Insights into the activation of brain serine racemase by the multi-PDZ domain glutamate receptor interacting protein, divalent cations and ATP Florian Baumgart 1 , Jose ´ M. Manchen ˜ o 2 and Ignacio Rodrı ´ guez-Crespo 1 1 Departamento de Bioquı ´ mica y Biologı ´ a Molecular, Facultad de Ciencias Quı ´ micas, Universidad Complutense de Madrid, Spain 2 Grupo de Cristalografia Macromolecular y Biologı ´ a Estructural, Instituto Rocasolano, CSIC, Madrid, Spain Serine racemase (SR) is a pyridoxal phosphate con- taining enzyme that catal yses th e conversion of the naturally occurring amino a cid l-serine into its race- mic counterpart d-serine [1,2]. In brain tissues, d-serine occupies the so-called ‘glycine site’ withi n the NMDA receptor together with the neurotrans- mitte r glutamate. Initially, Wolosker and coworkers performed elegant studies that resulted in the mole- cular cloning of the enzyme [3] and determined that it was essentially expressed in astrocytes [4,5]. The observation t hat certain neurones displayed signifi- cant levels of d-serine [6] was confirmed when the expression of SR was detected in neuronal cells as well [7,8]. Keywords calcium activation; D-serine; GRIP; PDZ domain; serine racemase Correspondence I. Rodrı ´ guez-Crespo, Departamento de Bioquı ´ mica y Biologı ´ a Molecular, Facultad de Ciencias Quı ´ micas, Universidad Complutense, 28040 Madrid, Spain Fax: +34 91 394 4159 Tel: +34 91 394 4137 E-mail: nacho@bbm1.ucm.es (Received 7 June 2007, revised 6 July 2007, accepted 11 July 2007) doi:10.1111/j.1742-4658.2007.05986.x Brain serine racemase contains pyridoxal phosphate as a prosthetic group and is known to become activated by divalent cations such as Ca 2+ and Mg 2+ , as well as by ATP and ADP. In vivo, brain serine racemase is also activated by a multi-PSD-95 ⁄ discs large ⁄ ZO-1 (PDZ) domain glutamate receptor interacting protein (GRIP) that is usually coupled to the GluR2 ⁄ 3 subunits of the a-amino-3-hydroxy-5-methylisoxazole-4-propionic acid Ca 2+ channel. In the p resent study, we analysed the mechanisms b y which ser- ine racemase becomes activated by GRIP, divalent cations and ATP. We show that binding of PDZ6 of GRIP to serine racemase does not result in increased d-serine production. However, full-length GRIP does augment significantly enzymatic activity. We expressed various GRIP shorter con- structs to map down the regions within GRIP that are necessary for serine racemase activation. We observed that, whereas recombinant proteins con- taining PDZ4-PDZ5-PDZ6 are unable to activate serine racemase, other constructs containing PDZ4-PDZ5-PDZ6-GAP2-PDZ7 significantly aug- ment its activity. Hence, activation of serine racemase by GRIP is not a direct consequence of the translocation towards the calcium channel but rather a likely conformational change induced by GRIP on serine race- mase. On the other hand, the observed activation of serine racemase by divalent cations has been assumed to be a side-effect associated with ATP binding, which is known to form a complex with Mg 2+ ions. Because no mammalian serine racemase has yet been crystallized, we used molecular modelling based on yeast and bacterial homologs to demonstrate that the binding sites for Ca 2+ , ATP and the PDZ6 domain of GRIP are spatially separated and modulate the enzyme through distinct mechanisms. Abbreviations AMPA, a-amino-3-hydroxy-5-methylisoxazole-4-propionic acid; AMPpcp, phosphomethylphosphonic acid adenylate ester; GRIP, glutamate receptor interacting protein; hSR, human serine racemase; PDB, protein databank; PDZ, PSD-95 ⁄ discs large ⁄ ZO-1; PLP, pyridoxal phosphate; SR, serine racemase. FEBS Journal 274 (2007) 4561–4571 ª 2007 The Authors Journal compilation ª 2007 FEBS 4561 Sequence comparison studies have shown that SR is homologous to other type II fold-pyridoxal phosphate enzymes. However, we observed that, unlike other amino acid racemases, Ca 2+ ,Mn 2+ ,Mg 2+ and other divalent cations were able to activate recombinant brain SR through a process that involved the stabiliza- tion of the enzyme [9]. The addition of chelating agents such as EDTA or EGTA almost completely abrogated the synthesis of d-serine. Further work dem- onstrated that d-serine synthesis by a brain purified SR was activated by ATP, ADP and GTP as well as by divalent cations [10]. Likewise, when SR was expressed recombinantly in human embryonic kidney cells and purified, both divalent cations and ATP or ADP activated the enzyme [11]. In addition, these two reports showed that ATP was not hydrolysed during turnover, hence suggesting a novel, allosteric role for this nucleotide during d-serine synthesis. By means of the yeast two-hybrid approach, three proteins have been shown to interact with brain SR: glutamate receptor interacting protein (GRIP) [1,12], PICK1 [13] and Golga3 [14]. GRIP is a large protein with seven PSD-95 ⁄ discs large ⁄ ZO-1 (PDZ) domains that associates with the GluR2 ⁄ 3 subunits of the a-amino-3-hydroxy-5-methylisoxazole-4-propionic acid (AMPA) subtype of glutamate receptors using PDZ4 and PDZ5 [15]. PICK1, a protein that contains a sin- gle PDZ domain, also binds to the GluR2 ⁄ 3 subunits of the AMPA receptors as well as to protein kinase C [13]. Both GRIP and PICK1 bind to the four carboxy- terminal amino acids of SR (-Ser-Val-Ser-Val-COOH in the human enzyme and -Thr-Val-Ser-Val-COOH in the mouse enzyme) [12,13]. Interestingly, coexpression of GRIP with SR caused a five-fold increase in the d-serine released into the medium [1], whereas infec- tion of astrocytes with a GRIP adenovirus resulted in a two- to three-fold increase [12]. Finally, Golga3 binds to the first 66 amino acids of brain SR and, remarkably, this binding also results in an increased d-serine synthesis. However, activation of SR by Golga3 takes place through a decreased ubiquitylation of SR and diminished proteasomal degradation [14]. Because calcium activates SR [9,11], it is conceivable that GRIP binding might target SR to the proximity of the Ca 2+ -permeable AMPA channel. Alternatively, due to the promiscuous interaction of GRIP with numerous cellular proteins, GRIP binding to SR might bring it to the close proximity of some other protein responsible for the observed increase in d-serine syn- thesis. Finally, GRIP might also activate brain SR through a putative conformational change that might result in an increased catalytic rate. With that in mind, we analysed in detail the mechanisms by which the hepta-PDZ domain protein GRIP activates brain SR. We show that GRIP induces a conformational change in SR responsible for the observed increase in d-serine synthesis. Results Binding of PDZ6 of GRIP to brain SR When SR is transfected in COS7 cells, high levels of d-serine can be detected in the supernatant. Conse- quently, we transfected brain SR in COS7 cells in the presence and absence of transfected PDZ6 domain of GRIP or full-length GRIP (Fig. 1A). In the three cases, similar levels of transfected SR were obtained (Fig. 1A, upper panel). Remarkably, although full-length GRIP was able to increase significantly the activity of SR, its PDZ6 domain was unable to increase the levels of d-serine in the supernatant. To investigate whether the PDZ6 domain of GRIP was efficiently transfected in COS7, we performed an immunoblotting, which resulted in a positive band at the expected molecular mass (approximately 13 kDa; Fig. 1A, upper right- hand panel). Next, to rule out the possibility that SR and the PDZ6 domain of GRIP might be unable to interact, we immunoprecipitated the transfected SR from the COS7 cells and investigated whether the PDZ6 domain of GRIP effectively associated with the carboxy-terminal end of SR. As shown in Fig. 1A, the PDZ6 domain of GRIP was found to be in associa- tion with SR, an observation that confirms the proper binding of both proteins. Next, we decided to analyse the binding of the PDZ6 domain of GRIP to brain SR using recombinant pro- teins. We expressed recombinant brain SR in Escheri- chia coli using the pCWori vector as previously described [9,16], as well as the isolated PDZ6 domain of GRIP (residues 665–768). Both recombinant pro- teins were purified to homogeneity (Fig. 1B). Because the PDZ6 domain of GRIP is just a part of the entire protein, we confirmed by circular dichroism that the protein was properly folded (Fig. 1B, right panel). The far-UV circular dichroism spectrum of the PDZ domain of GRIP indicates an abundance in b-sheet content, as confirmed from the crystal structure of this domain [17]. Once we had confirmed that the PDZ6 domain of GRIP was properly folded, we analysed the activity of SR under different conditions in the presence and absence of this binding protein (Fig. 1C). When SR is purified in the presence of divalent cations, the addition of extra Ca 2+ or Mg 2+ has a limited effect on its catalytic activity. The chelating agent EDTA Activation of brain SR by GRIP, calcium and ATP F. Baumgart et al. 4562 FEBS Journal 274 (2007) 4561–4571 ª 2007 The Authors Journal compilation ª 2007 FEBS significantly diminished catalytical activity, whereas ATP significantly increased the racemase activity (Fig. 1C). When ATP plus Ca 2+ ⁄ Mg 2+ was added to the reaction mixture, the synthesis of d-serine reached almost a three-fold increase over basal activity levels. When recombinant PDZ6 domain of GRIP was added to SR in a 2 : 1 molar ratio, no significant changes in activity could be observed. This clearly indicates that the binding of the PDZ6 domain by itself is not responsible for the previously reported increase in SR activity [1,12]. Binding of brain SR to recombinant constructs of GRIP that included additional PDZ modules GRIP is a very large protein (1112 amino acids) com- posed of at least nine protein modules. The architecture of this protein is depicted in Fig. 2A. Each PDZ domain is comprised of approximately 100 amino acids and they are conserved in terms of folding, although each PDZ module is able to interact with a different subset of target proteins [18,19]. GRIP contains two clusters of three PDZ domains, since PDZ1, PDZ2 and PDZ3 are consecutive in the sequence as well as PDZ4, PDZ5 and PDZ6. On the other hand, PDZ7 is close to the carboxy-terminal end of the amino acid sequence [15]. The two clusters of PDZ domains, as well as the second cluster and PDZ7, are separated by large domains of unknown function referred to as GAP1 and GAP2 (Fig. 2A). Binding of GRIP to SR occurs through the direct interaction of the PDZ6 domain of GRIP and the final four amino acids of SR [12]. We performed the recombinant expression in E. coli and the purification of two larger fragments of GRIP and incubated the purified proteins with SR to analyse changes in activity. A hexa-His tag was introduced at the N-terminal end and a FLAG tag was introduced at the carboxy-terminal end. Expression and purification conditions were optimized to obtain a homogeneous band by SDS ⁄ PAGE. When the purified protein that contained the cluster PDZ4-PDZ5-PDZ6 (residues 468– 768) was incubated with SR in a 2 : 1 molar ratio, we failed to observe the expected increase in d-serine A B C Fig. 1. Binding of SR to the PDZ6 domain of GRIP. (A) COS7 cells were transfected with a SR plasmid and then, 24 h post-transfec- tion, they were trypsinized, split into three flasks and transfected with a PDZ6, a full-length GRIP or an empty plasmid. The amount of the released D-serine into the medium was determined in the three cases (left panel). The efficient expression of SR (upper left panel) and PDZ6 domain of GRIP (upper right panel) in the trans- fected COS7 cells was determined by immunodetection by wes- tern blot. The association between the PDZ6 domain of GRIP and SR was determined through the immunoprecipitation of SR and the immunodetection of FLAG-tagged PDZ6 (bottom right panel). (B) Coomassie Blue-stained SDS ⁄ PAGE gels of purified recombi- nant SR (left) and the PDZ6 domain of GRIP (middle). The circular dichroism spectrum of purified PDZ6 domain of GRIP is shown