The effect of amino-acid substitutions I112P, D147E and K152N in CYP11B2 on the catalytic activities of the enzyme Stephanie Bechtel 1 , Natalya Belkina 2 and Rita Bernhardt 1 1 Universita ¨ t des Saarlandes, Saarbru ¨ cken, Germany; 2 Insitute of Biomedical Chemistry RAMS, Moscow, Russia By replacing specific amino acids at positions 112, 147 and 152 of the human aldosterone synthase (CYP11B2) with the corresponding residues from human, mouse or rat 11b-hydroxylase (CYP11B1), w e have been able to investi- gate whether these residues belong to structural determi- nants of individual enzymatic activities. When incubated with 11-d eoxycorticostero ne ( DOC), the 11b-h ydroxylation activity of the m utants was most effectively increased b y combining D147E and I112P (sixfold increase). The two substitutions displayed a n additive effect. The same tendency can be observed when using 11-deoxycortisol as a substrate, although the effect is less pronounced. The second step of the CYP11B2-dependent DOC conversion, the 18-hydroxyla- tion activity, was not as strongly increased as the 11b-hydroxylation potential. A ctivity was unaffected by D147E, whereas the single mutant I112P displayed the most pronounced activation (70% enhancement), thus causing different increasing effects o n the first two enzymatic reaction steps. A slightly enhanced aldosterone synthesis f rom DOC could be m easured due to increased levels of the i ntermedi- ates. However, the 18-oxidation activity of all the mutants, except for I112S and D147E, was slightly reduced. The strongly enhanced 18-hydroxycorticosterone and a ldoster- one formation observed in the mutants p rovides important information on a possible role of s uch amino-acid replace- ments in the development of essential h ypertension. Furthermore, the results indicate the possibility of a differ- ential as well as independent modification of CYP11B2 reaction steps. The combination of functional data and computer modelling of CYP11B2 suggests an indirect involvement of r esidue 147 in the regulation of CYP11B isoform specific substrate conversion due to its location on the protein surface. In addition, the results indicate the functional significance of amino-acid 112 in the putative substrate access channel of human CYP11B2. Thus, we present the first example of substrate re cognition a nd conversion being attributed to the N-terminal part of human CYP11B2. Keywords: c ytochrome P450; 11 b-hydroxylase, aldosterone synthase; N-terminal protein region; engineering substrate specificity. Cytochromes P 450 a re key enzymes in the biotransforma- tion of drugs, xenobiotics and steroids (reviewed in [1]). The synthesis of the most important glucocorticoid and mineralocorticoid hormones in humans (cortisol and aldosterone, respectively), take place in t he adrenal gland. It has been shown that i n pig [2] and frog [3] t his synthesis is performed by a single P450 enzym e (CYP11B1). In contrast, bovine h as two closely relate d isoenzymes encoded by different genes [4,5] that synthesize both cortisol and aldosterone. In several other species, including human [6,7], mouse [ 8] and r at [9,10], t wo distinct isofo rms of the CYP11B subfamily, namely CYP11B1 and CYP11B2, have been characterized, w hich are specialized to synthesize cortisol or aldosterone. In human, the terminal three steps in the biogenesis of aldosterone are catalyzed by the aldosterone synthase (CYP11B2) exclu- sively in the z ona glomerulosa [11]. The 11b-and 18-hydroxylation of the substrate 11-deoxycorticosterone (DOC) leads to corticosterone (B) and 18-hydroxycorticos- terone (18-OH-B), whose 18-oxidation yields aldosterone. In the zona fasciculata/reticularis, the 11b-hydroxylase (CYP11B1) catalyzes the 11b-hydroxylation of 11-deoxy- cortisol to produce cortisol which is normally secreted 100- to 1 000-fold in excess over a ldosterone [12]. C YP11B1 is also able to produce corticosterone from 11-deoxycorti- costerone but it cannot convert c orticosterone i nto aldosterone [7,13]. The translated proteins of t he two human i soenzymes o f C YP11B contain 503 amino acids, including a 24-residue N-terminal mitochondrial targeting sequence, and s hare 93% sequence i dentity [6]. There are only 32 a mino-acid differences in the mature forms of t he two cytochrome P450 proteins. The apparent molecular masses of the aldosterone synthase and 11b-hydroxylase have been determined to be 48.5 and 50 kDa, respectively [13]. Both enzymes are lo calized in the i nner mitochondrial membrane and f unction alongside the flavoprotein adreno- doxin reductase (AdR) [14], and adrenodoxin (Adx) [15]. Correspondence to R. Bernhardt, Universita ¨ t des Saarlandes, FR. 8.8 Biochemie, P O Box151150, D-66041 Saarbru ¨ cken, Germany. Fax: + 4 9 681302 4739, Tel.: + 49 681302 4241, E-mail: ritabern@mx.uni-saarland.de Abbreviations: CYP11B1, c ytochrome P450 11b ,11b-hydroxylase; CYP11B2, cytochrome P450 aldo , aldosterone synth ase; Adx, adreno- doxin; AdR, adrenodoxin reductase; SS, Dahl salt- sensitive rat; S R, Dahl salt-resistant rat; SRS, substrate recognition site; DOC, 11-deoxycorticosterone; B, corticosterone; 18-OH-B, 18-hydroxy- corticosterone; A ldo, aldosterone; HPTLC, high p erformance thin layer chromatography; D M EM, Dulbecc o’s m o dified E a gle’s med ium. Enzymes:steroid11b-hydroxylase and aldosterone synthase (EC 1.14.15.4); adrenodoxin re ductase ( EC 1.1 8.1.2). Note: a website is available at h ttp://www.uni-saarland.de/fak8/ bernhardt/ (Received 2 9 August 2001 , revised 30 November 2001, a ccepted 7 December 2001) Eur. J. Biochem. 