Reconstructing the replication complex of AcMNPV Kathleen L. Hefferon 1 and Lois K. Miller 2 1 Center for Virology, Department of Botany, University of Toronto, Ontario, Canada; 2 Department of Entomology, University of Georgia, Athens, GA, USA Baculoviruses are well known for their large, circular, dou- ble-stranded DNA genomes. The type member, AcMNPV, is the best characterized and undergoes a succession of early, late and very late gene expression during its infection cycle. The viral genes involved in DNA replication have previously been identified and their products are required for the acti- vation of late gene expression. In this study, we FLAG- and HA-tagged the replication late expression factors of AcMNPV, examined their expression and functional activities by CAT assay and Western blot analysis, and determined their subcellular localization in transfected cells by subcellular fractionation and immunofluorescent microscopy. We found that all replication LEFs with the exception of P143 and P35 resided in the nucleus of trans- fected cells. We further investigated the interactions among various replication LEFs using both yeast two-hybrid and coprecipitation strategies. A summary of the interactive properties of the replication LEFs is presented and a model for a putative AcMNPV replication complex is offered. Keywords: Autographica californica nucleopolyhedrosis virus; coprecipitation; DNA replication; late expression factor; yeast two-hybrid system. Autographa californica nucleopolyhedrosis virus, or AcMNPV, is the type member of the Baculoviridae, a family of double-stranded DNA viruses with large circular genomes. The successive and concomitant expression of an assortment of early, late and very late genes are instrumental for successful baculovirus infection, and require a switch from early dependence on a host cell-derived RNA poly- merase II to a novel virus-encoded RNA polymerase that is required for transcription later on in infection. A series of repetitive and highly conserved sequences known as homologous regions, or hrs, may function both as origins of DNA replication as well as transcriptional enhancers of late gene expression. An array of AcMNPV genes expressed early on during infection, known as late expression factors, or LEFs, are essential for both replication and late gene expression [1–4]. Eighteen LEFs had previously been shown to be neces- sary for late gene expression in Spodoptera frugiperda (Sf-21) cells; more recently, an additional factor, known as LEF-12, has been identified and was found to be essential for transcription [5–7]. Nine late expression factors are involved in viral replication. Of these, HEL and DNAPOL contain sequence motifs characteristic of helicases and DNA polymerases, respectively [8–10]. IE1 has been demonstrated to play a role in both the initiation of replication as well as transactivation of late gene expression [11,12]. In addition to playing a role in transactivation, IE2 is involved in cell cycle control [13]. P35, an inhibitor of apoptosis, circumvents the cell defence pathway to prevent programmed cell death [14]. LEFs 1, 2 and 3 have been suggested to carry out primase and single-stranded DNA binding protein (SSB) activities, respectively [15–17]. No role has yet been attributed to LEF-7, which like P35 and IE2 has also been demonstrated to be essential in AcMNPV replication in Sf-21 cells, but not Trichoplusia ni (Tn-368) cells [18,19]. Little is known about how the replication LEFs assemble into a replication complex during viral infection. To gain further insight into the nature of the baculovirus replication complex, the interactions between each of the replication LEFs were investigated more thoroughly. Constructs were generated which express amino-terminal HA- and FLAG-tagged versions of each LEF. The subcellular localization of each tagged LEF was deter- mined by immunofluorescence using anti-HA and anti- FLAG Igs. The relative strengths of interactions between replication LEFs were examined using the yeast two- hybrid system and the results were confirmed by copreci- pitation studies. A working model of AcMNPV replication complex assembly is presented. MATERIALS AND METHODS Cell culture and transfections Spodoptera frugiperda (fall armyworm) IPLB-SF-21 cells and Trichoplusia ni (cabbage looper) Tn-368 