in the right panel. (C) D-Serine synthesis by recombinant SR in the absence (black bars) and presence (grey bars) of a two-fold molar excess of the PDZ6 domain of GRIP under different assay condi- tions. Data are representative of three independent experiments. F. Baumgart et al. Activation of brain SR by GRIP, calcium and ATP FEBS Journal 274 (2007) 4561–4571 ª 2007 The Authors Journal compilation ª 2007 FEBS 4563 synthesis (Fig. 2B). Although a limited rise in activity was observed when both ATP and Ca 2+ were present, this increase is far from the expected five-fold [1] or two- to three-fold [12] increase that was reported when both proteins were transfected in mammalian cells. Remark- ably, when we incubated the purified protein that contained the PDZ4-PDZ5-PDZ6-GAP2-PDZ7-end of GRIP (residues 468–1112) with SR in a 2 : 1 molar ratio, a significant increase in activity was obtained when no additional ATP was added (Fig. 2C). This increase was over two-fold when purified SR lacked additional Ca 2+ or ATP, as well as when additional Ca 2+ had been included in the reaction mixture. Characterization of the activation of brain SR by GRIP(468–1112) We next analysed whether larger ratios of PDZ6 domain:SR might be able to increase the synthesis of d-serine. We tested up to a ratio of 23 : 1 using the recombinant PDZ6 domain of GRIP (residues 665–768) and recombinant SR (Fig. 3A). Even at this large excess of PDZ6, the increase in racemization activity was extre- mely limited. However, when we tested larger ratios of recombinant PDZ4-PDZ5-PDZ6-GAP2-PDZ7-end of GRIP (residues 468–1112), a significant increase in the racemase activity was observed (Fig. 3B). Due to solu- bility problems, we could not go beyond a 5.8 ratio of GRIP fragment:SR but, at this point, we observed a 2.8-fold augmentation in racemase activity. Hence, this result indicates that certain residues of GRIP that lie outside the binding site for SR present within PDZ6 are responsible for a complete activation of the enzyme. Next, we maintained a 1 : 1 molar ratio of the recom- binant protein PDZ4-PDZ5-PDZ6-GAP2-PDZ7-end to racemase and inspected the catalytic properties of the latter at increasing concentrations of the substrate l-ser- ine in the absence of additional ATP (Fig. 3C). We were able to determine that binding of this fragment of GRIP to SR changed both the K m and the V max of the reaction. The K m for d-serine synthesis increased from 1.9 mm in the absence of GRIP fragment (filled circles) to 3.4 in its presence (empty circles), whereas the V max of the reaction augmented 1.65-fold (from approximately 115 ± 8 nmolÆmg )1 Æmin )1 to 190 ± 7 nmolÆmg )1 Æ min )1 ; Fig. 3C, insert). Consequently, binding of PDZ4- PDZ5-PDZ6-GAP2-PDZ7-end of GRIP induces a conformational change in recombinant SR that is responsible for its increased catalytic properties. We next considered whether the binding of GRIP to SR might result in a shift in the response towards calcium. In the presence of ATP, a preparation of recombinant SR that had been purified in the presence D-Serine Synthesis (%) 50 100 150 200 250 300 D-Serine Synthesis (%) 100 200 300 400 + ATP mock + EDTA + Ca 2+ + Ca 2+ /ATP + ATP mock + EDTA + Ca 2+ + Ca 2+ /ATP C N PDZ1 GAP2 GAP1 PDZ7 PDZ4 PDZ5 PDZ6 PDZ3 PDZ2 468 665 768 1112 A B C 75 50 37 25 75 50 37 25 Fig. 2. D-Serine synthesis by purified recombinant SR in the pres- ence of the PDZ4-PDZ5-PDZ6 and PDZ4-PDZ5-PDZ6-GAP2-PDZ7- end modules of GRIP. (A) GRIP is formed by seven PDZ domains separated by two large GAP domains of unknown function. The residue numbering indicative of the beginning and end of each domain is shown on the right. D-Serine synthesis is measured under various conditions in the absence (black bars) or presence (grey bars) of GRIP constructs. The effect of (B) PDZ4-PDZ5-PDZ6 and (C) PDZ4-PDZ5-PDZ6-GAP2-PDZ7-end is shown together with a Coomassie Blue-stained SDS ⁄ PAGE (inserts). Data are represen- tative of three independent experiments. Activation of brain SR by GRIP, calcium and ATP F. Baumgart et al. 4564 FEBS Journal 274 (2007) 4561–4571 ª 2007 The Authors Journal compilation ª 2007 FEBS of divalent cations, but afterwards dialysed, was incu- bated with increasing levels of Ca 2+ in the absence and presence of PDZ4-PDZ5-PDZ6-GAP2-PDZ7-end of GRIP (Fig. 3D). Values above 2 mm Ca 2+ could not be reached due to protein precipitation in the assay. In both cases, recombinant SR became activated in the 1–100 lm range of Ca 2+ . The activation curve was not displaced towards lower Ca 2+ concentrations, a clear indication that GRIP binding does not result in a higher sensitivity of SR towards this divalent cation. ATP binding does not involve significant changes either in the quaternary structure of SR or in its kinetic properties At this point, we considered the mechanism by which the addition of ATP or ADP might augment the cata- lytic properties of SR. It should be noted that the highly homologous threonine dehydratase, an E. coli enzyme, binds to and becomes activated by AMP, in a process that results in the decrease of the K m for threonine from 70 mm in the absence to 5 mm in the presence of this cofactor [20]. At the same time, binding of AMP to E. coli threonine dehydratase results in the association of the protein monomers into tetramers [21]. Accord- ingly, we inspected the catalytic properties of SR in the presence and absence of added ATP. In the presence of 100 lm ATP, the enzyme becomes activated but, inter- estingly, the V max for d-serine synthesis increases 2.2- fold, whereas the K m of the reaction remains almost unchanged (approximately 3.2 mm in the absence against 3.0 mm in the presence of ATP) (Fig. 4A). Remarkably, ATP binding is not involved in protein oligomerization. We previously showed that brain SR is found in solution in a dimer–tetramer equilibrium [9], with the dimer eluting at approximately 12.8 mL in a Superdex-200 column. Addition of 10 lm ATP plus 100 lm Mg 2+ to brain SR did not induce changes in the elution