Transcription factor specificity protein (SP1) and activating protein 2a (AP-2a) regulate expression of human KCTD10 gene by binding to proximal region of promoter Rushi Liu1,*, Aidong Zhou1,*, Daolong Ren1,*, Ailan He1, Xiang Hu1, Wenfeng Zhang1, Liping Yang1, Mingjun Liu1, Hong Li1, Jianlin Zhou1, Shuanglin Xiang1 and Jian Zhang1,2 Key Laboratory of Protein Biochemistry and Development Biology of State Education Ministry of China, Hunan Normal University, China Model Organisms Division, Shanghai Second Medical University, China Keywords AP-2a; KCTD10; promoter; regulatory element; SP1 Correspondence J Zhang, Key Laboratory of Protein Biochemistry and Development Biology of State Education Ministry of China, College of Life Sciences, Hunan Normal University, Changsha, Hunan 410081, China Fax: +86 731 887 2792 Tel: +86 731 887 2792 E-mail: Zhangjian@hunnu.edu.cn *These authors contributed equally to this work (Received 25 October 2008, revised December 2008, accepted 11 December 2008) doi:10.1111/j.1742-4658.2008.06855.x Potassium channel tetramerization domain-containing 10 gene (KCTD10) belongs to the polymerase delta-interacting protein (PDIP1) gene family Mouse KCTD10 was thought to interact with proliferating cell nuclear antigen and the small subunit of polymerase d, and to have roles in DNA repair, DNA replication and cell-cycle control To better understand the regulatory mechanism of KCTD10 expression, we characterized the promoter of human KCTD10 containing a 639 bp fragment of the 5¢-flanking region ()609 ⁄ +30) A primer extension assay identified the transcription start site as an A, 63 bp upstream of the start codon The promoter region contains neither a TATA box nor a CCAAT box, but a CpG island was found near to the transcription start site Deletion mutagenesis showed that the region from )108 to +30 was indispensable to the promoter activity, and site-directed mutation analysis in this proximal promoter region of KCTD10 revealed two important transcription regulatory elements of specificity protein (SP1) and activating protein-2 (AP-2) An in vivo chromatin immunoprecipitation assay further demonstrated that SP1 and AP-2a could bind to this proximal promoter region Moreover, using a luciferase reporter assay, quantitative real-time RT-PCR and western blot analysis, both overexpression and RNA interference of SP1 and AP-2a indicated that the binding of SP1 to the proximal promoter region stimulated the promoter activity and endogenous KCTD10 expression, whereas binding of AP-2a to this region showed opposite effects Rat potassium channel tetramerization domain-containing 10 (KCTD10) gene was recently cloned and identified as a new member of the polymerase deltainteracting protein (PDIP1) gene family The amino acid sequence of rat KCTD10 shares high levels of identity with other members in this family; for example, 65.1% identity with PDIP1 and 66.7% identity with tumor necrosis factor alpha-induced protein (TNFAIP1), respectively Like PDIP1 and TNFAIP1, KCTD10 protein also contains a BTB ⁄ POZ domain and a potassium channel tetramerization (K-tetra) domain (a relative of BTB ⁄ POZ domain) at its N-terminus, and a proliferating cell nuclear antigen (PCNA)-binding motif at its C-terminus [1] PCNA, a multifunctional protein, plays critical roles in a variety of eukaryotic cellular processes, Abbreviations AP-2, activating protein-2; ChIP, chromatin immunoprecipitation; DPE, downstream promoter element; KCTD10, potassium channel tetramerization domain-containing 10; PCNA, proliferating cell nuclear antigen; PDIP1, polymerase delta-interacting protein 1; Sp1, specificity protein 1; TNFAIP1, tumor necrosis factor alpha induced protein 1; TNF-a, tumor necrosis factor-alpha; TSS, transcription start site 1114 FEBS Journal 276 (2009) 1114–1124 ª 2009 Hunan Normal University Journal compilation ª 2009 FEBS R Liu et al including DNA replication, DNA repair and cellcycle progression by interacting with proteins involved in these processes The best-understood role of PCNA was as a slide clamp to tether DNA polymerase d to its template for high processive DNA synthesis [2,3] Many proteins have been shown to bind PCNA; they all contain a consensus PCNAbinding motif, which was initially identified in p21 [4] Recent studies have shown that PDIP1 and TNFAIP1 could interact with PCNA and stimulate PCNA-dependent polymerase d activity [5,6] KCTD10 can also interact with the small subunit of DNA polymerase d (p50) and PCNA [1] These findings suggested that PCNA might function as a regulatory target of the PDIP1 gene family including KCTD10, coordinating DNA replication, DNA repair and cell-cycle progression Tumor necrosis factor-alpha (TNF-a) is a multifunctional cytokine involved in a variety of biological activities, such as apoptosis, proliferation, B-cell activation and some inflammatory responses [7] It is known that TNF-a induces cell proliferation in liver regeneration after hepatocyte loss caused by surgical resection or chemical injury [8] Like other members of the PDIP1 gene family, KCTD10 is also supposed