269, 1118–1127 (2002) Ó FEBS 2002 Lifton et al. [ 16] described a patient carrying a chimeric gene consisting of a 5 ¢-CYP11B1 r egulatory s equence fused to a 3¢-CYP11B2 portion, causing glucocortico id-remedi- able aldosteronism. The encoded chimeric p rotein, w hich is a result of an unequal meiotic cross-over upstream of intron 5, possessed efficient aldosterone synthase activity. Previous studies have primarily concentrated on the C-terminal amino a cids, emphasizing t heir importance f or the individual a ctivities of CYP11B1 a nd CYP11B2. For instance, by s ubstituting the positions 301, 30 2 a nd 32 0 i n CYP11B2 by CYP11B1-specific residues, a switch in the regio- and stereospecificity of the enzymatic activity can be observed [17]. Moreover, an aldosterone synthase activity could b e converted from CYP11B2 to the 11b-hydroxylase, when creating a C YP11B1 double mutant c ontaining the aldosterone synthase specific amino acids glycine and alanine a t positions 288 and 320, respectively [18 ]. Bo ¨ ttner et al . [ 19] have shown that the mutant A320V of CYP11B1 displays only 20% aldostero ne synthase wild-type activity when expressed in COS-1 cells in the presence of DOC, indicating that other amino acids, including some at the N-terminus, contribute to efficient CYP11B1 and CYP11B2 wild-type activity. In addition, it is known from the crystal structures of CYP101, CYP108 and CYP102 that the N-terminal region encodes an amino-acid sequence that is involved in substrate recognition and binding as well as redox partner binding [20]. This finding was also supported by results obtained with microsomal P 450 proteins. Ridderstro ¨ m et al. [ 21] have shown t he functional i mpor- tance of Arg97 and Arg108 in the activity of CYP2C9, especially for substrate binding, by site-directed mutagenesis and homology modelling. The phenotypical abnormality of hypertension was examined using the model system of Dahl salt-sensitive (SS) and s alt-resistant ( SR) r ats demonstrating the essential role of exons 3 and 4 of aldosteron e synthase [22], w hich also implicates t he significance o f the N-terminal region of CYP11B2 in e nzymatic activity. These studies prompted us to perform protein sequence- and structure-based align- ments of human CYP11B f amily members with mouse a nd rat CYP11B1 and CYP11B2, human CYP2C9 and P450s with known three-dimensional s tructures. We concentrated our efforts on the N-terminal amino acids, which differ between the human CYP11B1 and CYP11B2 enzyme, and are c and idate residues for influencing the enzymatic activity of human aldosterone synthase. As the two helices, B and C, of the structurally known c ytochromes P450 located in the N-terminal pro tein regions play an essential role i n the high substrate s electivity and redox partner interaction [23,24], we investigated whether t he amino acids of human CYP11B2 located in regions aligned with these helices are of functional importance. They were replaced by the corresponding amino a cids of hum an, mouse a nd rat CYP11B1 u sing site-directed mutagen esis and t he mutants were characterized with respect to their hydroxylation selectivity. MATERIALS AND METHODS Materials Expression vector pSVL was purchased from Pharmacia Biotech Inc. Oligonucleotides were synthesized on an Applied Biosystems model 380A DNA synthesizer at BioTez (Berlin). COS-1 cells were obtained from the American Type Culture Collection. Cell culture media, pyruvate, glutamine, antibiotics and Hepes were from Sigma. Fetal bovine serum and DEAE-dextran were obtained from GibcoBRL and Pharmacia Biotech Inc., respectively. Chloroquine, Hank’s balanced salt solution, dimethylsulfoxide, 11-deoxycorticosterone, corticosterone, 18-hydroxycorticosterone, aldosterone, 11-deoxycortisol, cortisol, 4-chlor-1-naphthol and secondary horseradish conjugated anti-(rabbit IgG) Ig were all from Sigma. [ 14 C]11-deoxycorticosterone and [ 3 H]11-deoxycortisol were purchased from DuPont NEN. HPTLC plates silica ge l 60 F 254 and s olvents w ere f rom M erck. The BCA a ssay kit for quantitation of total protein was purchased from Pierce. Site-directed mutagenesis and expression vectors Mutations were inserted into human C YP11B2 cDNA by site-directed mutagenesis u sing th e Q uick Change Kit from Stratagene Ltd (Cambridge, UK), according to m anufac- turer’s instructions and using mutagenic p rimers listed in Table 1 . The cell culture expression construct pSVL/ CYP11B2 w as used as a t emplate. This construct contains the cDNA encoding human aldosterone synthase. The sequence corresponds to that published by Kawamoto et al. [7] with one variation at position 249, where we found Ser instead of Arg, as described by Mornet et al.[6].All exchanges w ere c onfirmed by automatic sequencing using a LiCor-4000 DNA sequencer (MWG Biotech, Ebersberg, Germany), thus excluding undesired mutations. To express t he human 11b-hydroxylase enzyme, we u sed the cDNA sequence corresponding to that described by Mornet et al. [6], except for three modifications. These modifications led to the following variations in the encoded protein: Leu at position 5 2 is r eplaced by Me t, Ile 78 i s replaced by Val, and at position 494 we found Phe instead of Cys, as published by Kawamoto et al. [ 25]. The c DNA was cloned into the mammalian cell expression vector pSVL. All standard procedures were carried out as described by Sambrook et al .[26]. Cell culture COS-1 cells were grown at 37 °Cand6%CO 2 in Dulbecco’s modified E agle’s medium (DMEM) supple- mented with 5% fetal bovine serum, 0.1 mgÆmL )1 strepto- mycin, 100 UÆmL )1 penicillin, 1 m M pyruvate and 4 m M L -glutamine. Table 1. Sequences of forward oligonucleotides e mployed fo r t he mutagenesis of the human aldosterone synthase and the corresponding amino-acid exchanges. Nucleotides represented in bold characters indicate mismatched bases in CYP11B2. Codons for the changed amino acids ar e underlined. Mutation Oligonucleotide sequences I112S CCTGCAGGATG CCCCTGGAG I112P CCTGCAGGATG AGCCTGGAG D147E GCTGAACCCA GAAGTGCTGTCGCCC D147E/K152N ACCCA GAAGTGCTGTCGCCCAACGCCG TGC Ó FEBS 2002 Effect of I112P, D147E, K152N on CYP11B2 activity (Eur. J. Biochem. 