV IXa as a chromophore have been exclusively found in bacteria with a heme oxyg- enase gene as the only enzyme of chromophore syn- thesis, as reported for Bph1 from D. radiodurans [11] and Agp1 from A. tumefaciens [12]. Thus, the identification of the native CphB chromophore was of particular interest, as Calothrix generates PCB (as a reduction product of BV IXa) in large quantities to equip cells with their light antennae, the phycobili- somes. The expression ⁄ purification of CphB from F. diplo- siphon SF33 yielded a chromoprotein (CphBcy) with spectral properties virtually indistinguishable from those of the heterologously expressed, BV IXa-assem- bled protein. Although the peptide covering the chro- mophore-binding region lost the chromophore during the MS analysis, the assignment of BV IXa as a chromophore is straightforward. The first line of evi- dence arises from the detection of a chromopeptide in the HPLC separation that matches the spectral properties of a peptide-attached tetrapyrrole (in addi- tion, the MS analysis of this peak revealed the expec- ted molecular mass for the peptide containing the putative chromophore-binding site; the finding of more than one peptide with chromophore absorption might be due to incomplete digestion or mechanical cleavage of peptide bonds). The second line of evi- dence arises from the high affinity of CphB for BV. In contrast to the CphBm–PCB adduct, which relea- ses the chromophore during purification, no loss of chromophore was detected for CphBcy; however, chromophore exchange (BV versus PCB and vice versa) has been shown to be possible [18]. Further- more, the tight interaction between BV IXa and apo- CphBcy, allowing Zn-mediated fluorescence (which is not seen with the CphB–PCB adduct), and the stabil- ity of the BV adduct against an excess of PCB, are both indicative of the fact that PCB cannot be the chromophore of CphBcy. Accordingly, we recently showed that BV is able to actively replace PCB in the binding pocket of CphB [18]. As an additional argument, the absorption properties of CphBcy match the spectra of the heterologously expressed protein assembled with BV, not only in the position of the absorption maxima, but also in the shape of the P r and P fr forms. Slight differences in the positions of the absorption maxima of homologously versus heterologously expressed BphPs like those observed with CphBcy (maximum variations of 2 nm were observed) were also reported for Cph1 from Synechocystis [19]. In particular, the positions of the absorption max- ima provide a clear indication of the type of chromo- phore–protein interaction, when we take into account that covalent binding of a 3-ethylidene-substituted tetrapyrrole (such as PCB) leads to the loss of one double bond (3–3¢) due to the formation of a thio- ether linkage to the protein. This effect has recently Fig. 6. Assembly kinetics and subsequent red light illumination of CphBm H267A assembled with a 2.5 molar excess of BV and BV control sample. B. Quest et al. Homologously expressed bacteriophytochrome FEBS Journal 274 (2007) 2088–2098 ª 2007 The Authors Journal compilation ª 2007 FEBS 2093 been demonstrated by comparing the absorption max- ima of the noncovalently bound PCB adduct of CphB (k max : 686 and 734 nm for P r and P fr , respectively [10]) with those of the L266C mutant of CphB that binds PCB covalently (k max : 656 and 702 nm), and with those of the BV IXa adduct of CphB (702 and 754 nm). This mutation (L266C), which enables cova- lent binding of PCB with removal of the 3–3¢ double bond in the chromophore, is sufficient to convert the binding mode of CphB into that of Cph1 or CphA (cf. k max of CphA: 663 and 710 nm for P r and P fr , respectively). Moreover, the spectral shift of the L266C mutant is only observed when PCB is used for the in vitro