to be induced by TNF-a [1] KCTD10 is an interacting partner of PCNA and the small subunit of pol d, so it probably plays some roles in cell proliferation by linking TNF-a signaling to DNA synthesis Recently, a transgenic Caenorhabditis elegans model of Alzheimer’s disease was achieved by expressing human b-amyloid peptide [9] In the brain of transgenic C elegans, TNFAIP1 expression was found to be markedly increased; and the brain region with minimum pathological symptoms showed the highest expression of TNFAIP1, suggesting that TNFAIP1 may have a protective function during Alzheimer’s disease progression [9] These studies indicated that the PDIP1 gene family, including KCTD10, might function in the proliferation and development of cells, or in disease progression Although the function of KCTD10 is very important, regulation of its expression remains unclear We characterized a 639 bp genomic fragment in the 5¢-flanking region of human KCTD10; and identified the binding sites of two transcription factors, specificity protein (SP1) and activating protein-2a (AP-2a), in the promoter region of KCTD10 We found that the proximal promoter region from )108 to +30 was indispensable for basal promoter activity of KCTD10; and SP1 and AP-2a can regulate the promoter activity and endogenous KCTD10 expression oppositely through binding this region SP1 and AP-2a regulate KCTD10 Results Analysis of genomic structure and identification of transcription start site of human KCTD10 To determine the genomic structure of human KCTD10, a full-length cDNA sequence of human KCTD10 was used to search the human genome database The results showed that human KCTD10 was mapped to chromosome 12q24.11 region, spanned  21.3 kb and contained five exons Mouse and human KCTD10 share identical organization and exons with similar length (Fig 1A) In the human genome, KCTD10 was arranged in the reverse direction to its neighbor gene – ubiquitin protein ligase E3B (UBE3B, NM_183415) The 5¢-flanking region was very short, only  380 bp between the start the codon of human KCTD10 and 5¢ cDNA end of UBE3B (Fig 1B) The transcription start site (TSS) of KCTD10 was determined by primer extension assay An antisense primer on the 3¢-end of the first exon was labeled with [32P]ATP[cP], and extended with AMV reverse transcriptase using total RNAs from HeLa cells as template; simultaneously, sequencing reaction was performed using the same primer Nucleotide A, 63 bp upstream of the start codon, was identified as the TSS by sequence reading (Fig 2) Identification of the cis-regulatory region and trans-regulatory factors responsible for the promoter activity of human KCTD10 Computer-aided analysis was performed to predict the potential cis-elements regulating KCTD10 expression in the 5¢-flanking region, a 639 bp genomic sequence upstream of the start codon of KCTD10 We did not find any TATA box or CCAAT box around the TSS, but checked out a CpG island with 64.7% GC content throughout the whole 639 bp sequence The 5¢-flanking region of mouse KCTD10 displayed very similar genomic organization to that of human KCTD10 To characterize potential sequences involved in the regulation of KCTD10 expression, the 5¢-flanking region was amplified, and inserted into the upstream of pTAL-Luc – a promoter-free luciferase reporter vector A series of 5¢ deletion constructs with a common 3¢-end except for construct P ()609 ⁄ )241) were generated using different primers (Table 1) Luciferase activities of these constructs were assayed in transfected HeLa cells As shown in Fig 3, construct P ()609 ⁄ +30) containing the whole 639 bp sequence FEBS Journal 276 (2009) 1114–1124 ª 2009 Hunan Normal University Journal compilation ª 2009 FEBS 1115 SP1 and AP-2a regulate KCTD10 R Liu et al A B Fig Genomic structure of human and mouse KCTD10 genes, and the 5¢-flanking region sequence of human KCTD10 (A) Genomic organization of human and mouse KCTD10 genes Solid boxes indicate coding region, and open boxes indicate 5¢UTR and 3¢UTR (B) 5¢-Flanking region of human KCTD10 from )609 to +30 KCTD10 was arranged in the reverse direction to its neighboring gene ubiquitin protein ligase E3B (UBE3B, NM_183415); TSS of human KCTD10 is denoted +1, and the start codon (ATG) is indicated by solid box The consensus binding sites of the transcription factors with high regulatory activities are boxed, other sites with no or weak regulatory activities are underlined produced  17.5-fold higher luciferase activity compared with the control pLuc vector Taking this as a 100% base, deletion from )609 to )343 showed a 7.4% increase; construct P ()609 ⁄ )241), in which 271 bp of the 3¢-end was deleted, presented almost no promoter activity; by contrast, construct P ()241 ⁄ +30) containing this 271 bp of the 3¢-end showed only a 8.7% increase These results suggested that the functional promoter region was located in the 271 bp region of the 3¢-end (from )241 to +30) Further deletion extended to )203 showed an  28.1% decrease compared with P ()241 ⁄ +30), whereas deletion to )108 showed an  67.4% increase compared with