269) 1119 Transient transfections and enzymatic assays Transfections were performed using the DEAE-dextran method as described previously [27], modified a s f ollows: COS-1 cells we re plated at a density of 6 · 10 5 cells per 6-cm dish and grown overnight. Next day, the medium was aspirated and the cells were subjected to starvation by incubating in 2 mL fetal bo vine serum-free medium containing Hepes to a final c oncentration of 5 0 m M . The incubation time was fi xed to 2 h. After removing the medium, the C OS-1 cells were cotransfected with 5 lgof CYP11B2 or CYP11B1 expression plasmid and 3 lgof pBAdx4 (a generous gift from M. Waterman, D epartment of Biochemistry, V anderbilt University School of Medicine, Nashville, USA) mixed with 1 mL s tarvation Medium supplemented with 250 lg DEAE-dextran. After 1 h, 2 mL of complete medium containing chloroquine to a final concentration o f 100 l M were added, and t he incubation of the cells was continued for 2 h . For the subsequent dimethylsulfoxide treatment, the medium was replaced by 2 m L o f H ank’s balanced salt s olution supplemented with 10% dimethylsulfoxide for exactly 2 min. Afterwards, the cells were washed twice with Hank’s balanced salt solution and cultured with 3 mL of complete medium. To assay f or CYP11B1- and CYP11B2-dependent activities, the cells were incubated 24 h after transfection with 2 mL complete medium containing either 30 l M DOC and 6 nCi 14 C-labelled DOC or 30 l M 11-deoxycortisol a nd 0.6 lCi 3 H-labelled 11-deoxycortisol. Following a 48-h incubation period, steroids were extracted twice from the c ell culture supernatant with m ethylene c hloride a nd the organic phase was dried. The residues were d issolved in 10 lL methanol and spotted onto glass-baked silica-coated high perfor- mance thin layer chromatography (HPTLC) plates. The HPTLC plates were developed twice in methylene chloride/ methanol/water (300 : 20 : 1, v/v/v). The reacti on products were identifie d by comigration o f unlabeled steroid refer- ences an d quantified after 2 days exposure on a bioimaging analyser (BAS-2500, Fuji P hoto Film Co., Ltd). After substrate incubation, the transfected COS-1 cells were lysed, as described p reviously [19], a nd subjected to immunolog- ical d etection of cytochro me P 450 expression a ccording to standard procedures [26,28] using an anti-(human CYP11B) serum (a kind gift from H. Takemori, Department of Physiological Chemistry, O saka University Medical School Osaka, Japan). The total amounts of protein were quanti- fied using a BCA assay kit, according to t he manufacturer’s protocol. Alignment of P450 sequences and protein modelling Multiple s equence a lignment was carried out usin g CLUSTALW 1.8 [29]. The secondary structure p redictions were produced by the network method using PHDSEC [30]. The modelling o f t he thre e-dimensional structure of CYP11B1 was carried out by homology modelling with bacterial c ytochromes w ith known three-dimensional s truc- ture from the Protein Data Bank [31], using the SYBYL 6.6 subroutine COMPOSER (Tripos Inc., St Louis, MO, USA). The standard procedure of p rotein modelling using COMPOSER includes the following steps: (a) determination of an initial set of topologically equivalent r esidues by using the multiple s equence alignment method, which is then used to produce an optimal structural alignment of the cyto- chromes P450 with known stru cture; (b) determination of structurally conserved regions (SCRs) of the p roteins b ased on this structural alignment; (c) building o f the backbone of each SCR in the model by fitting a most appropriate fragment from one of the cytochromes P 450 with known three-dimensional structure and determination of the side- chain conformations based on information about the backbone secondary structure and the s ide chains o f the corresponding residues i n e ach o f t he protein templates; ( d) searching f or protein loops i n o rder to design the backbone conformations of t he structurally variable regions (SVRs) with visual inspection to avoid poor steric interaction w ith surrounding parts of the protein model. The models of the three-dimensional structure of CYP11B2 and the mutants were made by using p oint mutations and protein loop search for regions which are different for CYP11B1 and CYP11B2 by means of the SYBYL programme suite, as described previously [32]. Energy m inimizatio n was perfo rmed for t he structures of the models in the presence o f water; t he Tripos Force Field was used. The optimum was r eached when the energy gradient was lower than 0.05 kcalÆmol )1 ÆA ˚ )1 . However, n o more than 500 minimization steps were u sed. The Powell Conjugate Gradient method was u sed for energy minimi- zation in both cases. V erification of the obtained models was c arried out using PROCHECK [33] and PROSA [34] and all the models showed appropriate quality. RESULTS Alignment of human, mouse and rat CYP11B1 and CYP11B2 with crystallized cytochromes P450 and human microsomal CYP2C9 Although the sequence identities between the multitude of P450 enzymes, identified t o date, are frequently less t han 20%, there is a Ôstructural coreÕ common to all P450s [23], indicating high conservation of secondary structu re. Based on this fact, we performed amino-acid sequence and structure alignments o f human 1 1b-hydroxylase and aldo- sterone synthase with structurally known P450s and the human CYP2C9 ( Fig. 1). W e focused on the distribution o f 32 amino a cids that d iffer in the mature forms of CYP11B1 and C YP11B2, in order to i dentify candidates residues for determining the efficient c atalytic functions of the two enzymes. We discovered that residue 112 is located in a region aligned with t he substrate recognition s ite (SRS) 1 of CYP2 family members [35] and the B helix of the c rystal- lized P450s (Fig. 1). As the helices A, B, B¢,FandGofthe crystallized P450 proteins may contribute to the high substrate specificity to cytochrome P450 [23], an d as the conversion of a multitude of compounds might be due to the high variability i n the SRS o f th e family 2 P 450s [35], amino acid 112 of CYP11B1 a nd CYP11B2 may therefore be involved in specific substrate recognition of human 11b- hydroxylase and aldosterone synthase. Residues 147 and 152 are encoded by exon 3 . Its functional relevance was demonstrated by the use of the model system of Dahl SS and SR rats [ 22] encoding the amino-acid substitution E136D. The double mutant E136D/Q251R in Dahl SR rats resulted in a 1000-fold enhanced enzymatic a ctivity i n D ahl SR rats. Furthermore, amino acids 147 and 152 are placed 1120 S. Bechtel et al. (Eur. J. Biochem. 269) Ó FEBS 2002 Fig. 1. M ultiple s equence alignment be tween s everal cy tochromes P 450. Th e a lignment w as do ne us ing CLUSTALW 1.8 ( 31). The regions corre- sponding to he lices and the heme-binding area of the structurally known P 450s are indicated and examplified by the underlines in the CYP101 sequence. T he shaded po sitions in t he human CYP11B sequences re present the residues selected for investigation, whereas t he shaded p art in t he CYP2C9 sequence ind icates its put ative SRS1, belonging t o the substrate r ecognition sites i n CYP2 family m embers identified b y Gotoh ( 37) . Ó FEBS 2002 Effect of I112P, D147E, K152N on CYP11B2 activity (Eur. J. Biochem. 