The silencing of adenine nucleotide translocase isoform induces oxidative stress and programmed cell death in ADF human glioblastoma cells Annalisa Lena1*, Mariarosa Rechichi1*, Alessandra Salvetti1, Donatella Vecchio1, Monica Evangelista2, Giuseppe Rainaldi2, Vittorio Gremigni1 and Leonardo Rossi1,3 Dipartimento di Morfologia Umana e Biologia Applicata, University of Pisa, Italy Laboratorio di Terapia Genica e Molecolare, Istituto di Fisiologia Clinica, CNR, Pisa, Italy Istituto Toscano Tumori, Italy Keywords adenine nucleotide translocase; ADF cells; glioblastoma multiforme; mitochondrion; reactive oxygen species Correspondence L Rossi, Dipartimento di Morfologia Umana e Biologia Applicata, Sezione di Biologia e Genetica, Via Volta 4, 56126 Pisa, Italy Fax: +39 050 2219 101 Tel: +39 050 2219 112 E-mail: leoros@biomed.unipi.it *These authors contributed equally to this work (Received 17 December 2009, revised 12 April 2010, accepted 28 April 2010) doi:10.1111/j.1742-4658.2010.07702.x Adenine nucleotide translocases (ANTs) are multitask proteins involved in several aspects of cell metabolism, as well as in the regulation of cell death ⁄ survival processes We investigated the role played by ANT isoforms and in the growth of a human glioblastoma cell line (ADF cells) The silencing of ANT2 isoform, by small interfering RNA, did not produce significant changes in ADF cell viability By contrast, the silencing of ANT1 isoform strongly reduced ADF cell viability by inducing a non-apoptotic cell death process resembling paraptosis We demonstrated that cell death induced by ANT1 depletion cannot be ascribed to the loss of the ATP ⁄ ADP exchange function of this protein By contrast, our findings indicate that ANT1-silenced cells experience oxidative stress, thus allowing us to hypothesize that the effect of ANT1-silencing on ADF is mediated by the loss of the ANT1 uncoupling function Several studies ascribe a proapoptotic role to ANT1 as a result of the observation that ANT1 overexpression sensitizes cells to mitochondrial depolarization or to apoptotic stimuli In the present study, we demonstrate that, despite its pro-apoptotic function at a high expression level, the reduction of ANT1 density below a physiological baseline impairs fundamental functions of this protein in ADF cells, leading them to undertake a cell death process Introduction Adenine nucleotide translocase (ANT) represents a crucial player in the crosstalk between mitochondrial and cytoplasmic energetic pools Indeed, it catalyzes the last step of oxidative phosphorylation: the exchange of ATP generated in mitochondria by ATP synthase with the ADP produced in the cytosol by most energy-consuming reactions [1–3] In humans, four different ANT isoforms have been identified: ANT1 is predominant in differentiated tissues; ANT2 is present in proliferating cells; and ANT3 is ubiquitous ANT4 has been recently identified through a genome scan and appears to be exclusively expressed in testis [4–9] ANT2 mRNA levels are high also in tumors, especially in neoplastic cells with high glycolytic rates [10–13] Apart from their unique role in ATP ⁄ ADP exchange, ANT proteins are also involved in the formation of the permeability transition pore [14], they act as uncoupling proteins in both basal and fatty acid induced proton conductance [15], and they mediate protoporfirine IX transport through the inner mitochondrial membrane for heme biosynthesis [16] Abbreviations ANT, adenine nucleotide translocase; ATR, atractyloside; AVO, acidic vesicular organelle; BA, bongkrekic acid; CCCP, carbonyl cyanide m-chlorophenylhydrazone; NAC, N-acetyl-L-cysteine; ROS, reactive oxygen species; siRNA, small interfering RNA FEBS Journal 277 (2010) 2853–2867 ª 2010 The Authors Journal compilation ª 2010 FEBS 2853 ANT1-silencing induces glioblastoma cell death A Lena et al Because of their multitask nature, ANTs are involved in several aspects of cell metabolism, as well as in cell survival ⁄ death processes, and have been related to several pathologies, including cancer and neurodegenerative diseases [17,18] Moreover, recent data indicate that ANT isoforms play different, sometimes opposing, roles, suggesting that their expression pattern may allow cells to adapt to specific requirements [5,11,19–23] In particular, ANT1 and ANT3 are considered to play a pro-apoptotic role [19,24], whereas ANT2 down-regulation produces a strong reduction in breast cancer cell viability and chemosensitizes HeLa cells to lonidamine treatment [20,21] The present study aims to provide new information about the function of ANT proteins in the regulation of cell death ⁄ survival processes We analyzed the role of ANT1 and ANT2 isoforms in a human glioblastoma cell line, the ADF cells in which, we had previously characterized the effect of several putative ANT targeting agents [25] We found that ANT2 is more abundant than ANT1 in ADF cells, although we observed that silencing of ANT1, but not ANT2, strongly reduced ADF viability by inducing an increase in oxidative stress that leads to cell death We also demonstrated that the ANT1-silencing effect on cell viability is independent of its primary role in ATP ⁄ ADP exchange Our data allow us to suggest a model in which ANT1 depletion might trigger, in ADF cells, an increase in cellular reactive oxygen species (ROS) as a consequence of a reduction in its basal proton conductance function Results ANT1 and ANT2 small interfering RNAs (siRNAs) efficiently down-regulate the expression of their corresponding ANT isoform The amount of ANT1 and ANT2 transcripts expressed in ADF cells was evaluated by absolute real-time RT-PCR As shown in Fig 1A, the number of ANT2 transcripts is approximately five-fold higher than that of ANT1 transcripts Specific siRNAs were designed to selectively down-regulate ANT1 and ANT2 isoforms The siRNAs were tested for their ability to reduce the expression of their cognate mRNAs by absolute real-time quantification of ANT1 and ANT2 specific transcripts As shown in Fig 1B,C, ANT1 and ANT2 siRNAs were able to strongly reduce (by more than ten-fold) the expression of their cognate mRNAs with respect to nontransfected ADF cells or Scramble-transfected ADF cells, 24 h after transfection Importantly, ANT1 siRNAs did not 2854 modify the expression level of ANT2, and ANT2 siRNAs did not modify the expression level of ANT1 (Fig 1B,C) Moreover, both ANT1 and ANT2 siRNAs did not modify ANT3 expression (data not shown) The reduction in the amount of isoform specific transcripts is maintained for least 72 h after transfection (data not shown) We also evaluated the ability of ANT1 and ANT2 specific siRNAs to reduce ANT expression at the protein level Because of the absence of a specific antibody able to discriminate between isoforms and 2, only a partial reduction of ANT protein is appreciable after ANT2 and especially ANT1 siRNA transfection by western blot analysis, as performed using polyclonal anti-ANT serum, 72 h after transfection (Fig 1D) For this reason, we also assayed ANT1 or ANT2 protein reduction by measuring the ability of ANT1 and ANT2 siRNAs to inhibit translation of the respective recombinant proteins As shown in Fig 1E, FLAGANT1 and FLAG-ANT2 protein expression is almost completely absent in ANT1 siRNA- and ANT2 siRNA-transfected cells, respectively ANT1-silencing strongly reduces ADF and U87-MG cell viability We evaluated the effect of ANT specific isoform down-regulation on ADF cell viability by crystal violet assay ANT2 down-regulation by ANT2 siRNA transfection did not alter cell viability