profile (Fig. 4B). Although a slight increase in the population of high molecular mass oligomers eluting at approximately 10 mL was observed, the population of dimers remained the most abundant in solution. Molecular modelling of human SR (hSR) using the crystal coordinates of homologous enzymes from Schizosaccharomyces pombe and Thermus thermophilus Although no mammalian serine racemases have been resolved to date, the structures of two homologous racemases have been recently solved and their atomic coordinates deposited in public databases. The three- dimensional structure of SR from S. pombe has been solved in the presence of Mg 2+ as well as with the ATP analogue phosphomethylphosphonic acid adenyl- ate ester (AMPpcp) [protein databank (PDB) codes: molar ratio (GRIP/SR) D-Ser synthesis (%) 50 100 150 200 250 molar ratio (GRIP/SR) 0 5 10 15 20 0 1 2 3 4 5 6 D-Ser synthesis (%) 50 100 150 200 250 [L-Ser] (mM) 0 1020304050 D-Ser synthesis (A 411 nm ) 0.00 0.01 0.02 0.03 0.04 0.05 0.06 1/[L-Ser] -0.5 0.0 0.5 1.0 1.5 1/A 411 nm 0 20 40 60 80 additional Ca 2+ added 100 n M 1 µ M 10 µM 100 µ M 1 m M D-Ser synthesis (A 411 nm ) 0.02 0.04 0.06 0.08 + EDTA A C D B Fig. 3. Characterization of SR activation by the PDZ4-PDZ5-PDZ6- GAP2-PDZ7-end module of GRIP. D-Serine synthesis by recombi- nant SR in the presence of increasing molar ratios of (A) the recombinant PDZ6 domain or (B) PDZ4-PDZ5-PDZ6-GAP2- PDZ7-end module of GRIP. (C) The kinetic properties of D-serine racemization were determined in the absence (filled circles) or pres- ence (empty circles) of a two-fold molar excess of PDZ4-PDZ5- PDZ6-GAP2-PDZ7-end module of GRIP towards SR at increasing substrate concentrations. The Lineweaver–Burk plot is depicted in the insert. These assays were performed in the presence of 1 m M Ca 2+ and in the absence of ATP. (D) Increase in D-serine synthesis at increasing Ca 2+ concentrations by recombinant SR in the absence (filled circles) or presence (empty circles) of a two-fold molar excess of the PDZ4-PDZ5-PDZ6-GAP2-PDZ7-end module of GRIP. Data are representative of three independent experiments. F. Baumgart et al. Activation of brain SR by GRIP, calcium and ATP FEBS Journal 274 (2007) 4561–4571 ª 2007 The Authors Journal compilation ª 2007 FEBS 4565 1V71 and 1WTC]. Likewise, the atomic coordinates of threonine deaminase from T. thermophilus have been obtained by X-ray crystallography in the presence of Ca 2+ (PDB code: 1VE5). With the aim of building a full-atom 3D model of hSR, we carried out a tertiary structure prediction approach by using three different servers available on the Internet (see Experimental pro- cedures). The results provided by the program were fully consistent in that all of them rendered the same hit with the highest score: the SR from the fission yeast S. pombe (40% sequence identity with hSR). In the case of 3d-jury, the threading predictions were stopped because it readily considered 1V71 as a signifi- cant hit. The other potential template provided by sp3 and 3d-shotgun with a similar but lower score is thre- onine deaminase from T. thermophilus (TtTD; PDB code: 1VE5) (41% sequence identity with hSR). Both proteins, which belong to the tryptophan synthase b-subunit-like pyridoxal-phosphate-dependent enzymes superfamily, share the same polypeptide chain fold. The 3D comparison of the Ca atoms of the two crystal structures yielded a root mean square (rms) deviation of 1.3 A ˚ for 289 Ca atoms. Thus, the template selected for building a 3D model for hSR was the SR from S. pombe (SpSR). Although the 3D models provided by both 3d-shotgun and sp3 are indistinguishable (rmsd ¼ 0.75 A ˚ for 318 Ca-atoms), it should be noted that the last server provides a model for the first four residues of hSR and also for the last 12 amino acid residues, which were not modelled by 3d-shotgun. Superimposition of the crystal structure of SpSR and the herein proposed full-atom model for hSR reveals that the pyridoxal phosphate (PLP) binding site is conserved. The coenzyme is located deep between the two subdomains. The lysine residue Lys56 in hSR would be homologous to Lys57 in SpSR, Lys51 in TtTD, or Lys62 in threonine deaminase from E. coli [22], which are covalently bound to PLP through the formation of a Schiff base. Conversely, the microenvi- ronment of the phosphate moiety of PLP is essentially conserved, mainly interacting with the tetraglycine loop (Gly185 to Gly188), which is highly conserved in PLP-dependent enzymes. Other residues interacting with the PLP coenzyme are Phe55, which embraces the pyridine ring, Ser313 and Asn154. The only significant difference in the vicinity of PLP between hSR and SpSR is precisely the presence of this last residue Asn54 instead of Tyr152 in SpSR. The crystal structure of both SpSR and TtTD revealed a common cation binding site, which in the first case is occupied by Mg 2+ and in the second by Ca 2+ (Fig. 5A). In both cases, the metal is hexavalent- ly coordinated. The cation binding site is formed by two carboxylate-containing residues (Glu208, Asp214 in SpSR and Glu203, Asp209 in TtTD), a main chain carbonyl oxygen (Gly212 in SpSR and Ala207 in TtTD) and three well-ordered water molecules, which in turn are hydrogen-bonded to main chain carbonyl groups. Both the geometry and the distances perfectly agree with the coordination of these metals [23]. The Fig. 4. Binding of ATP to SR changes the V max of the racemization reaction but not the oligomeric state of the enzyme. (A) Michaelis–Menten representation and Lineweaver–Burk plot of the activation of brain SR by ATP. Assays were performed in the presence of 1 m M Ca 2+ plus 1 mM Mg 2+ . (B) Gel filtration elution profile of recombinant SR (approximately 400 lg per run) in the absence (upper trace) and pres- ence (bottom trace) of 10 l M ATP plus 100 l M Mg 2+ . Data are representative of four independent experiments. Activation of brain SR by GRIP, calcium and ATP F. Baumgart et al. 4566 FEBS Journal 274 (2007) 4561–4571 ª 2007 The Authors Journal