assembly, and not in the case of BV, which retains practically unchanged absorption max- ima, irrespective of whether the wild-type or the mutated apo-protein is used [18]. Also, in BV-binding proteins a double bond (3¢)3¢ of the vinyl group) is lost during covalent bond formation, and this should also lead to a less red-shifted absorption than observed. This unexpected result, however, is pro- posed to be due to a rearrangement of double bonds in BV upon covalent binding, in accordance with a more detailed inspection of the D. radiodurans BphP crystal structure (K. Forest, personal communication). Such a rearrangement (Fig. 7) changes the hybridiza- tion of C 2 into sp 3 in accordance with the electron density of the crystal structure, and converts the A-ring of bound BV into a PCB-like structure, now with an ethylidene substituent. In addition, this type of binding is reversible, explaining the observation that a bound BV can be expelled from the binding site by an excess of PCB [18]. The ability of CphB to incorporate BV noncovalently (C24S mutant) places it between these two classes of phytochromes, and the mutation demonstrates that C24 is not necessary for the formation of the photo- receptor complex, as has been shown by us for other phytochromes [28]. An inspection of the three-dimen- sional structure of D. radiodurans does not reveal any other appropriately located cysteine that would allow a similar conformation of a bound chromophore. The observed preferred binding of BV to CphB, although PCB is synthesized in the cyanobacterial cell in large quantities, is an interesting ability of Calothrix that allows adjustment of the spectral sensitivity through the use of two related photoreceptors. This selection, of course, can only be employed on the basis of an additional photoreceptor (CphB) that binds BV and provides a bathochromically shifted absorption. It should be noted that although the demonstration of light-induced phosphorylation of both phytochromes from Calothrix, which differ in their absorption max- ima by  50 nm, represents a simple color discrimin- ation system, there is, as yet, no evidence for a physiologic role. The loss of chromophore incorporation upon muta- tion of H267 reveals a very important role for this residue for both PCB-binding and BV-binding phytochromes. Inspection of the crystal structure of D. radiodurans phytochrome indicates interactions with the chromophore (via hydrogen bonding to the pro- pionate group of ring C), which can be assumed to have a stabilizing effect on the extended conformation that the chromophore adopts in the binding site (in contrast to the helically coiled conformation in organic solvents [29]). This mutation has been reported to prevent chro- mophore binding in Bph1 [3], in oat phytochrome [30], and in CphB (this study) and CphA (B. Quest, unpub- lished results). In addition, this histidine might also be important for the assembly process itself, as has been demonstrated by addition of imidazole to the incuba- tion mixture [18]. On the other hand, recent studies have shown that in Cph1 also, a glutamine residue at that position is sufficient for the spectral properties of this cyanobacterial phytochrome [31]; these authors demonstrate, moreover, that a major contribution of this histidine (260 in Cph1) is the stabilization of the protonated state of the chromophore (H260Q shows strong pH dependence in its absorption properties). The homologously expressed protein showed an even more pronounced phosphorylation capability origin- ating from the P r form than the heterologously expressed protein, and reacted in a precise manner with its cognate response regulator, as shown by the crystal structures of the response regulators RcpA and RcpB [32]. The physiologic relevance of this signal transduction pathway, which leads to