By contrast, ANT1 depletion strongly affects cell viability 24, 48 and 72 h after transfection (Fig 2A) To exclude the possibility that the effect of ANT1 on cell viability might be a specific feature of ADF cells, we tested the effect of ANT1 siRNA on the viability of an additional glioblastoma cell line, the U87-MG cells U-87-MG showed a higher number of ANT1 transcripts then ADF cells ( 20 · 106 and · 106, respectively) At 24 and 48 h after transfection with ANT1-a and ANT1-b siRNAs, ANT1 transcripts of U87-MG cells were noticeably reduced with respect to Scrambletransfected cells (Fig 2B) As shown in Fig 2C, ANT1 depletion significantly affects U87-MG cell viability 24, 48 and 72 h after transfection The effect of ANT1 siRNA on ADF cell viability is not rescued after strongly increasing the ANT2 expression level by pcDNA-ANT2 transfection (Fig 2D) We also compared the effect of ANT1 and ANT2 isoform co-silencing with that of ANT1-silencing alone We found that ANT2-silencing did not significantly affect the effect of ANT1-silencing on ADF cell viability (Fig 2E) De novo protein synthesis is required for programmed cell death Thus, to evaluate whether FEBS Journal 277 (2010) 2853–2867 ª 2010 The Authors Journal compilation ª 2010 FEBS A Lena et al ANT1-silencing induces glioblastoma cell death A Fig Analysis of ANT1 and ANT2 expression in nontransfected ADF cells and in ANT1- and ANT2-silenced ADF cells (A) Number of ANT1 and ANT2 transcripts in nontransfected ADF cells (B) Number of ANT1 transcripts in nontransfected, Scramble- and ANT1 and ANT2 siRNA-transfected cells (C) Number of ANT2 transcripts in nontransfected, Scramble- and ANT1 and ANT2 siRNA-transfected cells (D) Western blot analysis of ANT protein in Scrambleand ANT1 and ANT2 siRNA-transfected cells; the 33 kDa band corresponds to ANT proteins, the 43 kDa band corresponds to actin (E) Western blot analysis of FLAGANT1 and FLAG-ANT2 recombinant protein expression revealed by anti-FLAG serum Anti-ERK1 ⁄ antibody was used as loading control pcDNA-ANT1, pcDNA-ANT2 or pcDNA were transfected 24 h after transfection with ANT1 or ANT2 siRNA Protein expression analysis was performed 24 h after the transfection with pcDNA-ANT1, pcDNA-ANT2 or pcDNA; the 39 kDa band corresponds to recombinant FLAG-ANT1 or ANT2 protein, the 42 kDa band corresponds to ERK2, the 44 kDa band, where it is visible, corresponds to ERK1 B C D E ANT1-silencing effect on cell viability might be a result of the onset of a programmed cell death process, we analyzed the effect of siRNA in the presence of the protein synthesis inhibitor puromycin As shown in Fig 2F, treatment with puromycin significantly reduced the ANT1 siRNA-mediated effect on ADF cell viability, indicating that the reduction in cell viability induced by ANT1 siRNA requires protein synthesis ANT1-silencing induces ADF cell apoptosis and a non-apoptotic cell death modality similar to paraptosis To gain more insight regarding the observed reduction in cell viability, we evaluated the mitotic and apoptotic indexes in ANT1 siRNA- and Scramble-transfected cells, as well as in nontransfected control cells As shown in Fig 3, ANT1 siRNA-transfected cells show a slightly reduced number of mitosis and a significantly increased number of apoptotic figures with respect to controls This difference is detectable 24 h after transfection (data not shown) and becomes even more evident 48 h after transfection (Fig 3B) However, the percentage of cells with fragmented nuclei is low ( 2% at 24 h and 20% at 48 h), suggesting that other mechanisms of cell death are occurring With the aim of identifying these cell death mechanisms, we analyzed ADF cell ultrastructure 24 and 48 h after transfection with ANT1 siRNA or Scramble Ultrastructural examination (Fig 4A,G) confirmed the presence of a few cells showing partially condensed chromatin, as a morphological feature of apoptosis, in siRNA-transfected samples (Fig 4E) By contrast, the majority of ANT1 siRNA-transfected cells showed cytoplasmic vacuolation (Fig 4C,D), which was not observable in Scramble-transfected cells (Fig 4A,B) Vacuoles were derived predominantly from the endoplasmic reticulum, although mitochondrial swelling was also observed in some of the analyzed cells (Fig 4D) ANT1 siRNA-treated cells showed no ultrastructural evidence of membrane rupture and were also negative to propidium iodide staining (data not shown), indicating that the plasma membrane is maintained intact, allowing us to exclude primary necrosis as the principal cell death modality Moreover, autophagic vacuoles were not observed, thus allowing us to exclude a autophagic-like cell death FEBS Journal 277 (2010) 2853–2867 ª 2010 The Authors Journal compilation ª 2010 FEBS 2855 ANT1-silencing induces glioblastoma cell death A A Lena et al B 30 000 000 1.8 ANT1 molecules/µg RNA 1.6 1.2 0.8 0.6 0.4 *** *** *** 0.2 24 h 20 000 000 15 000 000 10 000 000 *** 000 000 *** 72 h *** 48 h siRNA ANT1-a siRNA ANT2-a Scramble Non transfected cells siRNA ANT1-b C 25 000 000 Sc m bl e2 si A h N T1 -b 24 si A h N T1 -a 24 Sc h m bl e4 si A h N T1 -b 48 si A h N T1 -a 48 h AB 540 nm 1.4 siRNA ANT2-b D Percentage of live cells vs control 3.5 AB 540 nm 2.5 * 1.5 ** *** *** * * 0.5 120 100 80 60 40 20 0 24 h 24 h 48 h PcDNA + scramble siRNA ANT1-b siRNA ANT1-a 72 h Scramble PcDNA + siRNA ANT1 Non-transfected cells PcDNA-ANT2 + scramble PcDNA-ANT2 + siRNA ANT1 F Percentage of live cells vs control E Percentage of live cells vs control 48 h 72 h 120 100 80 60 40 20 24 h Scramble siRNA ANT1 48 h 72 h siRNAANT1+ siRNA ANT2 120 100 80 60 40 20 24 h ANT1 siRNA 48 h 72 h ANT1 siRNA + puromycin Fig Effect of ANT1 and ANT2-silencing on ADF cells (A) Cell growth curves analyzed by crystal violet assay in nontransfected ADF cells, and in Scramble- and ANT1 siRNA and ANT2 siRNA ADF-transfected cells Each point represents the average of three experiments performed in triplicate The number of live cells counted in ANT1 siRNA-transfected cells was compared with that in Scramble-transfected cells using an unpaired t-test ***P < 0.001 (B) Number of ANT1 transcripts in Scramble- and ANT1 siRNA-transfected U-87-MG cells, 24 and 48 h after transfection (C) Cell growth curves analyzed by crystal violet assay in nontransfected U87-MG cells, and in Scramble- and ANT1 siRNA U87-MG-transfected cells Each point represents the average of two experiments performed in triplicate The number of live cells counted in ANT1 siRNA-transfected cells was compared with that of Scramble-transfected cells using an unpaired t-test ***P < 0.001; **P < 0.01; *P < 0.1 (D) Crystal violet assay of PcDNA + ANT1 siRNA-, PcDNA-ANT2 + ANT1 siRNA-, PcDNA + Scramble- and PcDNAANT2 + Scramble-transfected cells Each bar indicates the percentage of live cells versus the corresponding control (PcDNA + ANT1 siRNA versus PcDNA+Scramble and PcDNA-ANT2 + ANT1 siRNA versus PcDNA-ANT2 + Scramble) and is the mean of two independent experiments performed in triplicate (E) Crystal violet assay of ANT1 siRNA- and ANT1 + ANT2 siRNA-transfected cells Each bar indicates the percentage of live cells versus the corresponding control (ANT1 siRNA versus 50 nM Scramble and ANT1 siRNA + ANT2 siRNA versus 100 nM Scramble) and is the mean of two independent experiments performed in triplicate (F) Crystal violet assay of ANT1 siRNA-transfected cells and ANT1 siRNA-transfected cells treated with 10 lM puromycin Each bar indicates the percentage of live cells versus the corresponding control (ANT1 siRNA versus Scramble and ANT1 siRNA+puromycin versus Scramble + puromycin) and is the mean of two independent experiments performed in triplicate 2856 FEBS Journal 277 (2010) 2853–2867 ª 2010 The Authors Journal compilation ª 2010 FEBS A Lena et al ANT1-silencing induces glioblastoma cell death organelles in the autophagosome display degenerative alterations To further exclude an autophagic-like cell death process, we also analyzed the development of acidic vesicular organelles (AVO), by vital staining using acridine orange AVO positive cells were not detectable 24 and 48 h after ANT1 siRNA transfection (Fig 4H,I) By contrast, several AVO-positive cells were detectable 24 h after treatment with bongkrekic acid (BA) (Fig 4J) All these morphological features resemble those described for paraptosis [26] A ANT1-silencing produces mitochondrial transmembrane potential (DW) dissipation in a small percentage of ADF cells The fact that some cells show mitochondrial swelling suggests an effect of ANT1 siRNA on the mitochondrial transmembrane potential Thus, we performed cytoflurimetric evaluation of DW dissipation by using the JC1 dye Quadrants in the cytometry plot were established by comparing the distribution of the events in nontransfected cells (Fig 5A) and nontransfected cells treated with the uncoupler carbonyl cyanide m-chlorophenylhydrazone (CCCP) used as a control for complete DW dissipation (Fig 5B) Twenty-four hours after ANT1 siRNA treatment, the majority of the transfected cells exibit well polarized mitochondria (Fig 5D) comparable to those of nontransfected cells (Fig 5A) or Scramble-treated cells (Fig 5C) Only a small percentage (11 ± 2%) of the analyzed events show DW dissipation (Fig 5D) The amount of depolarized cells slightly increases in ANT1 siRNA samples (18 ± 2%), 48 h after transfection Fluorescence microscopy analysis of JC1-stained cells confirmed that ANT1 siRNA treatment does not induce essential modification of mitochondrial polarization (Fig 5E,F) Number of apoptosis/1000 cells B 30 25 20 15 10 0 siRNA ANT1 10 15 20 25 Number of mitosis/1000 cells Non-transfected cells Scramble Fig Analysis of apoptotic and mitotic index in ANT1 siRNA-transfected ADF cells by Hoechst 33342 staining (A) Representative image of a fragmented nucleus (white arrowhead) stained with Hoechst 33342 (B) Number of mitosis and apoptotic figures counted in a representative experiment 48 h after transfection in nontransfected, Scramble- and ANT1 siRNA-transfected cells Each point is the average of three counts of the same sample process To obtain a positive control for autophagy, we analyzed the ultrastructure of ADF cells treated with betulinic acid (Fig 4F,G), which is known to induce autophagy in this cell line [25] In this case, cells contain giant autophagosomes (a feature of autophagy) distributed throughout the cytoplasm Engulfed ANT1-silencing produces cell viability reduction independent of its ATP/ADP exchange function The reduction in cell survival observed in ANT1 siRNA treated cells could be the result of a reduction in the cytoplasmic ATP pool, determined by the loss of the ATP ⁄ ADP exchange function of ANT1 To test this hypothesis, we blocked this function in nontransfected cells by exposing them to BA or ATR, two natural inhibitors of ANT-mediated ATP ⁄ ADP exchange function [3] Surprisingly, as shown in Fig 6A,B, treatment with both inhibitors, at concentrations currently used in a variety of cell types, did not produce a reduction in cell viability with respect to vehicle-treated control cells In response to ATP ⁄ ADP co-transport blockade, ADF cells might FEBS Journal 277 (2010) 2853–2867 ª 2010 The Authors Journal compilation ª 2010 FEBS 2857 ANT1-silencing induces glioblastoma cell death A Lena et al A B C D E G F * H I J Fig Analysis of cell death modality in ANT1 siRNA-transfected ADF cells by transmission electron microscopy and acridine orange staining (A) Representative electron micrograph of a Scramble-treated ADF cell (B) Magnification of the box depicted in (A) showing electrondense mitochondria (black arrowheads) and normal endoplasmic reticulum (white arrows) (C) Representative electron micrograph of a ANT1 siRNA-treated ADF cell observed 48 h after treatment (D) Magnification of the box depicted in (C) showing swallen mitochondria (black arrowheads) and heavily enlarged endoplasmic reticulum (white arrows) (E) Electron micrograph of an apoptotic cell showing partial chromatin condensation in ANT1 siRNA-treated ADF cells observed 48 h after treatment (F) Representative electron micrograph of an ADF cell, 24 h after treatment with betulinic acid (G) Magnification of the box depicted in (F) showing normal electron-dense mitochondria (arrowhead) and a giant autophagosome engulfed with organelles that display degenerative alterations (asterisk) (H) Acridine orange-stained ADF cells visualized 24 h after ANT1 siRNA transfection (I) Acridine orange-stained ADF cells visualized 48 h after ANT1 siRNA transfection (J) Acridine orange-stained ADF cells visualized 24 h after betulinic acid treatment compensate for the reduction in cytoplasmic ATP by increasing glycolysis However, the analysis of glucose consumption after BA or ATR treatment did not 2858 reveal any increase in glucose utilization (Fig 6C,D) By contrast, the amount of glucose consumption is significantly higher in ANT1 siRNA-transfected cells FEBS Journal 277 (2010) 2853–2867 ª 2010 The Authors Journal compilation ª 2010 FEBS B 104 100 100 101 102 FL1-H ANT1-silencing induces oxidative damage We evaluated the ability of ANT1 siRNA to sensitize ADF cells to the treatment with pro-oxidants Accordingly, we measured ADF cell viability 24 h after treatment with H2O2 (10, 25, 50, 75, 100, 125, 150, 175 and 200 lm) ANT1-silencing results in a sustained sensitization to H2O2 treatment (IC50 = 56 ± 12) with respect to nontransfected (IC50 = 115 ± 10) and Scramble-transfected (IC50 = 88 ± 11) cells (Fig 7A) Increased susceptibility to pro-oxidant treatment suggests that ADF cells show oxidative damage as a consequence of ANT1-silencing According to this hypothesis, we found that ANT1 siRNA-treated cells 102 FL1-H 103 104 103 104 UQ: 86% 103 104 LQ: 14% 100 101 102 FL1-H F E than in ANT2 siRNA- and Scramble-transfected cells, 72 h after transfection (Fig 6E) 101 FL2-H 102 103 101 LQ: 3% 100 101 FL2-H 102 103 UQ: 97% LQ: 97% 100 102 103 FL1-H 104 101 D 100 Fig Analysis of ANT1-silencing on DW dissipation and the effect of the mitochondrial ATP ⁄ ADP transport inhibitors on ADF cell viability (A–D) The ability of ANT1silencing to dissipate the DW was evaluated by JC1 staining and cytofluorimetry Representative cytometry plots obtained 24 h after transfection for nontransfected cells (A), CCCP-treated cells (B), Scramble-transfected cells (C) and ANT1 siRNA-transfected cells (D) are shown Percentage of events in each quadrant (lower quadrant, LQ, depolarized cells; upper quadrant, UQ, polarized cells) are indicated; FL2-H, red fluorescence, FL1-H, green fluorescence (E,F) fluorescence microscope images of JC1-stained ADF cells 24 h after transfection (E) Scramble-transfected cells (F) ANT1 siRNAa-transfected cells 101 101 100 LQ: 2.5% 100 C UQ: 3% FL2-H 102 103 FL2-H 102 103 UQ: 97.5% 104 A 104 ANT1-silencing induces glioblastoma cell death 104 A Lena et al show higher lysosomal membrane instability, a possible sign of phospholipid peroxidation damage, with respect to control cells Lysosomal membrane instability was monitored by neutral red retention assay Neutral red accumulates in lysosomes from which it is gradually released The rate of this release