P ()203 ⁄ +30) This indicated that the potential positively-regulating region might exist from )241 to )203, and the potential negativeregulating region might exist from )203 to )108 Deletion to )13 sharply decreased luciferase activity to only 1.68% of P ()609 ⁄ +30) The 5¢-flanking region contained the functional promoter; within it, the region from )108 to +30 is essential for the promoter activity Using tfsearch and matinspector programs, multiple potential binding sites of transcription factors were found in the promoter region from )108 to +30 (Fig 1B), including two binding sites for Sp1, AP-2a and c-myb, and one CACCC box 1116 Mutational analysis revealed that mutation of the upstream Sp1 site (Sp1.1) decreased the promoter activity by 46.9%, whereas mutation of the downstream AP-2a site (AP-2.2) strongly increased the promoter activity by 88.1% (Fig 4A) However, although other sites were mutated individually, either no effects (c-myb.2, AP-2.1 and Sp1.2, data not shown) or very modest effects (mutation of the c-myb.1 site decreased the promoter activity by 28.6%, and mutation of CACCC box increased the promoter activity by 27.4%) were observed (Fig 4A) Taken together, Sp1.1 and AP-2.2 were two important elements related to the regulation of human KCTD10 expression By aligning the 5¢-flanking region of both human and mouse KCTD10 promoters (human from )144 to )45, mouse from )143 to )44 relative to the start codon), we found that two sequences shared great identities, and Sp1.1 sites were highly conserved (Fig 4B) Although one nucleotide varied from G to T in the AP-2.2 site (from )77 to )69) of mouse KCTD10 promoter, the sequence (GCCCCCTGC) might also be able to be recognized by AP-2a, and play similar role in the regulation of KCTD10 expression Thus, we proposed that the regulatory mechanisms of KCTD10 might be conserved between human and mouse FEBS Journal 276 (2009) 1114–1124 ª 2009 Hunan Normal University Journal compilation ª 2009 FEBS R Liu et al SP1 and AP-2a regulate KCTD10 Roles of Sp1 and AP-2a in the regulation of the promoter activity and the expression of human KCTD10 Fig Transcription start site of human KCTD10 Antisense primer from +21 to +40 was labeled with [32P]ATP[cP] using T4 polynucleotide kinase, then annealed to total RNAs template from HeLa cells, and extended with AMV reverse transcriptase DNA sequence ladder was obtained using the same primer and separated on the same gel The extended product is indicated by the arrow (PE means primer extension) Binding of Sp1 and AP-2a to the corresponding sites in the promoter of human KCTD10 in vivo To confirm that Sp1 and AP-2a bind to the authentic endogenous cis-elements in the KCTD10 promoter, we generated a pool of DNA fragments from HeLa cell lysates using chromatin immunoprecipitation (ChIP) with antibodies against Sp1 or AP-2a The ChIP-DNA was used as a template for PCR amplification of the genomic regions containing Sp1 or AP-2a binding elements in the KCTD10 promoter, and representative ChIP-PCR results were shown in Fig The chromatin fragment containing Sp1- or AP-2a-binding sites in the KCTD10 promoter was precipitated by antibodies against Sp1 or AP-2a but not by control IgG, indicating that endogenous Sp1 or AP-2a proteins specifically bound the Sp1 or AP-2a sites, and worked in the basal state to regulate KCTD10 transcription, respectively To test the effects of Sp1 and AP-2a binding on KCTD10 promoter activity, we performed a luciferase assay in HeLa and HepG2 cells by overexpression of Sp1 or AP-2a In HeLa cells, co-transfected pCMVSp1 increased the luciferase activity of construct P ()241 ⁄ +30) by 58.3%; but only weakly increased the luciferase activity of the Sp1.1 site mutated construct Mt-Sp1.1 (Fig 6A) In AP-2a-deficient HepG2 cells, several reporter constructs containing 5¢-flanking region of KCTD10 such as P ()609 ⁄ +30), P ()108 ⁄ +30) and P ()13 ⁄ +30) presented higher luciferase activities than in AP-2a-normal HeLa cells (Fig 6B); and co-transfected pCMV–AP-2a deceased the luciferase activity of construct P ()241 ⁄ +30) in a dose-dependent manner (Fig 6C) These data suggested that Sp1 upregulated, but AP-2a downregulated, the promoter activity of human KCTD10 Finally, to determine if the expression changes of AP-2a or Sp1 alter the KCTD10 level, we checked endogenous KCTD10 expression in HeLa cells at the mRNA and protein levels using quantitative real-time RT-PCR and western blot through overexpressing or suppressing AP-2a or Sp1 As shown in Fig 7A, mRNA levels in HeLa cells were measured using quantitative real-time RT-PCR, and presented as base 10 logarithms For AP-2a, overexpression of AP-2a (A1, purple bar versus yellow bar) led to a 5.6-fold decrease of KCTD10 at its transcription level (A3, purple bar versus yellow bar, base 10 logarithms); whereas AP-2a knockdown (A1, red bar versus yellow bar) caused a 2.34-fold induction of KCTD10 mRNA level (A3, red bar versus yellow bar, base 10 logarithms) For Sp1, its overexpression (A1, green bar versus yellow bar) resulted in a 12.0-fold increase (A3, green