phosphorylation of the response regulator under conditions of either continuous far-red light irradiation or continuous Fig. 7. Proposed double bond rearrange- ment during covalent binding of BV. Note that this binding is reversible. Homologously expressed bacteriophytochrome B. Quest et al. 2094 FEBS Journal 274 (2007) 2088–2098 ª 2007 The Authors Journal compilation ª 2007 FEBS darkness after assembly of CphB in the dark, will be the subject of future work. Experimental procedures Cyanobacterial strains and culture media Fremyella diplosiphon strain SF33 is a hormogonium-defici- ent mutant of F. diplosiphon UTEX 481 (also designated Calothrix PCC7601) [20,21] that grows as short filaments and is easier to use for genetic studies than the wild-type strain. Cyanobacteria were routinely maintained in liquid medium BG-11 [20] or on solid medium GN (BG-11 med- ium containing 0.38 mm Na 2 CO 3 ), at 30 °C under a photo- synthetic photon flux density of 6–7 lEÆm )2 Æs )1 for conditions without a gas supply, and 20–35 lEÆm )2 Æs )1 for growth with a gas supply provided by Sylvania (Osram, Munich, Germany) GRO-Lux 18 W fluorescent lamps. Cloning cphB was amplified from previously described constructs [10] using the following primers: oBQ35, 5¢- CATATGACGAA TTGCCATCGCGAACC-3¢; and oBQ36, 5¢- GGATCCTTA TTTGACCTCCTGCAATGTGAAATAG-3¢ (restriction sites are underlined, and start and stop codons are given in bold). The PCR product was then cloned in vector pET28a(+) (Novagen ⁄ Merck, Darmstadt, Germany) between the NdeI and BamHI sites located downstream of the nucleotide sequence providing the N-terminal His-tag sequence. The T7 promoter, present in the vector, was replaced by a tac pro- moter that was amplified from vector pGEX-4T-1 (Pharma- cia Biotech ⁄ GE Freiburg, Germany) using the following primers: oBQ60, 5¢- GGGCCCTGCACGGTGCACCAA TGC-3¢; and oBQ61, 5¢- CCATGGATACTGTTTCCTGTG TGA-3¢. The resulting PCR fragment was cloned between the ApaI and NcoI sites, thereby removing half of the 5¢ nuc- leotide sequence of the lacI repressor gene of pET28a(+). After removal of the BamHI site of this construct by diges- tion, Klenow fill-in and religation, the DNA fragment carry- ing the tac promoter, the cloned gene and the T7 terminator was subcloned into the single BamHI site of the vector pPL2.8 using the following primers: oBQ88, 5¢-CG GGA TCCTGCACGGTGCACCAATGCTTC-3¢; and oBQ89, 5¢-AC GGATCCAAAAAACCCCTCAAGACCCG-3¢. pPL2.8 is a derivative of pPL2.7 [22], generated by EcoRI digestion, Klenow fill-in, and religation. The resulting construct was termed pPL9b. CphBm was amplified from genomic DNA from PCC7601 using primers oBQ146 (5¢-TATA CCATGG GCTTAAGTCCTGAAAATTCTCCAG-3¢) and oBQ147 (5¢-AAA CTCGAGCCGGCCCTCAATTTTGACCTCCTGC AATGTGAAATAGAACG-3¢), and cloned between the NcoI and XhoI sites into pET28a(+), providing a His-tag in the C-terminus of the recombinant protein. Generation of site-directed mutations The C24S and H267A mutations were generated with the QuickChange site-directed mutagenesis kit (Stratagene- Europe, Amsterdam, the Netherlands), according to the instructions of the manufacturer. Generation of the C24S mutant was performed with the following primers: CphBm C24S-sen, 5¢-GAGGTGGACTTGACGAAT TCAGATCGCG AACCAATTCA C-3¢, and CphBm C24S-antisense 5¢-GTGAA TTGGTTCGCGATC TGAATTCGTCAAGTCCACCTC-3¢. The primers used for H267A were: oBQ144-2, 5¢-CACT CGGTACTCCGCAGCGTTTCGCCGTTA RCCATTGAA TATTTGCACAATATGG-3¢ (R ¼ purine); and oBQ145-2, 5¢-CCATATTGTGCAAATATTCAATG GYTAACGGCG AAACGCTGCGGAGTACCGAGTG-3¢ (Y ¼ pyrimidine). The differences from the wild-type sequence are indicated. The mutations were identified and verified by sequencing. Conjugal transfer of DNA to cyanobacteria DNA was transferred to F. diplosiphon cells by means of a triparental conjugation system as previously described [23], with