269) 1121 in an area aligned with the C helix of the so far crystallized P450 enzymes ( Fig. 1). These amino acids could p lay a n important functional role, especially with regard to the interaction w ith Adx, i n a ccordance with the observation that the helices B, C, J, J ¢, K, L of several known b acterial P450s seem to be involved in redox partner binding [24]. Site-directed mutagenesis and expression of CYP11B2 mutants Three single mutants, two double mutants and one triple mutant of CYP11B2 were created by site-directed muta- genesis u sing the oligonucleotides listed i n Table 1, in addition to th e complementary oligonucleo tides. Thus, the human aldosterone synthase wild-type amino acids were replaced with the corresponding residues of human, mouse and rat CYP11B1, respectively, as summarized in Table 2 . The successful insertion of the intended mutations was verified by sequence analysis. By performing three independent transfection experi- ments, we found no substantial deviations in expression levels b etween the wild-type and mutant proteins. This result suggests t hat the amino-acid exchanges had no influence o n protein stability o r expression le vel (data not shown). Enzymatic activity of aldosterone synthase mutants To analyse the enz ymatic specificities of the CYP11B2 mutants, as compared to the wild-type proteins, we contransfected the resultant plasmids together with pBAdx4 into COS-1 cells. The coexpression of bovine adrenodoxin has been demonstrated to be a u seful approach to increase the activity of the human s teroidogenic enzymes, as well as the sensitivity of the t est system [ 17,36–38]. To estimate the aldosterone-producing or cortisol-synthesizing potential, the cells were incubated with either DOC or 11-deoxycor- tisol, respectively. Different concentrations of DOC o r 11-deoxycortisol (ranging from 10 to 80 l M ) a nd differen t incubation times were used to optimize the incubation conditions; the optimal conditions were found to be 30 l M DOC o r 3 0 l M 11-deoxycortisol and 48 h incubation. Under the conditions tested, c omparable relative activities between the respective c onstructs were detected without affecting the viability of C OS-1 cells during s ubstrate incubation (data not shown). Using the optimized con di- tions, t he different mutants and the wild-type enzymes were characterized with respect to all three catalytic activities 11b-hydroxylation, 18-hydroxylation and 18-oxidation. The mutated CYP11B2 enzymes were analysed by incubating them with DOC as substrate (Fig. 2). No significant alteration in substrate conversion was detectable for mutant I112S, as compared to CYP11B2 wild-type, indicating that this amino-acid exchange had n o effec t on the enzymatic activity. The same observation was made f or the single mutant K152N (M. Hampf, Max-Delbru ¨ ck- Centre, B erlin, G ermany, p ersonal c ommunication). I n contrast, a ll other mutants induced markedly different steroid profiles relative to the wild-type of CYP11B2, as shown in Fig. 2. It is obvious that more intermediates (B and 18-OH-B) were produced from DOC due to a substantial increase in the activities of the mutants. How- ever, the three enzymatic steps were affected to diffe rent extents, represented b y the relative activities as shown in Fig. 2B. As e vident from the comparison of the 11b- hydroxylation activities of all constructs (Fig. 2B), the introduction of Pro a t position 112 enhanced the activity of the first enzymatic reaction s tep more than three fold, Table 2. Corresponding amino ac ids of human CYP11 B2 and CYP11B1 as well as m ouse and rat CYP11B1 at t he positions s elected for mutagenesis. Position Human CYP11B2 Human CYP11B1 Mouse and rat CYP11B1 112 I S P 147 D E N 152 K N K Fig. 2. Enzymatic activities of aldosterone synthase and 1 1b-hydroxy- lase. (A) Enzymatic activities of aldosterone synthase and 11b- hydroxylase w ild-type enzymes and different CYP11B2 site-directed mutants expressed in COS-1 cells towards 11-deoxycorticosterone (30 l M DOC a nd 6 nCi of [ 14 C]DOC). Mock rep resen ts the tran sfec- tion with the empty vector pSVL. Steroid patterns o f DOC conversion are given as means ± SEM o f four similar independent experiments performed in duplicate. T he am ounts of t he su bstrate, t he i ntermedi- ates corticosterone (‘B’) and 18-hydroxycorticosterone (18-OH-B) and the final product aldosterone (Aldo) are presented as percentages of total activity. (B ) R elative a ldostero ne syn thase act ivities. T he effects of the aldosterone synthase mu tants on the 11b-hydroxylation (ratio of RB + 18-OH-B + A ldo/DOC), 18-hydroxylation [ ratio of R18-OH- B plus Aldo)/B] and 18-oxidation (ratio of Aldo/18-OH-B) activity of CYP11B2 are presented. The a ctivities are shown as means ± SEM (n ¼ 8). 1122 S. Bechtel et al. (Eur. J. Biochem. 269) Ó FEBS 2002 whereas a fourfold increase was observed f or the D147E mutant, representing the strongest effect on the 11b- hydroxylation a ctivity o f all single mutants investigated here. When both mutations were introduced into CYP11B2, the 11b-hydroxylation c apacity was additionally activa ted, obtaining a s ixfold enhancement i n relation to the wild-typ e enzyme (Fig. 2B). I n c ontrast, t he introduction of another amino-acid exchange (I112P/D147E/K152N) led to a 26% reduction in 11b-hydroxylation activity, as compared to th e double mutant I112P/D147E, which demonstrated slightly increased a ctivity o f the first enzymatic reaction s tep, as did the single mutant D147E (Fig. 2B). The same observation was made for mutant D147E/K152N (exhibiting a 20% reduction), as compared to t he single mutant D147E. The 11b-hydroxylation activity of the double replacement mu- tant, D147E/K152N, equalled almost t hat of mutant I112P. Obviously, K 152N in combination with the mutations D147E and I112P/D147E minimized the activating c harac- ter of the corresponding mutants (Fig. 2 B). The second catalytic step performed by human C YP11B2 was not as strongly enhanced as the fi rst enzymatic modification i n all mutants studied (Fig. 2 B). The construct containing the I112P substitution could be clearly identified as the single mutant displaying