bar versus yellow bar, base 10 logarithms); whereas its knockdown (A1, blue bar versus yellow bar) resulted in a 1.9-fold decrease in KCTD10 mRNA level (A3, blue bar versus yellow bar, base 10 logarithms) Western blot verified these results from quantitative real-time RT-PCR again As shown in Fig 7B–D, whereas AP-2a suppression by RNA interference (RNAi) increased KCTD10 (lane in Fig 7B,D), AP-2a overexpression decreased KCTD10 (lane in Fig 7B,D) However, overexpression of Sp1 increased KCTD 10 (Fig 7C lane 2, Fig 7D lane 4), but silencing of Sp1 decreased KCTD10 (Fig 7C lane 3, Fig 7D lane 5) So we concluded that the expression of KCTD10 could be regulated by Sp1 positively, but by AP-2a negatively FEBS Journal 276 (2009) 1114–1124 ª 2009 Hunan Normal University Journal compilation ª 2009 FEBS 1117 SP1 and AP-2a regulate KCTD10 R Liu et al Table Oligonucleotides used in this study Name Sequence(5¢- to -3¢) Purpose PLuc-KCTD10-R P ()609 ⁄ +30)-F1 P ()343 ⁄ +30)-F2 P ()241 ⁄ +30)-F3 P ()203 ⁄ +30)-F4 P ()108 ⁄ +30)-F5 P ()13 ⁄ +30)-F6 P ()609 ⁄ )241)-R AP-2a ⁄ chipF AP-2a ⁄ chipR Sp1 ⁄ chipF Sp1 ⁄ chipR AP-2a ⁄ si Sp1 ⁄ si KCTD10FP KCTD10RP Sp1FP Sp1RP AP-2aFP AP-2aRP b-actinFP b-actinRP CCAAGCTTCGGACTGAGAGAGGCAGGAA GGGGTACCTGGAGCACACACGCCAGATC GGGGTACCCGACGCACTACCGCCATCGT GGGGTACCCTTCTTCGCCCGGGAAGGAA GGGGTACCGCAGCTGAAATAGCGGAGGT GGGGTACCAACGGACGGCTTAAGACGTT GGGGTACCCCGGCTGGCGTGAGCTGGGT CCAAGCTTTTCCTTCCCGGGCGAAGAAG GGGGCGGAAGTGGGGTG GAAAAGTCGGAGGACG GGACTACCTGGAGTGATGCCTAA CCCATCAACGGTCTGGAACT GCUCCACCUCGAAGUACAATT NNAGCGCUUCAUGAGGAGUGA TTGCGGTTTAGGTACATCCA TGTGGCTCTGTGGAACATTT GGACTACCTGGAGTGATGCCTAA CCCATCAACGGTCTGGAACT CAACGTTACCCTGCTCACATCA CAGGTCGGTGAACTCTTTGCA GCGCGGCTACAGCTTCA CTTAATGTCACGCACGATTTCC Mutagenesis ChIP ChIP ChIP ChIP RNAi RNAi Real-time PCR Fig Function analysis of 5¢-flanking region of human KCTD10 promoter Constructs containing sequentially deleted fragments of human KCTD10 5¢-flanking region (from )609 to +30) were transfected into HeLa cells, luciferase activities were then measured 36 h after transfection The region from )108 to +30 is essential for the promoter activity Data (means ± SD) were presented as the percentage of the control, P ()609 ⁄ +30) Vacant vector pTAL-luc only containing a basal TATA-like promoter was used as experimental control Discussion Our data showed that KCTD10 contains neither a canonical TATA box nor a CCAAT motif in the promoter region, but a cluster of CpG dinucleotides near to the TSS Although only a single TSS of human KCTD10 was detected 63 bp upstream of the start codon, and deletion mutagenesis demonstrated that the region from )108 to +30 was indispensable for basal promoter activity, we still could not exclude the exis1118 tence of other potential weak initial sites or other weak promoter region which were often found in CpG islands containing and TATA-free promoters [10–12] Typically, GC-rich promoter regions lack TATA or DPE core elements, and are frequently found to be bound with transcription factor Sp1 Sp1 helps to maintain the hypomethylation of CpG islands [13,14], and interacts with some components of the basal transcription complex [15,16]; therefore it plays a critical role in the assembly of the transcription start complex FEBS Journal 276 (2009) 1114–1124 ª 2009 Hunan Normal University Journal compilation ª 2009 FEBS R Liu et al SP1 and AP-2a regulate KCTD10 A Fig Identification of potential binding sites of transcription factors in the proximal promoter region (A) Site-directed mutation analysis of c-myb.1, CACCC-box, Sp1.1 and AP-2.2 sites in the proximal promoter region of human KCTD10 Data (means ± SD) were presented as the percentage versus the wild-type control P ()203 ⁄ +30) The cross (·) indicates the mutated sites SREBP-1, sterol regulatory element binding protein-1 (B) Alignment of the 5¢-flanking sequences upstream of the start codon of human and mouse KCTD10 B Fig In vivo ChIP assays of Sp1.1 and AP-2.2 binding sites in the proximal promoter region of human KCTD10 Mouse monoclonal anti-Sp1 (lane 2), or rabbit polyclonal anti-(AP-2a) (lane 5), or nonimmune mouse and rabbit IgG (lanes 3, 6) were used in ChIP The DNA fragments derived from AP-2a-specific or Sp1-specific immunoprecipitations were amplified using primers flanking the binding elements of Sp1 or AP-2a A portion of the total input was used as positive control (lanes 1, 4) to selectively activate transcription [13,14,17,18] In vivo ChIP assays confirmed that Sp1 could specifically recognize the GC-box element in the proximal promoter region of KCTD10 Luciferase assays in HeLa cells indicated that mutation of the Sp1-binding site decreased the promoter activity by 46.9%, whereas overexpression of Sp1 increased the promoter activity by 58.3% The expression of endogenous KCTD10 was downregulated 1.9-fold by Sp1 silencing, and upregulated 12.0-fold by Sp1 overexpression Western blot results of KCTD10 were identical to quantitative real-time RT-PCR Sp1 is an essential and positive regulator for the transcription of human KCTD10 The binding affinity and transcriptional