minor changes. The cargo strain containing the plasmid of interest was Epicurian coli XL1 blue MR (Stratagene- Europe); the conjugal strain, bearing the RP4 plasmid [24] necessary for conjugal transfer, was Escherichia coli J53. Mil- lipore HATF nitrocellulose filters were used for conjugation, and the cell mixtures were spotted in different cyanobac- teria ⁄ conjugal strain ⁄ cargo strain ratios. The filters were incubated under a photosynthetic photon flux density of 6–7 lEÆm )2 Æs )1 for 48 h on GN plates supplemented with 5% (v ⁄ v) LB medium, and subsequently transferred to GN plates containing 25 lgÆmL )1 neomycin. Homologous expression Cyanobacterial cells carrying plasmid pPL9b were grown in BG-11 medium [20] supplemented with 25 lgÆmL )1 neo- mycin. Phosphate buffer (5 mm, pH 7.4) was added to the fermenter cultivation (Braun, Melsungen, Germany, 880 137 ⁄ 1, culture volume of 12 L). All cyanobacterial cul- tures were incubated at 30 °C under a photosynthetic pho- ton flux density between 20 and 35 lEÆm )2 Æs )1 (GROLUX F18W ⁄ GRO fluorescent white light tubes, Osram). For the homologous expression of CphB in F. diplosiphon (CphBcy), the fermenter was inoculated with a 1 L precul- ture (D 750  0.8). The doubling time was approximately 20 h. Cells were harvested at a D 750 of around 0.8 by cen- trifugation (6000 g, 10 min, 4 °C, Avanti centrifuge with JA10 rotor, Beckman-Coulter, Fullerton, CA, USA). Prior to cell breakage by a French Pressure Cell (Aminco, 1100 lbÆin )2 ) in NaCl ⁄ Tris buffer (supplied with protease inhibitor cocktail, EDTA-free, Boehringer, Mannheim, Germany), the cyanobacterial cells were washed several B. Quest et al. Homologously expressed bacteriophytochrome FEBS Journal 274 (2007) 2088–2098 ª 2007 The Authors Journal compilation ª 2007 FEBS 2095 times with BG-11 to remove residual E. coli cells from the conjugation mixture. Heterologous expression The heterologous expression of CphBm and RcpB in BL21DE3 RIL (Stratagene-Europe) was carried out as pre- viously described [18]. In brief, the expression was carried out in TB medium at 18–20 °C for 16–20 h after induction with 0.4 mm isopropyl-thio-b-d-galactoside. The amount of soluble photoactive CphBm was thereby increased 30-fold in comparison to the expression system described previously [10]. Typical yields reached approximately 6 mg of purified protein per liter of culture. Protein purification After cell breakage, cellular debris was removed by ultracen- trifugation (150 000 g, 1 h, 4 °C, LX80 XP centrifuge with Ti60 rotor, Beckman-Coulter). For cyanobacterial prepara- tions, one spatula of streptomycin sulfate was added to the supernatant prior to the centrifugation to remove chloro- phyll-containing microvesicles. Centrifugation with strepto- mycin sulfate was repeated up to three times. Holo-CphBcy and Apo-CphBm were purified with Ni–nitrilotriacetic acid superflow affinity resin (Qiagen, Hilden, Germany) and sub- sequent gel filtration on a 16 ⁄ 60 Superdex 200 preparative grade column (Pharmacia ⁄ GE, Freiburg, Germany), using A ¨ kta FPLC systems. RcpB was purified to homogeneity by affinity purification on Ni-nitrilotriacetic acid superflow resins and gel filtration on a 26 ⁄ 60 Superdex 75 preparative grade column. Proteins were analyzed by SDS ⁄ PAGE fol- lowing the protocol of Scha ¨ gger & Jagow [25], and stored at 4 °C in NaCl ⁄ Tris buffer (50 mm Tris ⁄ HCl, pH 8.0, 150 mm NaCl), including 1 mm dithiothreitol, until further use. Visualization of chromoproteins via Zn-fluorescence Zn-gel electrophoresis was performed as previously des- cribed [26]. In brief, 1 mm Zn acetate was added to all solu- tions of a standard SDS ⁄ PAGE. The gels were placed on a UV-transilluminator, and images were recorded with integ- ration times between 2 and 4 s. Assembly of recombinant