compilation ª 2007 FEBS corresponding region of hSR is perfectly superimpos- able with the above crystal structures, indicating that the cation binding site is conserved, thus explaining the Ca 2+ -binding ability of hSR. In this case, the homologous amino acid residues in hSR putatively involved in Ca 2+ coordination are: Glu210, Asp216 and Ala214. Based on the crystal structure of SpSR (PDB code: 1V71), a putative model for the dimeric hSR can be easily built (Fig. 5B). In this structure, two monomers related by a crystallographic two-fold axis tightly asso- ciate forming dimeric species. It is worth noting that the presence of an extended C-terminal end in the model for hSR herein proposed would not preclude this association (Fig. 5B). The putative interface between hSR monomers would be made up primarily of hydrophobic residues essentially contributed by regular structure elements of the polypeptide chain. Estimation of the hydrophobic surface area with nac- cess from the ligplot package reveals that approxi- mately 76% of the contact area is hydrophobic, which is typical of obligate complexes. Additionally, the crys- tal structure of SpSR in the presence of AMPpcp has also been deposited (PDB code: 1WTC), revealing a putative ATP binding site. According to the present model for hSR, the ATP analogue would be located between hSR monomers in a shallow manner, mainly interacting with polar residues (Fig. 5B). Remarkably, comparison of the crystal structures of SpSR in the presence and absence of AMPpcp shows two impor- tant aspects. First, binding of the ATP analogue does not induce large conformational changes in the protein and, second, the ligand does not modify the dimeric state of the protein, which is in agreement with the results herein provided. Finally, the proposed structure for the dimeric hSR permits the visualization of a tentative model for the hSR:PDZ6 complex (Fig. 5C). This model has been constructed assuming that the C-terminal eight resi- dues of hSR adopt an extended conformation similar to that of the octapeptide of human liprin-a com- plexed with the GRIP1 PDZ6 domain [17], with an identical mode of interaction of PDZ6. Although this model should only be considered tentatively, it per- mits the identification of the regions of hSR that can be directly affected by the binding of the PDZ domain. Discussion Fluorescence studies from numerous groups have dem- onstrated that astrocytes respond to neurotransmitters not with action potentials, like most neurones, but A B C Fig. 5. (A) Calcium binding site of hSR. The polypeptide chains of hSR (yellow) and SpSR (blue) are superimposed. Calcium is shown as a green sphere; water molecules (wat) present in the crystal structure of SpSR are shown as red spheres. Labels for the resi- dues are for hSR. Carboxylate-containing residues and carbonyl oxy- gens involved in cation binding are shown as sticks. The figure was generated with PYMOL [32]. Positioning of the Ca 2+ , ATP and PDZ6 domain binding sites in the model of hSR. (B) 3D Model of the dimeric hSR. The relative position of the PLP (red sticks), Ca 2+ (magenta spheres) and AMPpcp (orange sticks) are shown. The N- and C-terminal ends of hSR are indicated as N and C, respec- tively. Magnesium ions complexed with the nucleotide present in the crystal structure of SpSR (PDB code: 1WTC) are shown as green spheres. (C) Putative 3D model of the PDZ6:HSR complex. The figure was generated with PYMOL. F. Baumgart et al. Activation of brain SR by GRIP, calcium and ATP FEBS Journal 274 (2007) 4561–4571 ª 2007 The Authors Journal compilation ª 2007 FEBS 4567 with propagating waves of intracellular calcium ions. In response to these calcium oscillations, glial cells release ‘gliotransmitters’ such as glutamate, ATP and d-serine. Released glutamate and d-serine occupy binding sites in the NMDA receptors of neurones hence regulating neuronal function. In this context, we analysed how brain SR becomes activated by three independent factors: divalent cations, nucleotides such as ATP and the multi-PDZ domain protein GRIP. When an adenovirus that contained GRIP was used to infect mice the cerebellar d-serine concentration was augmented two-fold [12]. One likely explanation for this observation is that the PDZ4-PDZ5 domains of GRIP might interact with the AMPA channel, target- ing brain SR bound to the PDZ6 domain of GRIP towards its proximity. Under these circumstances, brain SR might become activated due to the calcium influx through the channel. Conversely, brain SR acti- vation might occur through a conformational change induced upon GRIP binding. Using purified recombi- nant proteins, we have been able to establish that GRIP binding to brain SR induces a conformational change that increases the racemase activity by over two-fold. Although the PDZ6 domain of GRIP is involved in the interaction with the last four carboxy- terminal residues of SR, this association is not enough to induce SR activation. Our results indicate that addi- tional PDZ modules are necessary to trigger the observed activation. In this regard, it must be noted that multi-PDZ domain proteins are known to display ‘communication’ between individual modules. For example, neither the PDZ4, nor the PDZ5 domain of GRIP bind to the GluR2 subunit of the AMPA chan- nel independently, with the concerted action of both being necessary for the association [15]. Analysis of the amino acid sequence of GRIP reveals the presence of two GAP domains that separate the two three-PDZ domain tandems, PDZ1-PDZ2-PDZ3 from PDZ4- PDZ5-PDZ6 and the latter from PDZ7. Activation of brain SR requires the presence of GAP2 together with PDZ7. Interestingly, in the absence of additional ATP, the activation induced by the presence of the PDZ4- PDZ5-PDZ6-GAP2-PDZ7-end of GRIP reached the highest value. The conformational change induce by GRIP binding on brain SR results in changes in both the K m and the V max for d-serine synthesis and the response curve for activation by calcium remained