specificity of Sp1 can be altered by interaction with other cofactors in the binding sites near to Sp1 recognition motif, such as C ⁄ EBP [19], NF-jB [20], AP-1 [21] or AP-2 [22,23] In particular, AP-2 binding sites have been found in most Sp1-dependent promoters AP-2 was a tissuespecific transcription factor, playing critical roles in the regulation of gene expression during mammalian development, differentiation and carcinogenesis [24–27] It was reported that AP-2 could stimulate AP-2-dependent promoter activities in a tissue-specific manner [28], but suppress Sp1-dependent housekeeping promoter activities [22,23,29] In this study, we determined the functional role of AP-2a in the regulation of KCTD10 Mutation of the AP-2-binding site increased KCTD10 promoter activity by 88.1%, whereas overexpression of AP-2a in HepG2 cells inhibited promoter activity in a dose-dependent manner AP-2a silencing increased the expression of endogenous KCTD10 by 2.3-fold, whereas AP-2a overexpression decreased the expression of endogenous KCTD10 by 5.6-fold AP-2a is a negative regulator for KCTD10 Transcriptional interference, in which overexpression of one transcription factor resulted in inhibition of another, was often found in the regulation of eukaryotic gene expression The repression of AP-2 on Sp1dependent transcriptional activity has been explained in three models: (a) steric hindrance model – AP-2 FEBS Journal 276 (2009) 1114–1124 ª 2009 Hunan Normal University Journal compilation ª 2009 FEBS 1119 SP1 and AP-2a regulate KCTD10 R Liu et al Fig Effects of Sp1 and AP-2a expression level on the promoter activity of human KCTD10 (A) The relative luciferase activities of P ()241 ⁄ +30) and Mt-Sp1.1 mutant were examined in pCMV–Sp1transfected HeLa cells pCMV–myc was used to equilibrate the plasmid quantity, and pCMV–LacZ was used as a transfection efficiency control Data (means ± SD) were presented as the percentages of wild-type promoter control (B) Constructs P ()609 ⁄ +30), P ()108 ⁄ +30), P ()13 ⁄ +30) and pTAL-luc control were transfected into HeLa or HepG2 cells, respectively Luciferase activities were presented as the percentages of pTAL-luc control (C) The relative luciferase activities of P ()241 ⁄ +30) were inhibited by AP-2a overexpression in a dose-dependent manner in pCMV-AP-2a transfected HepG2 cells pCMV–myc was used to equilibrate the plasmid quantity, and pCMV–LacZ was used as a transfection efficiency control A B C represses Sp1-dependent promoter activity by interfering with the activation of transcription initiation by Sp1 via specific steric interference machinery [29]; (b) 1120 interaction model – the interaction between Sp1 and AP-2 affects formation of the Sp1–DNA complex [23]; (c) competing model – the AP-2 and Sp1 binding sites overlap, and the AP-2 binding competes with the SP1 binding [22] Our results reveal that the repressive activity of AP-2a on KCTD10 transcription works through inhibition of Sp1 activity It has been proposed that the ratio of Sp1 to AP-2a might be responsible for the transcriptional state of Sp1-dependent promoters; for example, Chen et al have shown that K3 keratin gene transcription was regulated by the ratio of Sp-1 to AP-2 in differentiating rabbit corneal epithelial cells [29] In our case, even though there were similar levels of Sp1 in both HeLa and HepG2 cells, KCTD10 promoter activity is significantly lower in HeLa cells than in HepG2 cells; this is probably due to the AP-2 deficiency When AP-2a was overexpressed in HepG2 cells, KCTD10 promoter activity decreased in a dose-dependent manner However, AP-2a silencing increased KCTD10 transcription, whereas AP-2a overexpression repressed KCTD10 transcription in HeLa cells It is possible that the relative ratio of Sp1 to AP-2a in a particular cell environment determined the activation or repression of human KCTD10 Our previous study demonstrated that mouse PDIP1 could also be regulated by Sp1 and AP-2, and the regulating sites were conserved in human, mouse and rat [30], which implied that the PDIP1 gene family might have similar regulating mechanisms in different species It has been reported that Sp1 binding to the promoters were critical for the activation of TNF-a- stimulated ADAM17 [31] and MCP-1 genes [32]; however, we did not detect significant changes in KCTD10 expression in HeLa cells after TNF-a induction (data not shown) This suggested that the isolated 5¢-flanking region of KCTD10 might not contain a TNF-a responsive element Although our results confirmed the roles of two transcription factors, Sp1 and AP-2a, in the FEBS Journal 276 (2009) 1114–1124 ª 2009 Hunan Normal University Journal compilation ª 2009 FEBS R Liu et al A SP1 and AP-2a regulate KCTD10 Experimental procedures Mapping TSS by primer extension B C D Fig Endogenous expression change in human KCTD10 after overexpressing, or suppressing Sp1 and AP-2a (A) mRNA levels in HeLa cells were measured using quantitative real-time RT-PCR, and presented as base 10 logarithms A1, mRNA levels of AP-2a after overexpressing Ap-2a, or suppressing AP-2a by RNA