directly depends upon the lysosomal membrane status Lysosomes with peroxidized phospholipids will release the dye more rapidly than healthy lysosomes As shown in Fig 7B,C, neutral red release is higher in ANT1silenced cells than in control cells, either at 24 or 48 h after treatment To confirm that ANT1 depletion-mediated reduction in cell survival is the result of a worsening in the oxidative status of ADF cells, we also evaluated the ability of the anti-oxidant compound N-acetyl-l-cysteine (NAC) to rescue ADF cells from ANT1 siRNA FEBS Journal 277 (2010) 2853–2867 ª 2010 The Authors Journal compilation ª 2010 FEBS 2859 ANT1-silencing induces glioblastoma cell death A A Lena et al B AB 540 nm AB 540 nm E Folds of glucose consumption 48 h Bong Ac µM 72 h Bong Ac µM D 2.5 1.5 0.5 24 h 24 h 48 h Vehicle Bong Ac µM 72 h Bong Ac µM Folds of glucose consumption C Folds of glucose consumption 24 h Vehicle 3.5 2.5 1.5 0.5 48 h Vehicle 72 h ATR 20 µM 2.5 1.5 0.5 24 h 48 h 72 h Vehicle ATR 20 µM *** 2.5 1.5 0.5 24 h Scramble 48 h siRNA ANT1 72 h siRNA ANT2 Fig Analysis of the effects of BA, ATR and ANT1 siRNA on cell viability and glucose consumption (A,B) Cell growth curves analyzed by crystal violet assay in BA and vehicle-treated (A) and in ATR and vehicle-treated (B) cells Each point is the average of three experiments performed in triplicate (C,D) Glucose consumption in BA and vehicle-treated (C) and ATR and vehicle-treated (D) cells Values are normalized versus the glucose consumption of vehicle-treated cells to which an arbitrary value of was attributed Each bar is the mean of two independent experiments performed in quadruplicate (E) Glucose consumption of Scramble-, ANT1 siRNA- and ANT2 siRNA-transfected cells Each bar is the mean value of two experiments performed in quadruplicate Values are normalized versus the glucose consumption of Scramble-transfected cells to which an arbitrary value of was attributed The glucose consumption quantified in ANT1 siRNA-transfected cells was compared with that quantified for Scramble-transfected cells using an unpaired t-test ***P < 0.001 treatment Although elevated concentrations of ROS are toxic to the cells, their role as second messengers in intracellular signal transduction is important for cancer cell growth and survival [27] We therefore assayed different dose ⁄ time conditions for NAC treatment on nontransfected ADF cells: pre-treatment with 20 lm NAC for 30 was the most severe condition that did not affect cell proliferation in the subsequent 48 h As shown in Fig 7D, treating ADF cells with 20 lm NAC for 30 prior to transfection significantly protects them from the effect of ANT1-silencing Indeed, 48 h after transfection, ANT1-depleted cells are reduced by 45% and 19%, with respect to Scramble-transfected cells in untreated and NAC-treated samples respectively 2860 Discussion At present, few data are available on the expression of ANT isoforms in astrocytes and astrocytic tumors It has been reported that ANT1 levels are increased in reactive astrocytes [28] and that ANT2 levels are increased in glial cells and neurons during hypertonicity in the brain [29] In the present study, we demonstrate that human ADF glioblastoma cells express ANT1 and ANT2 isoforms, and that ANT2 transcripts are more abundant than those coding for ANT1 protein The ANT2 isoform is known to be up-regulated in tumor cells, especially in neoplastic cells with high glycolytic rates [10,12,13] and, in this context, it has been FEBS Journal 277 (2010) 2853–2867 ª 2010 The Authors Journal compilation ª 2010 FEBS A Lena et al ANT1-silencing induces glioblastoma cell death A B 100 Red area/cell area Percentage of live cells 125 75 50 25 0123 0.4 0.35 0.3 0.25 0.2 0.15 0.1 0.05 T1 Dose of H2O2 (Log) Non-transfected cells Scramble D *** 0.5 ** T3 T4 siRNA ANT1 T5 Scramble 0.4 0.3 1.2 ** AB 540 Red area/cell area 0.7 *** T2 *** siRNA ANT1 C 0.6 ** NS 0.8 0.6 ** 0.4 0.2 0.2 0.1 0 T1 T2 T3 siRNA ANT1 Without NAC Non-transfected T4 T5 Scramble NAC 20 µM Scramble siRNA ANT1 Fig Analysis of oxidative stress status of ANT1-silenced ADF cells (A) Sigmoidal dose–response curves of the effect on cell viability measured 24 h after H2O2 treatment (10–200 lM) in nontransfected, Scramble- and ANT1 siRNA-transfected cells (B,C) Representative experiments of neutral red retention assay performed 24 h (C) or 48 h (D) after transfection with ANT1 siRNA or Scramble Images were taken every 10 min; the time of analysis (T10, 10 min, T2, 20 min, etc.) is indicated on the x-axis Each point is the mean red area ⁄ cell area value obtained by analyzing six to eight images taken in different microscope fields The red area ⁄ cell area value quantified in ANT1 siRNA-transfected cells was compared with that quantified for Scramble-transfected cells using an unpaired t-test ***P < 0.001; **P < 0.01 (D) Absorbance values obtained by the crystal violet assay in NAC-treated or untreated nontransfected cells, and Scramble- and ANT1 siRNAtransfected cells, 48 h after transfection The absorbance values recorded in ANT1 siRNA-transfected cells were compared with that of the Scramble-transfected cells using an unpaired t-test **P < 0.01; NS, not significant hypothesized that ANT2 transports nucleotides in the opposite direction (i.e by importing the glycolysisderived ATP into mitochondria); this is necessary for providing energy for intramitochondrial functions and contributes to the maintenance of DW, an essential condition for cell survival [11,30] This proposed role for ANT2 in cell proliferation, and its very low expression in differentiated tissues, make ANT2 protein or transcript an ideal target for anticancer strategy In accordance with this hypothesis, a recent study showed that breast tumor cell growth can be reduced by depleting ANT2 expression [21] Surprisingly, ANT2 down-regulation in ADF cells did not reduce cell growth and did not dissipate DW These results are also in accordance with a study performed by Le Bras et al [20], who demonstrated that ANT2 depletion induced no major changes in cell cycle and in mitochondria aspect and network, and suggest that ADF cells possess alternative mechanisms for providing mitochondria with ATP and maintaining DW, which can compensate for ANT2 loss of function Another possibility is that a more prolonged treatment is required to observe the effect of ANT2 depletion on ADF cell proliferation and ⁄ or that ANT2 molecules escaping the silencing ( · 106 transcripts), under our experimental conditions, are sufficient to guarantee the function of ANT2 By contrast, we observed a consistent reduction in cell viability in ANT1-depleted cells The effect on cell viability produced by ANT1silencing is strongly reduced in the presence of puromycin, a natural inhibitor of protein synthesis, suggesting that ANT1-depleted cells undergo a programmed cell death process that requires de novo protein synthesis Indeed, ultrastructural analysis allowed us to identify morphological signs of two different kinds of programmed cell death processes First, we observed a few apoptotic cells that correlate well with the increase in apoptosis demonstrated by the analysis of the apoptotic index 24 and 48 h after ANT1 siRNA transfection Second, transmission electron microscopy also revealed that, after ANT1 depletion, the majority of cells showed several cytoplasmic ultrastructural modifications consisting in vacuolation primarily ascribable to rough endoplasmic reticulum physical enlargement Mitochondria swelling was also observed in some cells No ruptures in plasma