chromoproteins, determination of absorption and difference absorption spectra, and measurement of P fr stability For the assembly of heterologously expressed CphBm in the wild-type, mutated or truncated form, with BV or PCB, the apoprotein was incubated in the dark with a 2.5-fold molar excess of BV or PCB, respectively. The molar extinction coefficients of the chromophores in NaCl ⁄ Tris buffer (BV e 674 ¼ 13 000 m )1 Æcm )1 , PCB e 610 ¼ 16 000 m )1 Æcm )1 ) were taken from Lindner et al. [27]. The fully assembled chromoproteins were subjected to repeated red ⁄ far-red illumination. Interference filters at 636 ± 9 nm and 730 ± 12 nm were used to generate the P fr and the P r forms of the PCB adducts, respectively, and for the BV adducts and for CphBcy, filters at 680 ± 8 nm and 788 ± 11 nm were used. The probes were illuminated with the stated light qualities, until no further absorption chan- ges occurred. Absorption spectra were recorded with a Shimadzu (Duisburg, Germany) UV-2401 PC spectropho- tometer. All samples were measured at 15 °C. For the determination of the thermal stability of the P fr form of CphBcy, the samples were irradiated with a saturating red light pulse, and the conversion back to P r was followed by UV-visible spectroscopy. Between the successive recordings of absorption spectra (from 260 to 820 nm), the samples were protected against the measuring light of the spectro- photometer. The absence of secondary photochemistry was confirmed by several consecutive measurements. Phosphorylation of CphBcy and transphosphorylation to RcpB Autophosphorylation and phosphotransfer were carried out as previously described [17]. In brief, a single reaction con- tained 3 lg of CphBcy for the autophosphorylation, or 3 lg of CphBcy and 0.75 lg of RcpB for the phosphotrans- fer reactions. The reactions were carried out in phospho- transfer buffer containing 50 mm Tris ⁄ HCl (pH 7.8), 50 mm KCl, 1 mm dithiothreitol, 0.5 mm MgCl 2 ,10lm unlabeled ATP, and 0.2 lm [ 32 P]ATP[cP] (110 TBqÆmmol )1 ) (Hartmann Analytik, Braunschweig, Germany). The reac- tion volume was 15 lL. Reactions were started by the addi- tion of [ 32 P]ATP[cP], and terminated at given time points by adding 5 lL of SDS stop buffer (250 mm Tris ⁄ HCl, pH 6.8, 15 mm EDTA, 30% v ⁄ v glycerol, 11% w ⁄ v SDS, 10% v ⁄ v 2-mercaptoethanol, 0.02% w ⁄ v bromophenol blue) and incubating for 5 min at 50 °C. Phosphotransfer was initiated by adding 15 lL of the autophosphorylation reaction mixture to 0.75 lg of RcpB, dissolved in 3 lLof phosphotransfer buffer without ATP. All reactions were performed at room temperature. The 32 P-labeled products were separated by SDS ⁄ PAGE (12.5%, La ¨ mmli) and trans- ferred to poly(vinylidene difluoride) membranes (Pharma- cia). The membranes were dried and quantified using a GS-525 PhosphorImager (Bio-Rad, Munich, Germany). MALDI-TOF MS Samples were excised from a Coomassie-stained gel and washed three times alternately in 50% acetonitrile and 50 mm ammonium bicarbonate. Destained samples were Homologously expressed bacteriophytochrome B. Quest et al. 2096 FEBS Journal 274 (2007) 2088–2098 ª 2007 The Authors Journal compilation ª 2007 FEBS processed by incubation at 56 °C in ammonium bicarbon- ate+10mm dithiothreitol for 45 min followed by incuba- tion in ammonium bicarbonate + 55 mm iodoacetamide for 30 min and an initial washing cycle. For tryptic digests of CphBcy, protein ⁄ protease mixtures (40 : 1, w ⁄ w) were incubated in NaCl ⁄ Tris + 1 mm CaCl 2 at 37 °C overnight. Digested samples were analyzed on a Maldi Reflex III (Bruker-Daltonik, Bremen, Germany). LC-MS Digested samples were separated with a Waters (Milford, MA, USA) Symmetry C18 column (5 lm; 0.32 · 150 mm) on a Waters CAP-LC, supplied with a photodiode array detector (eluent A, 0.025% v ⁄ v trifluoroacetic acid in H 2 O; eluent