the strongest activation of the 18- hydroxylation; 1.7-fold compared to the CYP11B2 wild- type, suggesting a critical r ole of t his residue in the second enzymatic r eaction step o f C YP11B2 (Fig. 2B). In c ontrast, this reaction step seems to be unaffected by the single replacement D147E. The same observation was made f or the double replacement mutant I112P/D147E showing 18- hydroxylation activity c omparable to C YP11B2 wild-type (Fig. 2 B), thus suggesting a slightly negative influ ence of D147E on the second hydroxylation s tep when combined with I112P. Interestingly, insertion o f one more human CYP11B1- specific residue at position 152 (I112P/D147E/K152N) leads to an increase (13%) in h ydroxylation a t position 18 (Fig. 2 B), c ompared to the corresp onding double mutant without K152N. This data indicates that K152N positively affected the 1 8-hydroxylation potential when c ombined with I112P and D147E. Investigation of aldosterone synthesizing abilities demonstrated that all mutants pro- duced slightly higher amounts of this steroid than CYP11B2 wild-type (Fig. 2A). Comparing the relative amounts o f aldosterone and 18-OH-B formation ( Fig. 2A), it becomes clear that 18-oxidation activity displays a s lightly d ecreased efficiency in all investigated mutants, except f or I112S a nd D147E, when compared to the CYP11B2 wild-type emzyme (Fig. 2B). In the second set of experiments, we investigated the activity of wild-type a nd mutant proteins towards the 11b- hydroxylase-specific substrate, 11-deoxycortisol. As seen for DOC, we observed an overall tendency of all mutants, except I112S, t o strongly improve the substra te conversion in relation to the CYP11B2 wild-type p rotein (Fig. 3 ). By replacing t he amino acids in positions 112 and 147 of CYP11B2 with those f ound in mouse, rat and human CYP11B1, the two single substituted proteins I 112P and D147E were obtained. These mutants displayed i ncreases of 80% (1.8-fold) and 90% (1.9-fold) in cortisol-synthesizing activities, r espectively, as compared to the CYP11B2 wild- type enzyme (Fig. 3A,B). A s shown in Fig. 3A, the product formation for the double mutant I112P/D147E w as enhanced by more than 200%, which represents a 2.7-fold increase on CYP11B2 wild-type activity (Fig. 3 B), when incubated with 11-deoxycortisol. The data from the I112P/ D147E mutant indicate an additive effect of the two single mutants. The combined substitutions at positions 147 and 152 (double mutant D147E/K152N), and 112, 1 47 and 1 52 (triple mutant I 112P/D147E/K152N) gave r ise to c ortisol- producing activity increases of 1.6-fold and 2.5-fold, respectively, compared t o the CYP11B2 wild-type. These results s how that the replacement of lysine 152 by gluta- mine did not further enhance the cortisol production of the corresponding single or double mutant (Fig. 3B), demonstrating that the 11b-hydroxylase activity of CYP11B2 seems t o b e unaffecte d by an amino-acid change at position 15 2. DISCUSSION In humans, certain phenotypical abnormalities, such as essential hypertension, cardiovascular or endocrine diseases, Fig.3.Assessmentof11b-h ydroxylase a ctivity and determination of 11b-hydroxylase capacity. (A)Assessmentof11b-hydroxylase activity of CYP11B2 var iants e xpressed i n COS-1 cells. Cells were cotrans- fected with the indicated wild-type proteins, mutants or the empty vector pSVL a s a negative control (Mock) an d the c DNA o f b ovine Adx.Datashownaremeans±SEMoffourseparatetransfections, each done in duplicate. (B) Determination of 11b-hydroxylase capacity of CYP11B2 mutants in relation to the wild-type enzyme, when incubated with 11-deoxycortisol. The 11b-hydroxylation of 11-deoxycortisol catalysed by the mutated proteins is shown as percentage of CYP11B2 wild-type ac tivity, fixed t o 100%. The values given are means ± SEM of four separate transfections, each performedinduplicate. ÓFEBS 2002 Effect of I112P, D147E, K152N on CYP11B2 activity (Eur. J. Biochem. 269) 1123 are p artially caused by gen etic variations of CYP11B1 and/ or CYP11B2 [39,40]. Due to this fact, it is of great interest to obtain a deeper insight i nto the structural features under- lying the determination o f individual activities of these enzymes. Several structural determinants of human 11b- hydroxylase and aldosterone synthase have already been elucidated in previous studies [17–19,41,42]. These stuc tures are mainly located in the C-terminal regions of CYP11B1 and CYP11B2. So far, the role of distinct amino acids of the N-terminal regions of human C YP11B isozymes h as n ot been studied extensively, although it is known that the N-terminal domains of CYP11B1 and CYP11B2 differ more from each other than the C-terminal ones, as also seen in CYP11B isoforms o f other mammals such as rat, hamster or mouse ( Fig. 1). Therefore, our studies were focussed o n the residues at positions 112, 147 and 152 due to their location in protein regions aligned with functionally important areas o f crystallized P450 e nzymes [20,43] (Fig. 1 ). In this way, we intended to i dentify k ey amino- acid residues of C YP11B2 implicated in t he regulation of individual r eaction steps. Swapping the amino acid at position 147 from CYP11B2 to CYP11B1, led to a s tronger increase in the hydroxylation at the 11b-position of the substrates than mutant I112P, with a smaller effect in case of 11-deoxycortisol compared with DOC. The results obtained with the single substitution (D14 7E) are in contrast to those presented b y Fisher et al. [44]. They reported no effect of D147E on the 11b-hydroxylation o f 11-deoxycortisol. The observed difference might be due to polymorphisms i n the CYP11B locus, different experimental conditions or differ- ent steroid detection methods used by either group. The double mutant I112P/D147E e xerted the most p ronounced enhancement o f the 11 b-hydroxylation of b oth substrates (sixfold and 2.7-fold increases, as compared to the CYP11B2 wild-type activity, in the case of DOC a nd 11-deoxycortisol, respectively), indicating an almost addi- tive effect, but not a synergistic effe ct, o f t he two substi- tutions. Th e conversi on of 11-deoxycortisol was not altered by the replacement K152N, while the substitution slightly influenced the enzymatic reaction steps of aldosterone synthesis from DOC, s uggesting only