membrane were detected by FEBS Journal 277 (2010) 2853–2867 ª 2010 The Authors Journal compilation ª 2010 FEBS 2861 ANT1-silencing induces glioblastoma cell death A Lena et al both morphological examination and propidium iodide staining, thus allowing us to exclude primary necrosis as a principal death modality These features resemble those described for paraptosis, a caspase-independent programmed cell death modality Paraptotic cell death was described during development in some cases of neurodegeneration and in macrophage-mediated cytotoxicity upon glioma cells [30,31] In the latter case, paraptotic cell death is induced by the ROS produced by macrophage activation and can be mimicked, in vitro, in cytotoxicity studies performed using H2O2 [31] This last finding, as well as the observed resistance of ADF cells to treatment with ATP ⁄ ADP transport blockers, indicating that cell death produced by ANT1-silencing in this cell line could not be ascribed to the impairment of ATP ⁄ ADP exchange function performed by this protein, led us to analyze oxidative stress in ANT1-depleted ADF cells A number of observations demonstrate that ANT1 siRNA-transfected ADF cells experience oxidative stress First, the observation that ANT1 siRNA strongly sensitizes ADF cells to H2O2 treatment suggests that, in ANT1 depleted cells, the detoxifying system for H2O2 is already saturated by endogenous production Second, the neutral red retention assay demonstrates that ANT1-silenced cells show lysosome membrane instability, an indirect sign of possible phospholipid peroxidation Third, ANT1-silenced cells increase glucose consumption, which might be interpreted as an attempt by the cell to potentiate its detoxifying system Indeed, in addition to its role in energy production, glucose metabolism also leads to the formation of pyruvate and NADPH, both of which are considered to function in the cellular detoxification of hydroperoxides [32,33] Finally, we provide direct evidence that the anti-oxidant NAC rescues the ANT1-silencing effect on ADF cell survival, thus indicating that ANT1 effect is mediated by oxidative stress A possible explanation for the ANT1-silencing effect on oxidative stress and cell survival could reside in the loss of the basal proton conductance function described for ANT1 The amount of ANT protein present in the mitochondrial inner membrane has been shown to strongly affect the basal proton conductance, independent of the ATP ⁄ ADP exchange function, suggesting that ANT is a major catalyst of the basal fattyacid-independent proton leak in mitochondria [34] More recent data indicate that ANT1 and ANT2 may be responsible for basal and fatty acid-induced uncoupling, respectively [22] Basal proton conductance may play a fundamental role in the regulation of DW in glycolitic tumor cells that possess an incomplete electron transport chain and not utilize F0F1-ATP synthase 2862 for cytoplasmic ATP production In this context, it might be hypothesized that protons, accumulated by the electron transport chain in the intermembrane space, principally flow back into the matrix using the basal conductance function of ANT1 Lowering the ANT1 density at the mitochondrial inner membrane level might impair the balance between proton efflux ⁄ influx into the matrix, thus determining mitochondria hyperpolarization A strong positive correlation between mitochondrial membrane potential and ROS production has been clearly demonstrated [35] With our JC1 analysis, we were unable to detect a significant increase in the mitochondria membrane potential of ADF cells However, this cannot exclude small intermittent increases in DW that are sufficient to induce ROS production Indeed, it has been reported that even a small increase in membrane potential gives rise to a large stimulation of H2O2 production [36] Similarly, only a small decrease in membrane potential (10 mV) is able to inhibit H2O2 production by 70% [37] A possible explaination is that, when DW is sufficiently high, the half-life of CoQH· and some other electron transport intermediates, increases [36] Moreover, when electron transfer is hindered by a high membrane potential, Complex III may leak electrons to oxygen, resulting in the formation of superoxide Therefore a ‘mild uncoupling’ (i.e a small decrease in membrane potential) has been suggested to exert a natural antioxidant effect [38] Accordingly, we demonstrate that ANT1 depletion did not produce DW dissipation in the majority of ADF transfected cells The limited amount of depolarized cells detected at both 24 and 48 h after transfection with ANT1 siRNA might reflect those cells that are in an advanced status of cell death The extension of the present study to other lines of astrocytic tumors, as well as normal astrocytes, will be necessary to confirm the fundamental role of ANT1 in sustaining basal proton conductance and thus in the reduction of ROS production and oxidative stress Three previous studies [19,39,40] report that ANT1 overexpression induces apoptosis in a variety of immortalized fibroblasts and tumor cell lines, not including glioma cells Two of these studies attribute the pro-apoptotic effect of ANT1 overexpression to its function in modulating mitochondrial permeability transition pore opening Zamora et al [40] show that ANT1 overexpression results in the recruitment of the IjBa-NF-jB complex into mitochondria, with a corresponding decrease in nuclear NF-jB DNA binding activity In this situation, NF-jB transcriptionally regulated genes with anti-apoptotic activity, such as BclXL, MnSOD-2 and c-IAP2, are down-regulated and, FEBS Journal 277 (2010) 2853–2867 ª 2010 The Authors Journal compilation ª 2010 FEBS A Lena et al consequently, cells are sensitized to apoptosis According to these interpretations, we should have found a decrease in apoptotic cell death and an increased proliferation rate in our ANT1-silenced cells By contrast, under our experimental conditions, we find an increase in the number of dead cells However, the results obtained in the present study are consistent with the finding that an increase in ANT1 expression levels in activated astrocytes is not associated with an increase in cell death but rather an augmented energy mobilization capacity that contributes to neuroprotective, energy-dependent glutamate uptake [28] This suggests that, in astrocytes, and possibly in astrocytic tumors, a high expression level of ANT1 does not play a proapoptotic role Another possibility is that, although apparently contrasting, these findings could be explained by the idea that, when the quantity of ANT1 exceeds a physiological concentration, ANT1 sensitizes cells to mitochondrial depolarization or to apoptotic stimuli by both modulating the mitochondrial permeability transition and recruiting IjBa-NFjB complex into mitochondria However, this does not exclude the possibility that the reduction of ANT1 level below the physiological baseline impairs, in ADF tumor cells, the fundamental functions of this protein, such as basal proton conductance, which produces a severe effect on cell viability Experimental procedures Cell cultures Human ADF glioblastoma cell line, obtained from a WHO grade IV human glioblastoma [41], and human U87-MG cell line, a kind gift of Professor C Martini (Department of Psychiatry, Neurobiology, Pharmacology and Biotechnology, University of Pisa, Italy), were maintained under standard culture conditions (37 °C, 95% humidity, 5% CO2) in RPMI 1640 medium supplemented with 10% fetal bovine serum, mL of glutamine, 100 mL)1 penicillin, 100 