unaltered. Considering that the cellular concentration of ATP (3–6 mm) is well above that needed for SR activation [11], it is intriguing to elucidate what might be the exact role of the nucleotide in vivo. Because amino acid racemization in PLP-containing racemases is not an ATP-driven reaction and ATP is not hydrolysed dur- ing catalysis [10,11], the nucleotide could exert an allo- steric role. Inspection of the 3D model of brain SR reveals that ATP is positioned in the monomer–mono- mer interface. However, crystals of the homologous SpSR reveal that these enzymes establish identical monomer–monomer interactions in the presence and absence of the nucleotide. According to our results, the absence of modulation of the oligomeric state of the enzyme by the nucleotide is in clear contrast with the behaviour displayed by the homologous bacterial threonine deaminase [20,21]. Our data also indicate that, in the absence of added ATP, brain SR is more readily regulated by GRIP binding. It is then conceivable that, in the microenvironments where SR is present, cellular ATP levels might be low, hence per- mitting a tight regulation through ATP binding. Our finding that SR, GRIP and the GluR2 subunit of the AMPA channel are able to form a ternary com- plex appears to indicate that SR might be positioned close to this calcium channel, hence modulating its activity. Experimental procedures Chemicals and antibodies Ultrapure l-serine was purchased from NovaBiochem (Laufelfingen, Switzerland). Horseradish peroxidase was obtained from Roche Molecular Biochemicals (Mannheim, Germany). SR monoclonal and GRIP antibodies were obtained from Transduction Laboratories. d-Serine, d-amino acid oxidase from porcine kidney and FLAG anti- body were purchased from Sigma (St Louis, MO, USA). Buffers and common laboratory reagents were also obtained from Sigma. Using a campus facility, we injected pure recombinant brain SR and pure PDZ4-PDZ5-PDZ6- GAP2-PDZ7-end GRIP fragment into rabbits. Injections were performed every week over a 6-week period. The anti- serum was then obtained and tested. Cloning of SR and the GRIP constructs PDZ4- PDZ5-PDZ6, PDZ6 and PDZ4-PDZ5-PDZ6-GAP2- PDZ7-end into pCWori and recombinant protein expression The plasmid encoding the cDNA of mouse SR was a gener- ous gift from S. H. Snyder (Johns Hopkins University, Baltimore, MD, USA) and GRIP1 cDNA in pBK was kindly given to us by R. Huganir (Johns Hopkins University). We have previously described the recombinant expression and purification of brain SR [9]. All the constructs were cloned in the pCWori plasmid that possessed a hexa-His tag Activation of brain SR by GRIP, calcium and ATP F. Baumgart et al. 4568 FEBS Journal 274 (2007) 4561–4571 ª 2007 The Authors Journal compilation ª 2007 FEBS at the 5¢-end in frame when the NdeI site was used (N-termi- nus of the recombinant protein) [9,16]. In addition, by PCR, we introduced a SalI site at the 3¢-end of the amplified gene followed by eight amino acids that encoded for the FLAG epitope and a XbaI site (at the carboxy-terminal end of the protein). Hence, all constructs were cloned between NdeI and SalI to ensure that there would be a tag at each end of the protein. In constructs with PDZ4 at the 5¢-end, we performed a PCR with GRIP as template using the oligonucleotide 5¢- GGACAGGTTGTT CATATGGAAACACA-3¢, which intro duced the NdeI site (underlined sequence) as forward primer. The reverse oligonucleotide that annealed at the 3¢-end of the gene and introduced the FLAG epitope was 5¢-GG TCT AGAGCTTATCGTC ATCGTCCTTGTAGTCGACTGTG TTAGT-3¢. The SalI and XbaI sites are underlined. For PDZ6 cloning (320 bp) we used the oligonucleotide 5¢-GAT GAG CATATGAGTTCCCGGGCG-3¢ as forward primer (introducing a NdeI site) and 5¢-TGA GTCGACGGGGAT GGGCAGCTT-3¢ (introducing a SalI site) as reverse primer. The amplification of the PDZ4-PDZ5-PDZ6 GRIP construct was performed using the forward primer 5¢-GGACAGGT TGTT CATATGGAAACCACA-3¢ (introducing a novel NdeI site) together with 5¢-TGA GTCGACGGGGATGGG CAGCTT-3¢ (introducing a novel SalI site). The amplified DNA fragments were subcloned into a pGEM-T vector (Promega, Madison, WI, USA) and con- firmed by automated DNA sequencing. Then, they were double digested with NdeI plus SalI and ligated into the corresponding sites of pCWori. In all cases, the hexa-His was at the N-terminal end of the protein and the FLAG epitope at the carboxy-terminal end. BL21 (DE3)-compe- tent cells (Novagen, Merck Chemicals Ltd, Nottingham, UK) were routinely transformed with the respective pCW- ori constructs and an overnight 10 mL culture was used to inoculate a 2.8 L flask containing 0.75 L of 2 · yeast ⁄ tryp- tone medium. Typically, 1.5 L of cell cultures were grown in the presence of 100 mgÆL )1 ampicillin at 37 °Ctoan absorbance of 1.0 and induced adding 1 mm isopropyl thio- b-d-galactoside. The E. coli cultures were then grown at 30 °C (to avoid degradation, especially of the PDZ con- structs) at 220 r.p.m. for 16–20 h before the cells were har- vested by centrifugation at 5140 g for 30 min in an F10 rotor (Sorvall, Norwalk, CT, USA). The cell pellets were frozen in plastic bags as thin films and stored at )80 °C. Immunoblot and immunoprecipitation Regarding immunoblot, immunoprecipitation and confocal analysis, we followed standard cellular biology protocols, as reported in previous studies performed by our group [24,25]. Cloning of PDZ6 into pCDNA3 The DNA of FLAG-tagged PDZ6 was amplified from the pCWori-PDZ6 construct, using 5¢-ATGCACCATCACC A GAATTCCCATATG-3¢ as forward primer and 5¢-CAT GTTTGACAGCTTAT TCTAGAG-3¢ as reverse primer con taining EcoRI and XbaI restriction sites (underlined sequences). The PCR product was double digested with EcoRI plus XbaI and ligated into the corresponding sites of pCDNA3. Thus, the PCR product of PDZ6 that we obtained contained the sequence for a C-terminal FLAG tag for immunoprecipitation and immunodetection. The PDZ6- pCDNA3 plasmid was subsequently confirmed by automated DNA sequencing. Determination