interference; A2, mRNA levels of SP1 after overexpressing Sp1, or suppressing Sp1 by RNA interference; A3, mRNA levels of human KCTD10 after overexpressing Ap-2a or Sp1, or suppressing AP-2a or Sp1 by RNA interference mRNA levels in HeLa cells transfected with Myc vector were used as negative controls In A3, folds of human KCTD10 mRNA levels versus negative control were calculated All experiments were run three times (B–D) The protein expressions of AP-2a, Sp1 and KCTD10 after overexpressing Ap-2a or Sp1, or suppressing AP-2a or Sp1 by RNA interference in HeLa cells were examined using western blotting b-Actin was used as internal control; Si-NC represents scramble siRNA oligos which can not knockdown AP-2a, SP-1 and KCTD10 regulation of KCTD10 expression, other regulatory proteins involved in the transcription control of KCTD10 still need to be further investigated The TSS of human KCTD10 was determined using primer extension kit (Promega, Madison, WI, USA) according to the manufacturer’s instruction Briefly, an anti-sense primer (5¢-TCTCCAAACCCGGACTGAGA-3¢) corresponding to the position from +21 to +40 was labeled with [32P]ATP[cP] using T4 polynucleotide kinase, and purified by precipitation in 75% ethanol The labeled primer was incubated with 25 lg of total RNA from HeLa cells at 62 °C for 30 min, and then extended with AMV reverse transcriptase at 42 °C for h; sequencing reaction was further performed using CycleReaderÔ DNA Sequencing kit (Invitrogen, San Diego, CA, USA) with the same labeled primer The products of primer extension and sequencing reaction were resolved on 6% denaturing polyacrylamide sequencing gel Computer analysis of KCTD10 promoter structures, cloning of the promoter fragment, construction of deletion and point-mutated vectors Promoter searching was performed using proscan (http:// www-bimas.cit.nih.gov) and promoterinspector (http:// www.genomatix.de) programs Transcription factor binding sites in the 5¢-flanking region of human KCTD10 were predicted using tfsearch (http://www.cbrc.jp/research/db/ TFSEARCH.html) CpG island in this region was analyzed (http://cpgislands.usc.edu) using the criteria of CG percentages over 50%, calculated or expected CpG ratio over 0.6 and a minimal length of 200 bases The human genomic chromosome 12 clone (NT_ 009775.15) containing KCTD10 was identified by searching the human genome using full-length KCTD10 cDNA sequence A 639 bp genome fragment upstream of the start codon (ATG) and other five 5¢-deletion mutants were obtained by PCR from human genomic DNA using the 3¢-end primer pLuc-KCTD10-R and the upstream 5¢-end primers F1 to F6 (Table 1), and subcloned into the KpnI ⁄ HindIII sites of pTAL-Luc vector (Clontech, Mountain View, CA, USA) A 3¢-deletion mutant was constructed using the primers P ()241 ⁄ +30)-F3 and P ()609 ⁄ )241)-R Site-directed mutants derived from the P ()203 ⁄ +30) construct were generated by overlapping extension PCR as described previously [10] In brief, in the first round, two PCR were performed in parallel using construct P ()203 ⁄ +30) as a template: one with a wild-type forward primer P ()203 ⁄ +30)-F4 and a reverse mutated primer, the other with a forward mutated primer (complementary to the reverse mutated primer) and a wild-type reverse primer PLuc–KCTD10-R; in the second round, equal molar mixture of the two PCR products was used as template, P ()203 ⁄ +30)-F4 and pLuc–KCTD10-R were used as primers The final PCR products were similarly subcloned FEBS Journal 276 (2009) 1114–1124 ª 2009 Hunan Normal University Journal compilation ª 2009 FEBS 1121 SP1 and AP-2a regulate KCTD10 R Liu et al into pTAL–luc vector All constructs were confirmed by DNA sequencing Luciferase reporter assay HeLa and HepG2 cells were cultured in DMEM (Invitrogen) supplemented with 10% fetal bovine serum, mm l-glutamine, 100 mL)1 penicillin and 100 lgỈmL)1 streptomycin at 37 °C in a 5% CO2 incubator When cells reach 90% confluence in 24-well plate, the culture medium was replaced with serum- and antibiotic-free medium h before transfection; then 0.5 lg of luciferase reporter plasmids were co-transfected with 0.3 lg of b-galactosidase expression vector pCMV-LacZ using LipofectamineÔ 2000 Reagent (Invitrogen); h after transfection, cells were washed, and fresh medium supplemented with serum and antibiotics was put back again; cell lysates were collected 36 h after transfection and assayed for luciciferase activity using the Luciferase Assay System (Promega) Mammalian expression vectors of human Sp1 and AP-2a The human Sp1 coding sequence was amplified from HeLa first-strand cDNA using forward primer with EcoRI site (underlined) and reverse primer with SalI site in 5¢-end (forward primer: 5¢-AGAATTCCTGCCACCATGAGCGAC CA-3¢, reverse primer: 5¢-CGTCGACTG ATCTCAGAA GCCATTTTGC-3¢) The PCR product was subcloned into pCMV–HA (Clontech) at EcoRI ⁄ SalI sites The human AP-2a coding sequence was amplified from a human brain cDNA library using the primer shown in Table 1, and subcloned into pCMV–HA at EcoRI ⁄ XhoI sites Plasmids pCMV–Sp1 and pCMV–AP-2a were confirmed