mgỈmL)1 streptomycin and 1% non-essential amino acids (complete medium) Drugs The drugs employed included atractyloside potassium salt (ATR A6882; Sigma-Aldrich, St Louis, MO, USA), CCCP (C2759; Sigma-Aldrich), BA (Biomol International, Plymouth Meeting, PA, USA) and puromycin (Invitrogen, Paisley, UK) Stock solutions of 10 and mgỈmL)1 were prepared in distilled water for atractyloside and BA, respectively A 200 mm stock solution was prepared in dimethylsulfoxide for betulinic acid; a mm stock solution was ANT1-silencing induces glioblastoma cell death prepared in absolute ethanol for CCCP; and a 100 mgỈmL)1 stock solution was prepared in distilled water for puromycin RNA isolation, reverse transcription-PCR and cloning of human ANT1 and ANT2 RNA was extracted from · 106 cells using the Nucleospin RNA II kit (Macherey-Nagel, Duren, Germany) in accordance with the manufacturer’s instructions For RT-PCR,  lg of total RNA was reverse transcribed using the Superscript II reverse transcriptase (Invitrogen) Full-length cDNAs of ANT1 and ANT2 were amplified using the specific primers: ANT1 forward: 5¢-TCGCGGATCCATGGG TGATCACGCTTGG-3¢ (containing a BamHI restriction site at the 5¢ end); ANT1 reverse: 5¢-ACGCGTCGACGA CATATTTTTTGATCTCATCAT-3¢ (containing a SalI restriction site at the 5¢ end); ANT2 forward: 5¢-TCGCT GATCAATGACAGATGCCGCTGTGTCC-3¢ (containing a BclI restriction site at the 5¢ end); and ANT2 reverse: 5¢ACGCGTCGACTGTGTACTTCTTGATTTCATCATAC AAGACAAG-3¢ (containing a SalI restriction site at the 5¢ end) PCR cycling conditions for ANT1 were at 94 °C, 30 cycles of 30 s at 94 °C, 45 s at 50 °C and 90 s at 68 °C; for ANT2, they were at 94 °C, 35 cycles of 30 s at 94 °C, 45 s at 49 °C and 90 s at 72 °C In both PCRs, a final extension was carried on at 72 °C for The amplified fragments were BamHI-SalI digested and cloned in the pcDNA3 vector (Invitrogen), modified to achieve a short FLAG epitope The resulting expression vectors were composed of the ORF encoding human ANT1 or ANT2 fused with the FLAG epitope at their COOH terminal position After transformation in competent Escherichia coli cells, some clones were isolated and plasmid DNA was sequenced by automated fluorescent cycle sequencing (Applied Biosystems, Foster City, CA, USA) Selected clones (PcDNA-ANT1 and PcDNA-ANT2) were used in the applications described below RNA interference Among a series of siRNAs, designed according to the guidelines of Elbashir et al [42], the two most effective against human ANT1 isoform (accession number NM_001151) and human ANT2 isoform (accession number NM_001152) were identified using energy profiling guidelines [43] SiRNAs were synthesized using the Ampli-Scribe T7 high yield transcription kit (Epicenter Biotechnologies, Madison, WI, USA) in accordance with manufacturer’s instructions The sequences used as templates were: ANT1 siRNA-a: 5¢-AAGCATGCCAGCAAACAGATCTCTCTT GAAGATCTGTTTGCTGGCATGCTATAGTGAGTCGT ATTACC-3¢; ANT1 siRNA-b: 5¢-AAGCTGGAGGAAG ATTGCAAATCTCTTGAATTTGCAATCTTCCTCCAG FEBS Journal 277 (2010) 2853–2867 ª 2010 The Authors Journal compilation ª 2010 FEBS 2863 ANT1-silencing induces glioblastoma cell death A Lena et al CTATAGTGAGTCGTATTACC-3¢; ANT2 siRNA-a: 5¢AAGCTGGAGCTGAAAGGGAATTCTCTTGAAATTC CCTTTCAGCTCCAGCTATAGTGAGTCGTATTACC-3¢; and ANT2 siRNA-b: 5¢-AAGGATCCCAAGAACACTCA CTCTCTTGAAGTGAGTGTTCTTGGGATCCTATAGT GAGTCGTATTACC-3¢ ANT1 siRNA-a, ANT1 siRNA-b, ANT2 siRNA-a and ANT2 siRNA-b were used in the analysis of the cell growth curves In all the other experiments, ANT1 siRNA and ANT2 siRNA refer to ANT1 siRNA-a and ANT2 siRNA-a, respectively Transfection ADF cells were transfected using Lipofectamine 2000 reagent (Invitrogen) in accordance with the manufacturer’s instructions Five hours after transfection, medium was replaced with complete medium and the cells were used for the experiments In the overexpression experiments, 90% confluent ADF cells were transfected with 1.6 lgỈmL)1 of pcDNA-ANT1, pcDNA-ANT2 or pcDNA (control) In RNA interference experiments, 30% confluent ADF cells were transfected with siRNA-ANT1-a, siRNA-ANT1-b, siRNA-ANT2-a, siRNA-ANT2-b, siRNA-ANT1-a+siRNA-ANT2-a or Scramble (Scrambled Negative Control Stealth transfected cells; Ambion, Applied Biosystems Carlsbad, CA, USA) at a final concentration of 50 nm Transfection efficiency was routinely measured in a separate well using the BLOCK-IT fluorescent oligo (Invitrogen) and transfection experiments were used for the subsequent analysis only if transfection efficiency, as evaluated 24 h after transfection, was higher than 80% Immunoblotting ADF transfected cells and ADF control cells were lysed by adding 80 lL of lysis buffer [1% Triton X-100, 10% glycerol, 20 mm Tris-HCl (pH 7.5), 150 mm NaCl, 10 mm EDTA, mm phenylmethylsulphonyl fluoride, 0.5 lm aprotinin, 0.5 lm leupeptin] and used for western blot analysis with rabbit anti-FLAG serum (dilution : 1000; SigmaAldrich) or with goat anti-ANT serum (dilution : 200; Santa Cruz, Santa Cruz, CA, USA) After incubation with a : 100 000 dilution of peroxidase-conjugated anti-rabbit or anti-(goat IgG) sera (Bio-Rad, Hercules, CA, USA), cross-reactive bands were detected using the Supersignal West Dura substrate (Pierce, Rockford, IL, USA) To check that equal amounts of total proteins were loaded in each line, after anti-FLAG detection, filters were stripped and reprobed with mouse anti-ERK1 ⁄ antibody (dilution : 1000; Santa Cruz) and revealed as described above After anti-ANT detection, filters were stripped and reprobed with rabbit anti-Actin antibody (dilution : 150; Santa Cruz) and revealed as described above 2864 Absolute real-time PCR Real-time RT-PCR was performed using SYBR Green technology and Brilliant II SYBRGreeen QPCR master mix (Stratagene, Agilent, Santa Clara, CA, USA) to amplify 20 ng of retrotranscribed total RNA Conditions for the amplification were: 40 cycles of 30 s at 94 °C, 60 s at 60 °C and 60 s at 72 °C The primers used in the amplification reaction were: ANT1 forward: 5¢-GGGTGTGGA TCGGGATAAG-3¢; ANT1 reverse: 5¢-CATGGAACTCA CGCTGGG-3¢; ANT2 forward: 5¢-ACGTGTCTGTGCAG GGTATT-3¢; ANT2 reverse: 5¢-GTGTCAAATGGATAGG AAG-3¢; ANT3 forward: 5¢-AACCAAGAGAACCACG TAGAA-3¢; and ANT3 reverse: 5¢-CTTAGAACACGACT TGGCTC-3¢ For calibration curves, ANT1, ANT2 and ANT3 amplification products were purified and quantified by measuring A260 Serial dilutions of the amplified fragments containing 100 000 000, 1000 000 and 10 000 cDNA copies were used in the amplification experiments These curves were used to extrapolate the number of ANT1, ANT2 and ANT3 transcripts from their Ct values Crystal violet assay After transfection and ⁄ or treatment, cells were processed as previously described [25] Briefly, cells were washed in Phosphate buffered saline (PBS; 137 mm NaCl, 2.7 mm KCl, 10 mm Na2PO4, mm KH2PO4, pH 7) fixed in paraformaldehyde (4%) and stained with a crystal violet solution After removal of crystal violet, plates were washed by immersion in a beaker filled with tap water and air-dried Crystal violet destaining solution (0.6 mL) was then added to each well and A540 was measured Three wells for each type of sample were measured; values were blank-subtracted using the optical density of wells containing growth medium only as blank In some experiments, the IC50 was calculated by a sigmoidal dose–response curve, using the graphpad prism software (GraphPad Software Inc., San Diego, CA, USA) Mitotic and apoptotic index Sixty thousand ADF cells were plated in 24-well plates The next day, cells were transfected with siRNA-ANT1-a or Scramble After 24 or 48 