B, 0.02% v ⁄ v trifluoroacetic acid in acetonitrile; gra- dients, 5 min 5% v ⁄ v B, from 5% to 45% v ⁄ v B in 25 min, from 45% to 90% v ⁄ v B in 3 min, 7 min 90% B). The sam- ples were transferred online for ESI-MS-MS analysis. Acknowledgements We thank Dr Frank Siedler and Bea Scheffer (MPI Biochemie, Martinsried) for technical assistance in the MS experiments. This work was partially supported by the SFB533 and by a grant of the Fonds der Chemis- chen Industrie to B. Quest. References 1 Scha ¨ fer E & Nagy F, eds. (2006) Photomorphogenesis in Plants and Bacteria, 3rd edn. Springer, Dordrecht. 2 Hughes J, Mittmann F, Wilde A, Ga ¨ rtner W, Bo ¨ rner T, Hartmann E & Lamparter T (1997) A prokaryotic phytochrome. Nature 386, 663. 3 Davis SJ, Vener AV & Vierstra RD (1999) Bacteriophy- tochromes: phytochrome-like photoreceptors from non- photosynthetic eubacteria. Science 286, 2517–2520. 4 Lamparter T, Michael N, Caspani O, Miyata T, Shirai K & Inomata K (2003) Biliverdin binds covalently to Agrobacterium phytochrome Agp1 via its ring a vinyl side chain. J Biol Chem 278, 33786–33792. 5 Wurgler-Murphy SM & Saito H (1997) Two-component signal transducers and MAPK cascades. Trends Biochem Sci 22, 172–176. 6 Montgomery BL & Lagarias JC (2002) Phytochrome ancestry: sensors of bilins and light. Trends Plant Sci 7, 357–366. 7 Lamparter T, Mittmann F, Ga ¨ rtner W, Bo ¨ rner T, Hartmann E & Hughes J (1997) Characterization of recombinant phytochrome from the cyanobacterium Synechocystis. Proc Natl Acad Sci USA 94, 11792–11797. 8 Remberg A, Lindner I, Lamparter T, Hughes J, Kneip C, Hildebrandt P, Braslavsky SE, Ga ¨ rtner W & Schaffner K (1997) Raman spectroscopic and light- induced kinetic characterization of a recombinant phytochrome of the cyanobacterium Synechocystis. Biochemistry 36, 13389–13395. 9 Herdman M, Coursin T, Rippka R, Houmard J & Tandeau de Marsac N (2000) A new appraisal of the prokaryotic origin of eukaryotic phytochromes. J Mol Evol 51, 205–213. 10 Jorissen HJMM, Quest B, Remberg A, Coursin T, Braslavsky SE, Schaffner K, de Marsac N & Ga ¨ rtner W (2002) Two independent, light-sensing two-component systems in a filamentous cyanobacterium. Eur J Biochem 269, 2662–2671. 11 Bhoo SH, Davis SJ, Walker JM, Karniol B & Vierstra RD (2001) Bacteriophytochromes are photochromic his- tidine kinases using a biliverdin chromophore. Nature 414, 776–779. 12 Lamparter T, Michael N, Mittmann F & Esteban B (2002) Phytochrome from Agrobacterium tumefaciens has unusual spectral properties and reveals an N-ter- minal chromophore attachment site. Proc Natl Acad Sci USA 99, 11628–11633. 13 Karniol B & Vierstra RD (2003) The pair of bacterio- phytochromes from Agrobacterium tumefaciens are his- tidine kinases with opposing photobiological properties. Proc Natl Acad Sci USA 100, 2807–2812. 14 Karniol B, Wagner JR, Walker JM & Vierstra RD (2005) Phylogenetic analysis of the phytochrome super- family reveals distinct microbial subfamilies of photore- ceptors. Biochem J 392, 103–116. 15 Wagner JR, Brunzelle JS, Forest KT & Vierstra RD (2005) A light-sensing knot revealed by the structure of the chromophore-binding domain of phytochrome. Nature 438, 325–331. 16 Yeh K-C, Wu S-H, Murphy JT & Lagarias JC (1997) A cyanobacterial phytochrome two-component light sen- sory system. Science 277, 1505–1508. 17 Hu ¨ bschmann T, Jorissen HJMM, Bo ¨ rner T, Ga ¨ rtner W & de Marsac N (2001) Phosphorylation of proteins in the light-dependent signalling pathway of a filamentous cyanobacterium. Eur J Biochem 268, 3383–3389. 18 Quest B & Ga ¨ rtner W (2004) Chromophore selectivity in bacterial phytochromes ) dissecting the process of chro- mophore attachment. Eur J Biochem 271, 1117–1126. 19 Hu ¨ bschmann T, Bo ¨ rner T, Hartmann E & Lamparter T (2001) Characterization of the Cph1 holo-phytochrome from Synechocystis sp PCC 6803. Eur J Biochem 268, 2055–2063. 