by sequencing, and used to overexpress Sp1 and AP-2a in mammalian cells All expressed proteins were confirmed by SDS–PAGE and western blotting ChIP assay Sequence-specific DNA binding activities of Sp1 and AP-2a to KCTD10 promoter were confirmed by in vivo ChIP assays EZ ChIPÔ Kit (Upstate, Temecula, CA, USA) was used following the manufacturer’s instruction Briefly, cells were cross-linked for 10 in 1.6% formaldehyde solution; for every mg of protein extracts, 10 lg of mouse IgG bound to protein A–Sepharose was used for h pre-clear with shaking at °C; protein extracts were then immunoprecipitated with lg of rabbit polyclonal anti-(AP-2a) or lg of mouse monoclonal anti-Sp1 (Santa Cruz Biotech, Santa Cruz, CA, USA) by rotating overnight at °C To generate the pool of DNA fragments, protein extracts from 10 cm plate culture of HeLa cells were immunoprecipitated; the immunocomplexes were then washed and eluted; after 1122 reversion of cross-link, the DNA fragments were purified using spin columns The PCR primers for ChIP assay (shown in Table 1) were designed to flank the Sp1 and AP-2a sites in KCTD10 promoter Real-time quantitative RT-PCR and western blot Specific small interfering RNA (siRNA) against AP-2a (5¢-GCUCCACCUCGAAGUACAATT-3¢) and Sp1 (5¢-NN AGCGCUUCAUGAGGAGUGA-3¢) [12] were synthesized from Invitrogen to suppress the endogenous expression of Sp1 and AP-2a; pCMV–Sp1 and pCMV–AP-2a were used to overexpress Sp1 and AP-2a The cultured cells were transfected using LipofectamineÔ 2000 according to the manufacturer’s instruction; 24 h later after transfection, total RNAs were extracted from 107 cells with TRIzol reagent (Invitrogen); RT-PCR was carried out using a twostep strategy following the manufacturer’s manual (Promega) The primers for quantitative real-time RT-PCR of KCTD10 were shown in Table 1, and b-actin was used for internal normalization In parallel, nuclear extracts were prepared from the transfected cells; after heating and separation on 12.5% denaturing polyacrylamide gel, proteins were transferred onto nitrocellulose membranes, and then analyzed by western blot using rabbit polyclonal serum against AP-2a or Sp1 (Santa Cruz Biotech) Acknowledgements This work was supported in part by the National Natural Science Foundation of China (No 30771082, 30571005), the 973 project of Ministry of Science and Technology of China (No 2005CB522505, 2006CB943506), the Hunan Provincial Natural Science Foundation of China (No 08JJ3082), Project of Hunan Science and Technology Commission: run foundation of large-scale precision instrument and management of experiment animals (2060599), Project of Changsha Science and Technology Department (K0803107-21) Changsha, the Cultivation Fund of the Key Scientific and Technical Innovation Project, Ministry of Education of China (No 705041), the Provincial Science & Technology Department of Hunan (05FJ4016), and provincial Education Department of Hunan (No 05C391, 07C563) References Zhou J, Ren K, Liu X, Xiong X, Hu X & Zhang J (2005) A novel PDIP1-related protein, KCTD10, that interacts with proliferating cell nuclear antigen and DNA polymerase delta Biochim Biophys Acta 1729, 200–203 FEBS Journal 276 (2009) 1114–1124 ª 2009 Hunan Normal University Journal compilation ª 2009 FEBS R Liu et al Tan CK, Castillo C, So AG & Downey KM (1986) An auxiliary protein for DNA polymerase-delta from fetal calf thymus J Biol Chem 261, 12310–12316 Prelich G, Tan CK, Kostura M, Mathews MB, So AG, Downey KM & Stillman B (1987) Functional identity of proliferating cell nuclear antigen and a DNA polymerase-delta auxiliary protein Nature 326, 517–520 Warbrick E (1998) PCNA binding through a conserved motif Bioessays 20, 195–199 He H, Tan CK, Downey KM & So AG (2001) A tumor necrosis factor alpha- and interleukin 6-inducible protein that interacts with the small subunit of DNA polymerase delta and proliferating cell nuclear antigen Proc Natl Acad Sci USA 98, 11979–11984 Zhou J, Hu X, Xiong X, Liu X, Liu Y, Ren K, Jiang T, Hu X & Zhang J (2005) Cloning of two rat PDIP1-related genes and their interactions with proliferating cell nuclear antigen J Exp Zool A Comp Exp Biol 303, 227–240 Fiers W, Beyaert R, Boone E, Cornelis S, Declercq W, Decoster E, Denecker G, Depuydt B, De Valck D, De Wilde G et al (1995) TNF-induced intracellular signaling leading to gene induction or to cytotoxicity by necrosis or by apoptosis J Inflamm 47, 67–75 Fausto N (2000) Liver regeneration J Hepatol 32, 19–31 Link CD, Taft A, Kapulkin V, Duke K, Kim S, Fei Q, Wood DE & Sahagan BG (2003) Gene expression analysis in a transgenic Caenorhabditis elegans Alzheimer’s disease model Neurobiol Aging 24, 397–413 10 Arman M, Calvo J, Trojanowska ME, Cockerill PN, Santana M, Lopez-Cabrera M, Vives J & Lozano F (2004) Transcriptional regulation of human CD5: important role of Ets transcription factors in CD5 expression in T cells J Immunol 172, 7519–7529 11 Lavie L, Maldener E, Brouha B, Meese EU & Mayer J (2004) The human L1 promoter: variable transcription initiation sites and a major impact of upstream flanking sequence on