h, cells were detached, collected by centrifugation and resuspended in 40 lL of a glycerol, acetic acid, PBS (1 : : 13) solution containing lgỈmL)1 of Hoechst 33342 (H21492; Invitrogen) Cells were treated with 0.05 lgỈmL)1 colchicine for h before collection Two lL aliquots of cell suspension for each sample were spotted onto a glass slide and allowed to dry Mitotic and apoptotic figures were counted under the fluorescence microscope Two 10 lL aliquots for each sample were used to count the number of total cells with a hemocytometer For each treatment, the mitotic and apoptotic index (i.e FEBS Journal 277 (2010) 2853–2867 ª 2010 The Authors Journal compilation ª 2010 FEBS A Lena et al mitotic figures or apoptotic figures ⁄ total cells) were calculated in three replicate wells At least 80 000 cells were scanned for each type of sample Detection of AVOs As a marker of autophagy, the appearance and volume AVOs was visualized by acridine orange staining as described previously [25] in siRNA-ANT1-a and Scrambletransfected ADF cells The cytoplasm and nucleus of the stained cells fluoresced bright green, whereas the acidic autophagic vacuoles fluoresced bright orange To carry out a control of specificity, the cells were treated with 200 nm bafilomycin A1 for 30 before the addition of acridine orange to inhibit the acidification of autophagic vacuoles As a positive control for autophagy induction, ADF cells were treated for 24 h with 15 lm betulinic acid [25] Glucose consumption assay At 24, 48 and 72 h after transfection, 150 lL of medium from each sample were transferred to 1.5 mL tubes and centrifuged for at 300 g Seventy-five microliters of the resulting supernatants were collected and diluted with 75 lL of distilled water and 450 lL of o-Toluidine Reagent (T1199; Sigma-Aldrich) After heating at 100 °C for min, A630 was measured A calibration curve with serial dilutions of d-glucose (400, 600, 800, 1200 and 1400 mgỈL)1) was processed contemporarily to the samples in each experiment Neutral red release assay After transfection with siRNA-ANT1-a and Scramble, cells were stained for 10 at 15 °C in serum-free medium containing neutral red dye (3-amino-7-dimethylamino-2-methylphenazine hydrochloride) at the final concentration of 20 lgỈmL)1 After removal of neutral red dye, new complete medium was added to the cells Images were then taken every 10 min, under an Axiovert microscope (Carl Zeiss, Oberkochen, Germany) Images were then converted to grayscale mode using Adobe Photoshop cs (Adobe Systems, Inc., San Jose, CA, USA), and the red area, as well as total cell area, were measured using imagej software [44] Evaluation of mitochondrial potential by the JC1 staining assay Changes in mitochondrial membrane potential were analyzed using the specific lipophilic fluorescent cation 5,5¢,6,6¢-tetrachloro-1,1¢,3,3¢-tetraethylbenzimidazol-carbocyanine iodide (JC1; T3168; Invitrogen), which accumulates into the mitochondrial matrix JC-1 was prepared as a 1000· stock solution in dimethylsulfoxide (5 mgỈmL)1) At 24 and 48 h after transfection, cells were detached by trypsin treatment ANT1-silencing induces glioblastoma cell death and stained for 30 at 37 °C in fresh medium containing JC1 (final concentration of 10 lgỈmL)1) Cells were then washed twice with PBS, suspended in 500 lL of PBS and analyzed using a FACScalibur cytofluorimeter (Becton Dickinson, Franklin Lakes, NJ, USA) In each experiment, some ADF cell samples were exposed for 30 to the uncoupling agent CCCP at a 50 lm concentration, and then used as dissipation control Data were analyzed using cellquestÔ software (Becton Dickinson) Transmission electron microscope analyses At 24 or 48 h after ANT1 siRNA-a or Scramble transfection, both floating and adherent ADF cells were collected by centrifugation The pellets were washed in NaCl ⁄ Pi and fixed as previously described [45] Ultrathin sections were placed on Formvar carbon-coated nickel grids, stained with uranyl acetate and lead citrate and observed under a Jeol 100 SX transmission electron microscope (Jeol, Ltd, Tokyo, Japan) Statistical analysis In crystal violet assays aimed to analyze: the effect of ANT2 overexpression on ANT1-silenced cells (Fig 2C); the effect of ANT1 and ANT2 co-silencing on ADF cells (Fig 2D); and the effect of puromycin on ANT1-silenced cells (Fig 2E), to allow the direct comparison of samples with different controls bars indicate the percentage of live cells with respect to the relative controls, as specifically indicated in figure legend In glucose consumption assays, the absorbance data obtained from the analysis of the cell medium were normalized versus the total number of cells quantified in the respective wells by the crystal violet assay Data obtained in viability, neutral red retention, and glucose consumption assays were analyzed using the Student’s t-test for all pairwise comparisons Data are presented as the mean ± SD for replicate experiments Acknowledgements We thank Dr Paola Iacopetti for critical reading of the manuscript Grant sponsor: Fondi per il finanziamento progetti di ricerca Istituto Toscano Tumori (ITT) (to L.R.); Fondazione Cassa di Risparmio di Livorno and Fondazione Cassa di Risparmio di Lucca, Italy (to V.G.) References Klingenberg M (1985) The ADP ⁄ ATP carrier in mitochondrial membranes In The Enzymes of Biological FEBS Journal 277 (2010) 2853–2867 ª 2010 The Authors Journal compilation ª 2010 FEBS 2865 ANT1-silencing induces glioblastoma cell death 10 11 12 13 A Lena et al Membranes, Vol (Martonosi AN ed), pp 511–553 Plenum Publishing Co, New York ´ ´ Fiore C, Trezeguet V, Le Saux A, Roux P, Schwimmer C, Dianoux AC, Noel F, Lauquin GJ, Brandolin G & Vignais PV (1998) The mitochondrial ADP ⁄ ATP carrier: structural, physiological and pathological aspects Biochimie 80, 137–150 Palmieri F (2004) The mitochondrial transporter family (SLC25): physiological and pathological implications Pflugers Arch 447, 689–709 Stepien G, Torroni A, Chung AB, Hodge JA & Wallace DC (1992) Differential expression of adenine nucleotide translocator isoforms in mammalian tissues and during muscle cell differentiation J Biol Chem 267, 14592– 14597 Giraud S, Bonod-Bidaud C, Wesolowski-Louvel M & Stepien G (1998) Expression of human ANT2 gene in highly proliferative cells: GRBOX, a new transcriptional element, is involved in the regulation of glycolytic ATP import into mitochondria J Mol Biol 281, 409–418 Kim YH, Haidl G, Schaefer M, Egner U, Mandal A & Herr JC (2007) Compartmentalization of a unique ADP ⁄ ATP carrier protein SFEC (Sperm Flagellar Energy Carrier, AAC4) with glycolytic enzymes in the fibrous sheath of the human sperm flagellar principal piece Dev Biol 302, 463–476 Barath P, Luciakova K, Hodny Z, Li R & Nelson BD (1999) The growth-dependent expression of the adenine nucleotide translocase-2 (ANT2) gene is regulated at the level of transcription and is a marker of cell proliferation Exp Cell Res 248, 583–588 Dolce V, Scarcia P, Iacopetta D & Palmieri F (2005) A fourth ADP ⁄ ATP carrier isoform in man: identification, bacterial expression, functional characterization and tissue distribution FEBS Lett 579, 633–637 ´ Rodic N, Oka M, Hamazaki T, Murawski MR, Jorgensen M, Maatouk DM, Resnick JL, Li E & Terada N (2005) DNA methylation is required for silencing of ant4, an adenine nucleotide translocase selectively expressed in mouse embryonic stem cells and germ cells Stem Cells 23, 1314–1323 Torroni A, Stepien G, Hodge JA & Wallace DC (1990) Neoplastic transformation is associated with coordinate induction of nuclear and cytoplasmic