of D-serine concentration A routine colorimetric assay with 200 lL of total sample was used with l-serine as a substrate, coupling the appear- ance of d-serine to commercial d-amino acid oxidase and horseradish peroxidase, plus the peroxidase substrate O-phenylenediamine. The d-serine that was produced dur- ing the incubation period was degraded by d-amino acid oxidase, which specifically targets d-amino acids generating -keto acid, ammonia, and hydrogen peroxide. The hydro- gen peroxide was quantified using horseradish peroxidase and O-phenylenediamine, which turns yellow upon oxida- tion. The activity of serine racemase was determined in the presence of 20 mm Mops, pH 8.1, 10 lL of purified enzyme (5 lg approximately), 10 mml-serine, 0.03 m m dithiothreitol, 5 lm PLP, 50 lgÆmL )1 O-phenylenediamine, 1nm FAD, 0.2 mgÆmL )1 d-amino acid oxidase, and 0.01 mgÆmL )1 horseradish peroxidase. The reactions (200 lL, final volume) were incubated at 37 °C for 2 h before measuring the absorbance (A 411 nm ) with a Beckman DU-7 spectrophotometer (Beckman Coulter Inc., Fullerton, CA, USA). The d-serine present in a given sample was determined by correlating the absorbance (A 411 nm ) with d-serine calibration curves. d-Serine measurements were not influenced by the concentration of l-isomers present in the sample. Because standard commercial l-serine prepara- tions contain trace amounts of d-serine, it was necessary to purchase ultrapure l-serine from NovaBiochem to achieve a reasonable signal-to-noise ratio. Once optimized, this three-enzyme assay was able to detect d-serine formed in an unknown 100 lL sample in the linear range from 50 lm to 1 mm (up to 0.1 lmol total of d-serine). All the measure- ments were performed in triplicate. To measure d-serine production by COS7 transfected with SR, we used the second part of the colorimetric assay described above. Transfected cells were incubated for approximately 8 h with phenol-red-free Dulbecco’s modified Eagle’s medium supplemented with 10 mml-serine. Col- lected supernatants were boiled for 10 min and centrifuged before the assay. To estimate d-serine levels, we typically analyzed a 300 lL sample adding 10 nm FAD, 10 lgÆmL )1 horseradish peroxidase, 50 lgÆmL )1 O-phenylenediamine and 100 lgÆmL )1 d-amino acid oxidase in a final volume of 400 lL. Samples were incubated for 5 h at 37 °C, F. Baumgart et al. Activation of brain SR by GRIP, calcium and ATP FEBS Journal 274 (2007) 4561–4571 ª 2007 The Authors Journal compilation ª 2007 FEBS 4569 centrifuged in a table-top microcentrifuge at 16 000 g and subsequently measured at 411 nm with a spectrophotometer. Circular dichroism measurements CD spectra were recorded on a Jasco J-715 spectropolarime- ter (Jasco Inc., Easton, MD, USA) using a 0.1 cm path length cell at 25 °C. The temperature in the cuvette was reg- ulated with a Neslab RT-111 circulating water bath (Neslab Inc., Portsmouth, NH, USA). The buffer used was 50 mm Tris, pH 7. A minimum of five spectra were accumulated for each sample and the contribution of the buffer was always subtracted. The resultant spectra were smoothed using j715 noise reduction software provided with the CD spectrophotometer. Gel filtration analysis of recombinant SR in the presence and absence of ATP Generally, we followed a previously published protocol [9]. Aliquots of 200 lL of approximately 2 mgÆmL )1 of recom- binant racemase eluted from the Ni-nitrilotriacetic acid affinity resin were injected into a GP 250 plus fast protein liquid chromatography system equipped with two P-500 pumps and a Superdex HR200 column (Amersham Bio- sciences, Piscataway, NJ, USA). Separation was performed at 25 °C and protein detection was performed at 280 nm. The flow rate was kept at 1 mLÆmin )1 and the buffer consisted of 50 mm Tris, pH 7.0, 50 mm NaCl, 1 mm dithiothreitol in the presence or absence of 10 lm ATP plus 100 lm Mg 2+ . We were unable to use concentrations of ATP above 10 lm due to the elevated absorbance signal that we obtained. Modelling hSR The servers used in this work for prediction of the tertiary structure of hSR were: sp3 (http://sparks.informatics.iupui. edu ⁄ hzhou ⁄ anonymous-fold-sp3.html) [26], 3d-shotgun (INUB predictor; http://inub.cse.buffalo.edu) [27] and 3d-jury (BioInfoBank Meta server; http://meta.bioinfo.pl/ submit_wizard.pl) [28]. Currently, these servers are consid- ered among the best performers for structure prediction as a result of the CAFASP4 experiment (Critical Assessment of Fully Automated Structure Prediction) [28]. Considering the prediction results, a full-atom 3D model of hSR was built by using the atom coordinates of SR from S. pombe (PDB code: 1V71) because it was provided as the best template for the human homologue. Sequence alignments were analysed with clustal w [29]. The quality of the final structure was assessed with the verify3d program [30] and also with procheck [31]. In the first case, the 3D profile score is high (approximately 60), which is typical for correct structures and, in the second case, the program indicated that the stereochemistry of the model is correct, with 99.3% of amino acid residues in the allowed regions of the Ramachandran plot (data not shown). 3D Superposition of protein struc- tures and other analyses were performed with software o [23]. Acknowledgements We would like to thank Dr Martı ´ nez del Pozo for many useful comments and corrections of the manu- script. We are also grateful to Dr Galve-Roperh for numerous comments and suggestions. This work was supported by grant BMC2006 05395 from the Spanish DGICYT. References 1 Boehning D & Snyder SH (2003) Novel neural modula- tors. Annu Rev Neurosci 26, 105–131. 2 Mustafa AK, Kim PM & Snyder SH (2004) D-Serine as a putative glial neurotransmitter. Neuron Glia Biol 1, 275–281. 3 Wolosker H, Blackshaw S & Snyder SH (1999) SR: a glial enzyme synthesizing D-serine to regulate gluta- mate-N-methyl-D-aspartate neurotransmission. Proc Natl Acad Sci USA 96 , 13409–13414. 