minor functional relevance of lysine 152 in human C YP11B2. In contrast to the insertion of glutamic acid in position 147, the replacement I112P also increased the 18-hydroxy- lation activity (1.7-fold increase c ompared t o t he CYP11B2 wild-type enzyme; Fig. 2B), in addition to significantly enhancing the 11b-hydroxylation potential. The absolute amount of aldosterone formation was slightly enhanced for all mutants (Fig. 2A). However, the 18-oxidation activity (Fig. 2 B) was either e qual to the wild-typ e (D147E only), or even slightly decreased ( all o ther mutants). Although the enzymatic activity remained unchanged by th e intraspecies replacement I112S (Table 2), the esse ntial r ole o f residue 112 of human aldosterone synthase was clearly shown by mutant I112P. This demonstrated the importance of the correct residue at position 112 to ensure the s pecies-specific selectivity of substrate hydroxylation. Thus, mutant I112P produced an increased amount of 18-OH-B compared to the w ild-type. This is in a ccordance with the observation that rat CYP11B2, which contains proline instead of isoleucine in position 112, produces higher levels of 18- OH-B than human CYP11B2 [45,46]. I112 and S112 seem to be conserved in the human enzymes to prevent the strongly increased 18-OH-B production as seen when proline is i nserted. The position of residue 112 in the recently developed computer model of human C YP11B2 [32] (Fig. 4 ) suggests structural modifications in the sub- strate access channel induced by its r eplacement. Therefore, the observed significantly higher hydroxylation activities of the r esulting mutants m ight be attributed to a faster a nd easier passage of the substrate, possibly caused by a substrate access channel enlargement (Fig. 5). Also, t he slightly reduced oxidation activity of these constructs suggests a facilitated intermediate dissociation from the active site before be ing oxidized at the 18th position. Thus, the amino-acid replacement I112P located in t he B-helix of the C YP11B2 model (Fig. 4), might lead to a partial loss of enzymatic specificity. This suggestion is i n agreement with the observed contribution of helices A, B, B¢,FandGtothe high specificity of other cytochromes P450 [47]. Our finding of an exclusive increase in the 1 1b-hydroxy- lation capacity of CYP11B2 by the replacement D147E indicates that residue 147 in the CYP11B isoform is involved in spe cific s ubstrate conversion. This conclusion agrees with earlier observations mad e by Bo ¨ ttner et al .[36] who, while evaluating the f unctional relevance of the region flanked by amino acids 296 and 339 in human CYP11B1, found out that resid ues other than those investigated, appeared to be required for efficient 11b-hydroxylation. The position of D147 o n the protein surface of the CYP11B2 model (Fig. 4) suggests, however, that an indirect influence exists, possibly via the m ediation of structural modifications induced by redox partner binding o r by the interaction with other proteins of the mitochondrial membrane, such as CYP11A1. It was previously shown that CYP11B1 and CYP11B2 were able to interact not only with the redox partner but also with CYP11A1 [ 37,48]. As a consequence, in the bovine system an enhancement of the 11b-hydroxy- lase activity was observed, whereas the aldosterone synthe- Fig. 4. C omputer model of the three-dimensional structure of the human CYP11B2. Th e view is focused on the investigated amino acids and the heme-group of the P450 enzyme which are marked. The arrow indicates the putative substrate access channel. The p utative I-helix, running through the molecule like a tunnel, is s hown in th e center. 1124 S. Bechtel et al. (Eur. J. Biochem. 269) Ó FEBS 2002 sizing activity was suppressed [49]. However, this effect seems to be species-specific, as in the human system n o effect of CYP11A1 on the product pattern has been found [37]. As the observed effects o f mutant D147E investig ated here can be attributed to a c onservative a mino-acid exchange, t he side-chain size variations at position 147 seem to be important. A similarly crucial e ffect on the e nzymatic activity was demonstrated for mutant E198D of human CYP11B2, leading t o a reduction in aldosterone synthase activity [50]. Taken together, our data clearly d emonstrate for th e first time the functional relevance of N-terminal amino acids in human CYP11B2 for substrate recognition. In addition, they provide evidence t hat amino acids that a re placed outside the a ctive center ( Fig. 4) are essential for efficient catalytic activity of human aldosterone synthase. Our observations are supported by data obtained with other cytochrome P450 family members. Amino-acid 4 of Gunn rat CYP2C11 has been shown t o play a n important role in testosterone hydroxylation, possibly in modulating sub- strate channel conformation [51], whereas Arg112 of CYP101, located on the protein surface, is essential for electron transfer from putidaredoxin to this cytochrome P450 enzyme [52]. However, i t becomes a pparent by our data that in contrast to studies on Dahl SR rats [22], the examined amino-acid replacements between the two human CYP11B isoenzymes in exon 3 exerted a more modulating effect than a dramatically in creasing effect on the enzymatic activity. Nevertheless, it is conceivable that pathological abnormal- ities observed in p atients with essential hypertension could be caused by simil ar mutations as the analysed ones, due to their strongly increase d 18-OH-B and i ncreased aldosterone formation. Our hypothesis is in a ccordance with the report of Fardella et al. [53], suggesting e ssential hypertension for the mutant K251R of CY P11B2. This mutation caused a 400% and 50–80% enhancement in the formation of 18-OH-B and aldosterone, respectively. In conclusion, the studies presented here are the first example o f conferring CYP11B1 specific cortisol-producing function to the aldosterone synthase, t hereby simultan- eously increasing the CYP11B2 specific catalytic activity. Furthermore, we were able to demonstrate that the three enzymatic reaction steps of aldosterone synthesis could not only be modified independently, as evident with mutant D147E (where only the first reaction step was increased), but also differentially, as seen by mutant I112P ( where the three hydroxylation steps were affected to a different amount). This indicates t he possibility of dissecting the single reactions in aldosterone synthase activity by mutating defined positions in the primary structure, supporting the idea of divergent s tructural determinants of each reaction step. ACKNOWLEDGEMENTS This w ork was supported by a Grant fro m the Deutsche Forschungs- gemeinschaft t o R. B., Be 1343/2-6, a nd a visitor Grant from the Deutsche Forschu ngsgemeinschaft to N. B. We thank Michael Lisurek for assistance with computer modelling and Katharina Bo mpais for expert DNA sequenc ing. We also express our gratitude to Achim Heinz for h elpful discussion. REFERENCES 1. Bernhardt, R. (1996) Cytoc hrome P450 structure, function, and generation of reactive oxygen species. Rev. Physiol. Biochem. Pharmacol. 