oxidative phosphorylation genes J Biol Chem 265, 20589–20593 Chevrollier A, Loiseau D, Chabi B, Renier G, Douay ` O, Malthiery Y & Stepien G (2005) ANT2 isoform required for cancer cell glycolysis J Bioenerg Biomembr 37, 307–316 Faure Vigny H, Heddi A, Giraud S, Chautard D & Stepien G (1996) Expression of oxidative phosphorylation genes in renal tumors and tumoral cell lines Mol Carcinog 16, 165–172 Heddi A, Faure-Vigny H, Wallace DC & Stepien G (1996) Coordinate expression of nuclear and mitochon- 2866 14 15 16 17 18 19 20 21 22 23 24 25 drial genes involved in energy production in carcinoma and oncocytoma Biochim Biophys Acta 1316, 203–209 ` Zoratti M & Szabo I (1995) The mitochondrial permeability transition Biochim Biophys Acta 1241, 139–176 Klingenberg M (2008) The ADP and ATP transport in mitochondria and its carrier Biochim Biophys Acta 1778, 1978–2021 Azuma M, Kabe Y, Kuramori C, Kondo M, Yamaguchi Y & Handa H (2008) Adenine nucleotide translocator transports haem precursors into mitochondria PLoS ONE 3, e3070 Singh P, Suman S, Chandna S & Das TK (2009) Possible role of amyloid-beta, adenine nucleotide translocase and cyclophilin-D interaction in mitochondrial dysfunction of Alzheimer’s disease Bioinformation 3, 440–445 Martin LJ, Gertz B, Pan Y, Price AC, Molkentin JD & Chang Q (2009) The mitochondrial permeability transition pore in motor neurons: involvement in the pathobiology of ALS mice Exp Neurol 218, 333–346 Bauer MK, Schubert A, Rocks O & Grimm S (1999) Adenine nucleotide translocase-1, a component of the permeability transition pore, can dominantly induce apoptosis J Cell Biol 147, 1493–1502 Le Bras M, Borgne-Sanchez A, Touat Z, El Dein OS, Deniaud A, Maillier E, Lecellier G, Rebouillat D, Lemaire C, Kroemer G et al (2006) Chemosensitization by knockdown of adenine nucleotide translocase-2 Cancer Res 66, 9143–9152 Jang JY, Choi Y, Jeon YK & Kim CW (2008) Suppression of adenine nucleotide translocase-2 by vector-based siRNA in human breast cancer cells induces apoptosis and inhibits tumor growth in vitro and in vivo Breast Cancer Res 10, R11 Shabalina IG, Kramarova TV, Nedergaard J & Cannon B (2006) Carboxyatractyloside effects on brown-fat mitochondria imply that the adenine nucleotide translocator isoforms ANT1 and ANT2 may be responsible for basal and fatty-acid-induced uncoupling respectively Biochem J 399, 405–414 Vyssokikh MY, Katz A, Rueck A, Wuensch C, Dorner ă A, Zorov DB & Brdiczka D (2001) Adenine nucleotide translocator isoforms and are differently distributed in the mitochondrial inner membrane and have distinct affinities to cyclophilin D Biochem J 358, 349–358 Zamora M, Granell M, Mampel T & Vinas O (2004) ˜ Adenine nucleotide translocase (ANT3) overexpression induces apoptosis in cultured cells FEBS Lett 563, 155–160 Lena A, Rechichi M, Salvetti A, Bartoli B, Vecchio D, Scarcelli V, Amoroso R, Benvenuti L, Gagliardi R, Gremigni V et al (2009) Drugs targeting the mitochondrial pore act as citotoxic and cytostatic agents in temozolomide-resistant gliomacells J Transl Med 7, 13 FEBS Journal 277 (2010) 2853–2867 ª 2010 The Authors Journal compilation ª 2010 FEBS A Lena et al 26 Sperandio S, de Belle I & Bredesen DE (2000) An alternative, nonapoptotic form of programmed cell death Proc Natl Acad Sci USA 97, 14376–14381 27 Clerkin JS, Naughton R, Quiney C & Cotter TG (2008) Mechanisms of ROS modulated cell survival during carcinogenesis Cancer Lett 266, 30–36 28 Buck CR, Jurynec MJ, Gupta DK, Law AK, Bilger J, Wallace DC & McKeon RJ (2003) Increased adenine nucleotide translocator in reactive astrocytes facilitates glutamate transport Exp Neurol 181, 149–158 29 Yamashita T, Yamauchi A, Miyai A, Taniguchi M, Yoshimine T & Tohyama M (1999) Differential regulation of adenine nucleotide translocators by hypertonicity in the brain J Neurochem 72, 1259–1265 ` 30 Chevrollier A, Loiseau D, Gautier F, Malthiery Y & Stepien G (2005) ANT2 expression under hypoxic conditions produces opposite cell-cycle behavior in 143B and HepG2 cancer cells Mol Carcinog 42, 1–8 31 Hoa N, Myers MP, Douglass TG, Zhang JG, Delgado C, Driggers L, Callahan LL, VanDeusen G, Pham JT, Bhakta N et al (2009) Molecular mechanisms of paraptosis induction: implications for a non-genetically modified tumor vaccine PLoS ONE 4, e4631 32 Nath KA, Ngo EO, Hebbel RP, Croatt AJ, Zhou B & Nutter LM (1995) alpha-Ketoacids scavenge H2O2 in vitro and in vivo and reduce menadione-induced DNA injury and cytotoxicity Am J Physiol 268, C227–C236 33 Averill-Bates DA & Przybytkowski E (1994) The role of glucose in cellular defences against cytotoxicity of hydrogen peroxide in Chinese hamster ovary cells Arch Biochem Biophys 312, 52–58 34 Brand MD, Pakay JL, Ocloo A, Kokoszka J, Wallace DC, Brookes PS & Cornwall EJ (2005) The basal proton conductance of mitochondria depends on adenine nucleotide translocase content Biochem J 392, 353–362 35 Echtay KS (2007) Mitochondrial uncoupling proteins – what is their physiological role? Free Radic Biol Med 43, 1351–1371 ANT1-silencing induces glioblastoma cell death 36 Korshunov SS, Skulachev VP & Starkov AA (1997) High protonic potential actuates a mechanism of production of reactive oxygen species in mitochondria FEBS Lett 416, 15–18 37 Votyakova TV & Reynolds IJ (2001) DeltaPsi(m)dependent and -independent production of reactive oxygen species by rat brain mitochondria J Neurochem 79, 266–277 38 Skulachev VP (1997) Membrane-linked systems preventing superoxide formation Biosci Rep 17, 347– 366 39 Jang JY, Choi Y, Jeon YK, Aung KC & Kim CW (2008) Over-expression of adenine nucleotide translocase (ANT1) induces apoptosis and tumor regression in vivo BMC Cancer 8, 160 40 Zamora M, Merono C, Vinas O & Mampel T (2004) ˜ ˜ Recruitment of NF-kappaB into mitochondria is involved in adenine nucleotide translocase (ANT1)induced apoptosis J Biol Chem 279, 38415–38423 41 Fabrizi C, Colasanti M, Persichini T, Businaro R, Starace G & Lauro GM (1994) Interferon gamma up-regulates alpha macroglobulin expression in human astrocytoma cells J Neuroimmunol 53, 31–37 42 Elbashir SM, Harborth J, Weber K & Tuschl T (2002) Analysis of gene function in somatic mammalian cells using small interfering RNAs Methods 26, 199–213 43 Poliseno L, Evangelista M, Mercatanti A, Mariani L, Citti L & Rainaldi G (2004) The energy profiling of short interfering RNAs is highly predictive of their activity Oligonucleotides 14, 227–232 44 Abramoff MD, Magelhaes PJ & Ram SJ (2004) Image processing with ImageJ Biophotonics Int 11, 36–42 45 Chelli B, Rossi L, Da Pozzo E, Costa B, Spinetti F, Rechichi M, Salvetti A, Lena A, Simorini F, Vanacore R et al (2005) PIGA (N,N-Di-n-butyl-5-chloro-2-(4chlorophenyl)indol-3-ylglyoxylamide), a new mitochondrial benzodiazepine-receptor ligand, induces apoptosis in C6 glioma cells Chembiochem 6, 1082–1088 FEBS Journal 277 (2010) 2853–2867 ª 2010 The Authors Journal compilation ª 2010 FEBS 2867 ... transfection (Fig 6E) 10 1 FL2-H 10 2 10 3 10 1 LQ: 3% 10 0 10 1 FL2-H 10 2 10 3 UQ: 97% LQ: 97% 10 0 10 2 10 3 FL1-H 10 4 10 1 D 10 0 Fig Analysis of ANT1 -silencing on DW dissipation and the effect of the mitochondrial... ANT1 -silencing According to this hypothesis, we found that ANT1 siRNA-treated cells 10 2 FL1-H 10 3 10 4 10 3 10 4 UQ: 86% 10 3 10 4 LQ: 14 % 10 0 10 1 10 2 FL1-H F E than in ANT2 siRNA- and Scramble-transfected cells, ... Scramble-transfected cells (F) ANT1 siRNAa-transfected cells 10 1 10 1 10 0 LQ: 2.5% 10 0 C UQ: 3% FL2-H 10 2 10 3 FL2-H 10 2 10 3 UQ: 97.5% 10 4 A 10 4 ANT1 -silencing induces glioblastoma cell death 10 4 A Lena et al show