4 Schell MJ, Molliver ME & Snyder SH (1995) D-serine, an endogenous synaptic modulator: localization to astrocytes and glutamate-stimulated release. Proc Natl Acad Sci USA 92, 3948–3952. 5 Mothet JP, Parent AT, Wolosker H, Brady RO Jr, Lin- den DJ, Ferris CD, Rogawski MA & Snyder SH (2000) D-serine is an endogenous ligand for the glycine site of the N-methyl-D-aspartate receptor. Proc Natl Acad Sci USA 97, 4926–4931. 6 Yasuda E, Ma N & Semba R (2001) Immunohistochemical evidences for localization and production of D-serine in some neurons in the rat brain. Neurosci Lett 299, 162–164. 7 Kartvelishvily E, Shleper M, Balan L, Dumin E & Wolosker H (2006) Neuron-derived D-serine release provides a novel means to activate N-methyl-D-aspar- tate receptors. J Biol Chem 281, 14151–14162. 8 Williams SM, Diaz CM, Macnab LT, Sullivan RK & Pow DV (2006) Immunocytochemical analysis of D-ser- ine distribution in the mammalian brain reveals novel anatomical compartmentalizations in glia and neurons. Glia 53, 401–411. 9 Cook SP, Galve-Roperh I, Martinez del Pozo A & Rodriguez-Crespo I (2002) Direct calcium binding results in activation of brain SR. J Biol Chem 277, 27782–27792. 10 Neidle A & Dunlop DS (2002) Allosteric regulation of mouse brain SR. Neurochem Res 27, 1719–1724. Activation of brain SR by GRIP, calcium and ATP F. Baumgart et al. 4570 FEBS Journal 274 (2007) 4561–4571 ª 2007 The Authors Journal compilation ª 2007 FEBS [...]... Miranda J, Panizzutti R, Foltyn VN & Wolosker H (2002) Cofactors of SR that physiologically stimulate the synthesis of the N-methyl-D-aspartate (NMDA) receptor coagonist D -serine Proc Natl Acad Sci USA 99, 14542–14547 12 Kim PM, Aizawa H, Kim PS, Huang AS, Wickramasinghe SR, Kashani AH, Barrow RK, Huganir RL, Ghosh A & Snyder SH (2005) SR: activation by glutamate neurotransmission via glutamate receptor. .. dehydrase IV Characterization of kinetic effect of adenosine monophosphate J Biol Chem 248, 8189–8199 21 Gerlt JA, Rabinowitz KW, Dunne CP & Wood WA (1973) The mechanism of action of 5¢-adenylic Activation of brain SR by GRIP, calcium and ATP 22 23 24 25 26 27 28 29 30 31 32 acid-activated threonine dehydrase V Relation between ligand-induced allosteric activation and the protomeroligomer interconversion J... 5699–5702 19 Mothet JP, Pollegioni L, Ouanounou G, Martineau M, Fossier P & Baux G (2005) Glutamate receptor activation triggers a calcium-dependent and SNARE proteindependent release of the gliotransmitter D -serine Proc Natl Acad Sci USA 102, 5606–5611 20 Dunne CP, Gerlt JA, Rabinowitz KW & Wood WA (1973) The mechanism of action of 5¢-adenylic acid-activated threonine dehydrase IV Characterization of kinetic... characterization and role of tetrahydrobiopterin in dimer formation J Biol Chem 271, 11462–11467 17 Im Y-J, Park SH, Rho SH, Lee JH, Kang GB, Sheng M, Kim E & Eom SH (2003) Crystal structure of GRIP1 PDZ6-peptide complex reveals the structural basis for class II PDZ target recognition and PDZ domain- mediated multimerization J Biol Chem 278, 8501–8507 18 Hung AY & Sheng M (2002) PDZ domains: structural... Biol Chem 248, 8200–8206 Gallagher DT, Gilliland GL, Xiao G, Zondlo J, Fisher KE, Chinchilla D & Eisenstein E (1998) Structure and control of pyridoxal phosphate dependent allosteric threonine deaminase Structure 6, 465–475 Jones TA, Zou JY & Cowan SW (1991) Improved methods for building protein models in electron density maps and the location of errors in these models Acta Crystallogr A 47, 110–119... Rodriguez-Crespo I (2004) Palmitoylation of inducible nitric-oxide synthase at Cys-3 is required for proper intracellular traffic and nitric oxide synthesis J Biol Chem 279, 55682–55689 Navarro-Lerida I, Portoles MT, Barrientos AA, Gavilanes F, Bosca L & Rodriguez-Crespo I (2004) Induction of nitric oxide synthase-2 proceeds with the concomitant downregulation of the endogenous caveolin levels J Cell Sci... Wolosker H (2006) Modulation of D -serine levels via ubiquitin-dependent proteasomal degradation of SR J Biol Chem 281, 20291–20302 15 Dong H, O’Brien RJ, Fung ET, Lanahan AA, Worley PF & Huganir RL (1997) GRIP: a synaptic PDZ domain- containing protein that interacts with AMPA receptors Nature 386, 279–284 16 Rodriguez-Crespo I, Gerber NC & Ortiz de Montellano PR (1996) Endothelial nitric-oxide synthase... improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice Nucleic Acids Res 22, 4673–4680 Eisenberg D, Luthy R & Bowie JU (1997) VERIFY3D: assessment of protein models with three dimensional profiles Methods Enzymol 277, 396–404 Laskowski RA, MacArthur MW, Moss DS & Thornton JM (1993) PROCHECK: a program to check the. .. Cell Sci 117, 1687–1697 Zhou H & Zhou Y (2005) Fold recognition by combining sequence profiles derived from evolution and from depth-dependent structural alignment of fragments Proteins: Struct Funct Bioinform 58, 321–328 Fischer D (2003) 3D-SHOTGUN: a novel, cooperative, fold-recognition meta-predictor Proteins 51, 434–441 Ginalski K, Eloffson A, Fischer D & Richlewski L (2003) 3D-Jury: a simple approach... receptor interacting protein and mediation of neuronal migration Proc Natl Acad Sci USA 102, 2105–2110 13 Fujii K, Maeda K, Hikida T, Mustafa AK, Balkissoon R, Xia J, Yamada T, Ozeki Y, Kawahara R, Okawa M et al (2006) SR binds to PICK1: potential relevance to schizophrenia Mol Psychiatry 11, 150–157 14 Dumin E, Bendikov I, Foltyn VN, Misumi Y, Ikehara Y, Kartvelishvily E & Wolosker H (2006) Modulation of . Insights into the activation of brain serine racemase by the multi-PDZ domain glutamate receptor interacting protein, divalent cations and ATP Florian Baumgart 1 , Jose ´ M. Manchen ˜ o 2 and. mixture. Characterization of the activation of brain SR by GRIP(468–1112) We next analysed whether larger ratios of PDZ6 domain: SR might be able to increase the synthesis of d -serine. We tested up to a ratio of 23. SR (left) and the PDZ6 domain of GRIP (middle). The circular dichroism spectrum of purified PDZ6 domain of GRIP is shown in the right panel. (C) D -Serine synthesis by recombinant SR in the absence