127, 137–221. 2. Yanagibashi, K., Haniu, M., Shively, J.E., Shen, W.H. & Hall, P. (1986) The synthesis of aldosterone b y the adrenal c ortex. Two zones (fasciculata and glomerulosa) possess one enzyme for 11 beta-, 18-hydroxylation, and aldehyde synthesis. J. Bi ol. Chem. 261, 3 556–3562. 3. Nonaka, Y ., Takemori, H., Halder, S.K., Sun, T., Ohta, M., Hatano, O., Takakusu, A. & Okamoto, M. (1995) Frog cytochrome P-450 (11 beta, aldo), a single enzyme involved in the final steps of glucocorticoid and mineralocorticoid biosynthesis. Eur. J. Bio c hem. 229, 2 49–256. 4. Morohashi, K., Yoshioka, H., G othoh, O., Okada, Y., Yamam- oto, K., Miyata, T., Sogawa, K., Fujii-Kuriyama, Y. & Omura, T. (1987) Molecular c lo ning and nucleotide s eq uence of DNA of Fig. 5. P utative structures of the s ubstrate access c hannel of human CYP11B2 wild-type enzyme ( A) an d t he two mutants I112S (B) and I112P (C). The heme-groups and the analysed amino acids in position 112 are displayed i n capped sticks. Ó FEBS 2002 Effect of I112P, D147E, K152N on CYP11B2 activity (Eur. J. Biochem. 269) 1125 mitochondrial cytochrome P-450 (11 beta) of bovine adrenal cortex. J. Biochem. 102, 559– 568. 5. Mitani, F., Shimizu, T., Ueno, R., Ishimura, Y., Izumi, S., Komatsu, N. & Watanabe, K. (1982) Cytochrome P-45011 beta and P450scc in a drenal cortex: z onal distribution an d intrami- tochondrial localization by the horseradish peroxidase-labeled antibody m ethod. J. Histochem. Cytochem. 30, 1066–1074. 6. Mornet, E., Dupont, J ., Vitek, A. & White, P.C. (1989) Charac- terization of two g enes encod ing hu man steroid 11 b eta-h ydrox- ylase ( P-450 11b ). J. Biol. C hem. 264, 2 0961–20967. 7. Kawamoto, T., Mitsuuchi, Y., O hnishi, T., Ichikawa, Y., Yokoyama, Y., Sumimoto , H., Toda, K., Miyahara, K., Kuribayashi, I. & Nakao, K., et al. (1990) Cloning and expression of a cDNA for human cytochrome P-450 aldo as related t o p rimary aldosteronism. Bioc hem. Biop hys. Res. Commun. 173, 309– 316. 8. Domalik, L.J., Chaplin, D.D., Kirkman, M.S., W u, R.C., Liu, W., Howard, T .A., Seldin, M .F. & Parker, K.L. (1991) Different iso- zymes of m o use 11 beta-hydroxylase produce m ineralocorticoids and glucocorticoids. Mol. Endocrinol. 5 , 1853–1861. 9. Nonaka, Y., Ma tsukawa, N., Morohashi, K., O mura, T ., Ogihara, T., Teraoka, H. & Okamoto, M. (1989) Molecular cloning a nd sequence an alysis of cDNA encoding rat adrenal cytochrome P-450 11b . FE BS Lett. 25 5 , 21–26. 10. Mukai,K.,Imai,M.,Shimada,H.&Ishimara,Y.(1993)Isolation and charact erizatio n of r at CYP1 1B ge nes in volve d in l ate s teps of mineralo- a nd glucocorticoid syntheses. J. Biol. Chem. 26 8, 9130–9137. 11. Mitani, F. (1979) Cytochrome P450 i n a drenocortical mitochon- dria. Molec. Cell. B iochem. 24, 21–43. 12. Pascoe, L., Curnow, K.M., Slutsker, L., Connell, J.M.C., Speiser, P.W., New, M.I. & White, P.C. (1992) Glucocorticoid-suppress- ible hyperaldosteronism results from hybrid genes created by unequal crossovers betwee n CYP11B1 and CY P11B2. Proc. Natl Acad. Sci. USA 89 , 8327–8331. 13. Ogishima, T., Shibata, H., Mitani, F., Suzuki, H., S aruta, T. & Ishimura, Y. (1991) Aldosterone synthase cytochrome P-450 expressed in the adrenals of patients with p rimary aldosteronism. J. Biol. Chem. 26 6, 10731–10734. 14. Sagara, Y., Takata, Y., Miyata, T., Hara, T. & Horiuchi, T. (1987) Cloning and sequence analysis of adrenodoxin reductase cDNA from bovine adrenal cortex. J. Biochem. (Tokyo) 102, 1333–1336. 15. Grinberg, A.V., Hannemann, F., Schiffler, B., Mu ¨ ller, J., Heinemann, U. & B ernhard t, R. (2000) Adrenodoxin: s tructure, stability, an d electron t ransfer properties. Proteins 40 , 590–612. 16. Lifton, R.P., Dluhy, R.G. & Powers, M. (1992) Chimaeric 11 beta- hydroxylase/aldosterone s ynthase gene c auses glucocorticoid- remediable aldosteronism and human hypertension. Nature 355, 262–265. 17. Bo ¨ ttner, B., Schrauber, H. & Bernhardt, R . (1996) Engineering a mineralocorticoid- to a g lucoco rticoid-synthesizing cyto chro me P450. J . Biol. Chem. 271, 8028–8033. 18. Curnow, K.M., Mulatero, P., Emeric-Blanchouin, N., Aupetit- Faisant, B., Corvol, P. & Pascoe, L. (1997) The amino acid substitutions Ser288Gly and Val320Ala convert the cortisol producing enzyme, CYP11B1, into an aldosterone producing enzyme. Nat. Struct. Biol. 4, 32–35. 19. Bo ¨ ttner, B. & Bernhardt, R. (1996) Changed ratios of glucocor- ticoids/mineralocorticoids caused by point mutations in the putative I-helix regions of CYP11B1 and CYP11B2. Endocr. Res. 22, 4 55–461. 20. Graham-Lorence, S .E. & Peterson, J.A. (199 6) Structural align- ments of P450s and e xtrapolatio ns t o t he unknown. Methods Enzymol. 27 2, 315–325. 21. Ridderstro ¨ m, M., Masimirembwa, C., Trump-Kallmeyer, S., Ahlefelt, M., Otter, C. & Andersson, T.B. (2000) Arginines 97 and 108 in CYP2C9 are important determinants of the catalytic function. Bio chem. Biophys. R es. Commun. 270, 983–987. 22. Cover, C.M., Wang, J .M., St-Lezin, E., Kurtz, T.W. & Mellon, S.H. (1995) Molecular variants in the P450c11AS gene a s d eter- minants of aldosterone synthase activity in the Dahl rat model of hypertension. J. Biol. Chem. 270, 16555–16560. 23. Peterson, J.A. & Graham, S.E. ( 1998) A close family resemblance: the importance of structure in understanding cytochromes P450. Structure 6 , 1079–1085. 24. Graham-Lorence, S. & Peterson, J.A. (1996) P450: structural similar ities and functional differences. FASEB J. 10 , 206–214. 