promoter activity Genome Res 14, 2253– 2260 12 Gum JR Jr, Hicks JW, Crawley SC, Dahl CM, Yang SC, Roberton AM & Kim YS (2003) Initiation of transcription of the MUC3A human intestinal mucin from a TATA-less promoter and comparison with the MUC3B amino terminus J Biol Chem 278, 49600– 49609 13 Brandeis M, Frank D, Keshet I, Siegfried Z, Mendelsohn M, Nemes A, Temper V, Razin A & Cedar H (1994) Sp1 elements protect a CpG island from de novo methylation Nature 371, 435–438 14 Macleod D, Charlton J, Mullins J & Bird AP (1994) Sp1 sites in the mouse aprt gene promoter are required to prevent methylation of the CpG island Genes Dev 8, 2282–2292 15 Gill G, Pascal E, Tseng ZH & Tjian R (1994) A glutamine-rich hydrophobic patch in transcription factor Sp1 contacts the dTAFII110 component of the Drosophila SP1 and AP-2a regulate KCTD10 16 17 18 19 20 21 22 23 24 25 26 27 28 TFIID complex and mediates transcriptional activation Proc Natl Acad Sci USA 91, 192–196 Chiang CM & Roeder RG (1995) Cloning of an intrinsic human TFIID subunit that interacts with multiple transcriptional activators Science 267, 531–536 Baker DL, Dave V, Reed T & Periasamy M (1996) Multiple Sp1 binding sites in the cardiac ⁄ slow twitch muscle sarcoplasmic reticulum Ca2+-ATPase gene promoter are required for expression in Sol8 muscle cells J Biol Chem 271, 5921–5928 Cohen HT, Bossone SA, Zhu G, McDonald GA & Sukhatme VP (1997) Sp1 is a critical regulator of the Wilms’ tumor-1 gene J Biol Chem 272, 2901–2913 Lopez-Rodriguez C, Botella L & Corbi AL (1997) CCAAT-enhancer-binding proteins (C ⁄ EBP) regulate the tissue specific activity of the CD11c integrin gene promoter through functional interactions with Sp1 proteins J Biol Chem 272, 29120–29126 Perkins ND, Edwards NL, Duckett CS, Agranoff AB, Schmid RM & Nabel GJ (1993) A cooperative interaction between NF-kappa B and Sp1 is required for HIV-1 enhancer activation EMBO J 12, 3551–3558 Lee W, Haslinger A, Karin M & Tjian R (1987) Activation of transcription by two factors that bind promoter and enhancer sequences of the human metallothionein gene and SV40 Nature 325, 368–372 Getman DK, Mutero A, Inoue K & Taylor P (1995) Transcription factor repression and activation of the human acetylcholinesterase gene J Biol Chem 270, 23511–23519 Xu Y, Porntadavity S & St Clair DK (2002) Transcriptional regulation of the human manganese superoxide dismutase gene: the role of specificity protein (Sp1) and activating protein-2 (AP-2) Biochem J 362, 401–412 Zhang J, Hagopian-Donaldson S, Serbedzija G, Elsemore J, Plehn-Dujowich D, McMahon AP, Flavell RA & Williams T (1996) Neural tube, skeletal and body wall defects in mice lacking transcription factor AP-2 Nature 381, 238–241 Eckert D, Buhl S, Weber S, Jager R & Schorle H (2005) The AP-2 family of transcription factors Genome Biol 6, 246 Turner BC, Zhang J, Gumbs AA, Maher MG, Kaplan L, Carter D, Glazer PM, Hurst HC, Haffty BG & Williams T (1998) Expression of AP-2 transcription factors in human breast cancer correlates with the regulation of multiple growth factor signalling pathways Cancer Res 58, 5466–5472 Pellikainen JM & Kosma VM (2007) Activator protein2 in carcinogenesis with a special reference to breast cancer – a mini review Int J Cancer 120, 2061–2067 Benson LQ, Coon MR, Krueger LM, Han GC, Sarnaik AA & Wechsler DS (1999) Expression of MXI1, a Myc antagonist, is regulated by Sp1 and AP2 J Biol Chem 274, 28794–28802 FEBS Journal 276 (2009) 1114–1124 ª 2009 Hunan Normal University Journal compilation ª 2009 FEBS 1123 SP1 and AP-2a regulate KCTD10 R Liu et al 29 Chen TT, Wu RL, Castro-Munozledo F & Sun TT (1997) Regulation of K3 keratin gene transcription by Sp1 and AP-2 in differentiating rabbit corneal epithelial cells Mol Cell Biol 17, 3056–3064 30 Zhou J, Fan C, Zhong Y, Liu Y, Liu M, Zhou A, Ren K & Zhang J (2005) Genomic organization, promoter characterization and roles of Sp1 and AP-2 in the basal transcription of mouse PDIP1 gene FEBS Lett 579, 1715–1722 1124 31 Bzowska M, Jura N, Lassak A, Black RA & Bereta J (2004) Tumour necrosis factor-alpha stimulates expression of TNF-alpha converting enzyme in endothelial cells Eur J Biochem 271, 2808–2820 32 Ping D, Boekhoudt G, Zhang F, Morris A, Philipsen S, Warren ST & Boss J (2000) Sp1 binding is critical for promoter assembly and activation of the MCP-1 gene by tumor necrosis factor J Biol Chem 275, 1708–1714 FEBS Journal 276 (2009) 1114–1124 ª 2009 Hunan Normal University Journal compilation ª 2009 FEBS ... 5¢-flanking region of human KCTD10; and identified the binding sites of two transcription factors, specificity protein (SP1) and activating protein- 2a (AP -2a) , in the promoter region of KCTD10 We found... FEBS 11 15 SP1 and AP -2a regulate KCTD10 R Liu et al A B Fig Genomic structure of human and mouse KCTD10 genes, and the 5¢-flanking region sequence of human KCTD10 (A) Genomic organization of human. .. related to the regulation of human KCTD10 expression By aligning the 5¢-flanking region of both human and mouse KCTD10 promoters (human from )14 4 to )45, mouse from )14 3 to )44 relative to the