20 Rippka R, Deruelles J, Waterbury JB, Herdman M & Stanier RY (1979) Generic assignments, strain histories and properties of pure cultures of cyanobacteria. J Gen Microbiol 111, 1–61. 21 Cobley JG, Zerweck E, Reyes R, Mody A, Seludo-Unson JR, Jaeger H, Weerasuriya S & Navankasattusas S (1993) B. Quest et al. Homologously expressed bacteriophytochrome FEBS Journal 274 (2007) 2088–2098 ª 2007 The Authors Journal compilation ª 2007 FEBS 2097 [...]... 1415–1429 Benda C, Scheufler C, de Marsac N & Gartner W ¨ (2004) Crystal structures of two cyanobacterial response regulators in apo- and phosphorylated form reveal a novel dimerization motif of phytochromeassociated response regulators Biophys J 87, 476– 487 Matysik J, Hildebrandt P, Schlamann W, Braslavsky SE & Schaffner K (1995) Fourier-transform resonance Raman spectroscopy of intermediates of the phytochrome. .. proteins in the range from 1 to 100 kDa Anal Biochem 166, 368–379 Berkelman TR & Lagarias JC (1986) Visualization of bilin-linked peptides and proteins in polyacrylamide gels Anal Biochem 156, 194–201 Lindner I, Knipp B, Braslavsky SE, Gartner W & ¨ Schaffner K (1998) A novel chromophore selectively modifies the spectral properties of one of the two stable states of the plant photoreceptor phytochrome Angew...Homologously expressed bacteriophytochrome 22 23 24 25 26 27 28 B Quest et al Construction of shuttle plasmids which can be effectively mobilized from Escherichia coli into the chromatically adapting cyanobacterium, Fremyella diplosiphon Plasmid 30, 90–105 Kehoe DM & Grossman AR (1998) Use of molecular genetics to investigate complementary chromatic adaptation: advances in transformation and complementation... Lindner I, de Marsac N & Gartner W (2002) Phytochromes with noncovalently ¨ 2098 29 30 31 32 33 bound chromophores: the ability of apophytochromes to direct tetrapyrrole photoisomerization Photochem Photobiol 75, 554–559 Knipp B, Muller M, Metzler-Nolte N, Balaban TS, ¨ Braslavsky SE & Schaffner K (1998) NMR verification of helical conformations of phycocyanobilin in organic solvents Helv Chim Acta 81, 881–888... complementation Methods Enzymol 297, 279–290 Ehai J & Wolk CP (1988) Conjugal transfer of DNA to cyanobacteria Methods Enzymol 167, 747–754 Thomas CM & Smith CA (1987) Incompatibility group P plasmids: genetics, evolution, and use in genetic manipulation Annu Rev Microbiol 41, 77–101 Schagger H & von Jagow G (1987) Tricine-sodium ¨ dodecyl sulfate-polyacrylamide gel electrophoresis for the separation of proteins... Remberg A, Schmidt P, Braslavsky SE, Gartner W & ¨ Schaffner K (1999) Differential effects of mutations in the chromophore pocket of recombinant phytochrome on chromoprotein assembly and Pr-to-Pfr photoconversion Eur J Biochem 266, 201–208 Hahn J, Strauss HM, Landgraf FT, Gimenez HF, Lochnit G, Schmieder P & Hughes J (2006) Probing protein chromophore interactions in Cph1 phytochrome by mutagenesis... Schlamann W, Braslavsky SE & Schaffner K (1995) Fourier-transform resonance Raman spectroscopy of intermediates of the phytochrome photocycle Biochemistry 34, 10497–10507 FEBS Journal 274 (2007) 2088–2098 ª 2007 The Authors Journal compilation ª 2007 FEBS . (5¢-TATA CCATGG GCTTAAGTCCTGAAAATTCTCCAG-3¢) and oBQ147 (5¢-AAA CTCGAGCCGGCCCTCAATTTTGACCTCCTGC AATGTGAAATAGAACG-3¢), and cloned between the NcoI and XhoI sites into pET2 8a( +), providing a His-tag. Homologous expression of a bacterial phytochrome The cyanobacterium Fremyella diplosiphon incorporates biliverdin as a genuine, functional chromophore Benjamin Quest 1, *, Thomas Hu ¨ bschmann 2 ,. left). The kinase activity of the P r form of CphBcy was clearly stronger than the activity of the P fr form, which reached, maximally, 20% of that of the P r form. Tak- ing into account the maximal