25. Kawamoto, T., Mitsuuchi. Y., Toda, K., Miyahara, K., Yokoyama, Y., Nakao, K., Hosoda, K., Y amamoto, Y., I mura, H. & Shizuta, Y. (1990) Cloning of cDNA and genomic DNA for human c ytochrome P-45011 beta. FEBS Lett. 269, 345–349. 26. Sambrook, J., Fritsch, E.F. & Maniatis, T. (1989) Molecular Cloning: a Laboratory M anual, 2nd ed n. Cold Spring Harbor Laboratory Press, C old Spring Harbor, New Yo rk . 27. Zuber, M .X., Mason, J.I., S impson, E.R. & Wa terman, M.R. (1988) Simultaneous tra nsfection of COS-1 c ells with mitochon- drial and microsomal steroid hydroxylases: incorporation of a steroidogenic pathway into nonsteroidogenic cells. Proc. Natl Acad. Sci. USA 85 , 699–703. 28. Laemmli, U.K. (1970) Cleavage of structural proteins during the assembly of the head o f bacteriophage T4. Nature 227, 680–685. 29. Thompson, J.D., Higgins, D.G. & Gibson, T.J. ( 1994) CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap pen- alties and weight matrix choice. Nucleic Acids Res. 22, 4673–4680. 30. Rost, B. & Sander, C . (1993) Prediction of protein s tructure at better than 70% ac curacy. J. M ol. Biol. 232, 5 84–599. 31. Berman, H.M., Westbrook, J., Feng, Z., Gilliland, G., Bhat, T.N., Weissig, H., Shindyalov, I.N. & Bourne, P.E. (2000) The protei n data bank. N uc leic Acids Re s. 28, 235–242. 32. Belkina, N.V., Lisurek, M., Ivanov, A.S. & B ernhardt, R. (2001) Modelling of 3D-structures of cytochromes P450 11B1 and 11B2. J. Inorg. Biochem. 87, 197–207. 33. Laskowski, R.A., M acArthu r, M .W ., Moss, D.S. & Thornton, J.M. (1993) PROCHECK: a program to check the stereochemical quality of p rotein structures. J. Appl. Cryst. 26, 283–291. 34. Sippl, M.J. (1993) Recognition of errors in three-dimensional structures of proteins. Proteins 17, 355–362. 35. Gotoh, O. (1992) Sub strate recognition sites in cytochrom e P450 family 2 (CYP2) proteins inferred from comparative analyses of amino a cid and co ding nucleotide sequences. J. Biol. C hem. 267, 83–90. 36. Bo ¨ ttner, B., D enner, K. & Bernhardt, R. (1998) Co nfer- ring aldosterone synthesis to human CYP11B 1 by replacing key amino acid residues with CYP11B2-specific ones. Eur. J. Bioc hem. 252, 458–466. 37. Cao, P R. & Bernhardt, R. (1999) Interaction of CYP11B1 (cytochrome P -450 11b ) with C YP11A1 (cy tochrome P -450 scc )in COS-1 c ells. Eur. J. Biochem. 262, 720–726. 38. Cao, P R. & Bernhardt, R. (1999) Modulation of aldosterone biosynthesis by adrenodoxin mutants with different electron transport efficiencies. Eur. J. Biochem. 265 , 152–159. 39. White, P.C., Curnow, K.M. & Pascoe, L . (1994) Disorders of steroid 11b-hydroxylase isozymes. Endocr. R ev. 15, 421–438. 40. Peter, M., Dubuis, J M. & Sippell, W.G. (1999) Disorde rs of the aldosterone synthase and steroid 11b-hydroxylase deficiencies. Horm. Res. 41 , 211–222. 41. White,P.C.,Dupont,J.,New,M.I.,Leiberman,E.,Hochberg,Z. & Rosler, A. (1991) A mutation in CYP11B1 (Arg448 fi His) associated with steroid 11b-hydroxylase deficiency in Jews of Moroccan or igin. J. Clin. Invest. 87, 1664–1667. 42. Geley;, S., Jo ¨ hrer, K., Peter, M., Denner, K., Bernhardt, R., Sippell, W.G. & Kofler, R. (1995) Amino acid substitution R384P in aldosterone synthase causes corticosterone methyloxidase type I deficiency. J. Clin. Endocrinol. M etab. 80, 424–429. 1126 S. Bechtel et al. (Eur. J. Biochem. 269) Ó FEBS 2002 43. Hasemann, C.A., Kurumbail, R.G., Boddupalli, S.S., Peterson, J.A. & Deisenhofer, J. (1995) Structure and function of cytochromes P450: a comparative analysis of three crystal struc- tures. St ructure 3, 41–62. 44. Fisher, A., Fraser, R., Mc-Connell, J. & Davies, E. (2000) Amino acid residue 147 of human aldosterone synthase and 11beta- hydroxylase plays a key role in 11beta-hydroxylation. J. Clin. Endocrinol. Metab. 85, 1 261–1266. 45. Nonaka, Y., Fujii, T., Kagawa, N., Waterman, M .R., Takemori, H. & Okamoto, M. (1998) Structure/function relationship of CYP11B1 associated with Dahl’s salt-resistant rats – expression of rat CYP11B1 and CYP11B2 in Escherichia c oli. Eur. J. Bioche m. 258, 8 69–878. 46. Nonaka, Y., Fujii, T., Bernhardt, R. & O kamoto, M. (1998) Amino acid r esidues in I- a nd K-helices of r at CYP11B1 and CYP11B2 a re important in expression o f 18-hydroxylation a ctiv- ity. Endocr. R es. 24, 6 15–618. 47. Graham, S.E. & Peterson, J.A. (1999) How similar are P450s and what c an t heir differences teach u s? Arch. Biochem. B iophys. 369 , 24–29. 48. Schwarz, D ., Chernogolov, A. & K isselev, P. (1999) Complex formation in vesicle-reconstituted mitoch ondrial cytochrome P450 systems ( CYP11A1 and C YP11B1) as evidenced by r otational diffusion experiments using EPR and ST-EPR. Biochemistry 38, 9456–9464. 49. Ikushiro, S., Kominami, S. & Takemori, S. ( 1992) Adrenal P-450scc modulates activity of P-45 011 beta in liposomal a nd mitochondrial m embranes. I mplication of P-450scc in zone specificity of aldosterone biosynthesis in bovine adrenal. J. Biol . Chem. 26 7, 1464–1469. 50. Portrat-Doyen, S., Tourniaire, J., Richard, O., Mulatero, P., Aupetit-Faisant, B., Curnow, K.M., Pascoe, L. & Morel, Y. (1998) Isolated aldosterone synth ase deficien cy caused by simul- taneous E198D and V386A mutations in the CYP11B2 gene. J. Cli n. Endocrinol. Metab. 83, 4156–4161. 51. Biagini, C.P., Philpot, R.M. & Celier, C.M. (1999) Nonsubstrate recognition site r esidues are involved in testosterone hydroxylation by cytochrome P450 CYP 2C11. Arch. Biochem. Biophys. 361, 309–314. 52. Koga, H., S agara, Y., Yaoi, T., T sujimura, M., Nakamura, K., Sekimizu,K.,Makino,R.,Shimada,H.,Ishimura,Y.&Yura,K., et al. (1993) Essential role of the Arg112 r esidue of cytochrome P450cam for electron transfer from reduced putidaredoxin. FEBS Lett. 33 1, 109–113. 53. Fardella, C.E., Rodriguez, H., Hum, D.W., Mellon, S.H. & Miller, W.L. (1995) Artificial mutations in P450c11AS (aldosterone sy nt hase) c a n in crease enzymatic activity: a model for low-renin hyperten sio n? J. Cl in. Endocrinol. Metab. 80, 1 040– 1043. Ó FEBS 2002 Effect of I112P, D147E, K152N on CYP11B2 activity (Eur. J. Biochem. 269) 1127 . The effect of amino-acid substitutions I112P, D147E and K152N in CYP11B2 on the catalytic activities of the enzyme Stephanie Bechtel 1 , Natalya Belkina 2 and. and determination of the side- chain conformations based on information about the backbone secondary structure and the s ide chains o f the corresponding