cells were maintained in TC-100 medium (Gibco-BRL Laboratories, Gaitherburg, MD, USA) supplemented with 10% (w/v) fetal bovine serum and 0.26% (w/v) tryptose broth. Transfections were carried out as described previously [20]. Correspondence to K. L. Hefferon, Cornell Research Foundation, Cornell University, 20 Thornwood Drive, Ithaca, NY 14850, USA. Fax: +1 607 257 1015, Tel.: +1 607 257 1081, E-mail: klh22@cornell.edu Abbreviations:AcMNPV,Autographa californica nucleopolyhedrosis virus; CAT, chloramphenicol acetyltransferase; hrs, homologous region; hsp70, heat shock protein 70; LEF, late expression factor; ONPG, o-nitrophenyl-b- D -galactopyranoside; SSB, single-stranded DNA binding protein. (Received 14 June 2002, revised 26 September 2002, accepted 1 November 2002) Eur. J. Biochem. 269, 6233–6240 (2002) Ó FEBS 2002 doi:10.1046/j.1432-1033.2002.03342.x Expression plasmid construction To construct the epi-tagged expression plasmids, primers encompassing open reading frames of lef-1, lef-2, lef-3, lef-7, P35, ie-1, ie-2, DNApol and P143 were HA-tagged at the amino terminus by insertion of PCR products into the BglII and PspAI sites of plasmid phsp70HAHisVI+ containing the 5¢ terminal amino acid sequence RYPYDVPDYARA. The sequence YPYDVPDYA constitutes the haemaggluti- nin epitope (HA.11) [7].From these DNA manipulations, the plasmids phsp70HAHISLEF-1VI+, phsp70HAHISLEF- 2VI+, phsp70HAHISLEF-3VI+, phsp70HAHISLEF- 7VI+, phsp70HAHISP35VI+, phsp70HAHISHELVI+, phsp70HAHISDNApolVI+, phsp70HAHISIE1VI+ and phsp70HAHISIE2VI+ were constructed using primers listed in Table 1. In these constructs, hsp70 refers to the Drosophila melanogaster heat shock protein 70 (hsp70) promoter, HA refers to the HA.11 epitope and HIS refers to the His 6 tag that is fused to the N-terminus of the lef open reading frame inserted into the vector. VI+ refers to sequences containing the AcMNPV polyhedrin open reading frame, located within the vector. FLAG-tagged expression plasmid counterparts were constructed with the same primers by insertion of PCR products into phsp70FLAGHISVI+ containing the 5¢ terminal sequence RDYKDDDDKLENSRA. The sequence DYKDDDDK constitutes the FLAG epitope. Reporter plasmid pCAPCAT contains the CAT (chloramphenicol acetyltransferase) gene under the transcriptional control of the late vp39 promoter as well as a 473 nucleotide MluI fragment containing a portion of the origin of replication hr5. Two-hybrid yeast constructs were generated by PCR of each lef and insertion into the EcoRI and XhoI sites of plasmids PJB4-5 and PEG202, respectively, using primers listed in Table 1. The sequence of all plasmids constructed using PCR products were confirmed by direct nucleotide sequencing. Transfections and CAT assays Sf-21 and Tn-368 cells were transfected using lipofectin reagent (Gibco BRL). 1 · 10 6 cells were transfected with 2 lg of the reporter plasmid pCAPCAT, and either 0.5 lg of each of the clones of the overlapping AcMNPV k library or 1.0 lg of each plasmid of the overlapping lef library as described by Passarelli and Miller (1993; [15]), unless otherwise noted. Transfected cells were incubated at 28 °C Table 1. Primers used for the creation of replication LEF constructs. Primer HA/FLAG constructs Two-hybrid yeast constructs LEF-1 5¢ CATCACGATCTATGTTAGT GGCCCGGGAATTCATGTTAG GTGCAATTATAC TGTGCAATTATAC LEF-1 3¢ CCGCCCGGGTTATGTGGTAC GGCCCGGGAGCTCTTATGTG TTTTTG GTACTTTTTG LEF-2 5¢ CATCACAGATCTATGGCGA GGCCCGGGAGCTCTATGGC ATGCATCG GAATGCATCG LEF-2 3¢ CCGCCCGGGAATTACAAAT GGCCCGGGCTCGAGTTACAA AGGATTG ATAGGATTG LEF-3 5¢ CATCACAGATCTATGGCGAC GGCCCGGGAATTCATGGCG CAAAAGATC ACCAAAAGATC LEF-3 3¢ CCGCCCGGGTTACAAAAATT GGCCCGGGCTCGAGAATTTA TATATTC TATTC LEF-7 5¢ CATCACAGATCTATGTCGAG GGCCCGGGCTCGAGATGTC CGTTACAAAGCG GAGCGTTACAAAGCG LEF-7 3¢ CCGCCCGGGTTATTCTTTCA GGCCCGGGCTCGAGTTCTTT CAATTCTG CACAATTCTG HEL 5¢ CATCACAGATCTATGATTGA GGCCCGGGGAATTCATGATT CAACATTTTAC GACAACATTTTA HEL 3¢ CCGCCCGGGTTAACATACA GGCCCGGGCTCGAGCATAC AAATTTGGTACAC AAAATTTGGTACAC DNApol 5¢ CATCACAGATCTATGAAAAT GGCCCGGGGAATTCATGAA ATATCC AATATATCC DNApol 3¢ CCGCCCGGGTTATTTTTTCA GGCCCGGGCTCGAGTTTTTT TTTTATAC CATTTTATAC IE1 5¢ CTATGACGCAAATTAATTTT GGCCCGGGAATTCACGCAAA AACGC TTAATTTTAACGC IE1 3¢ CCGCCCGGGTTATCGCCAAC GGCCCGGGCTCGAGTCGCC TCCCATTGTTAAT AACTCCCATTGTTAAT IE2 5¢ CATCACAGATCTATGAGTCG GGCCCGGGAATTCAGTCGC CCAAATCAAC CAAATCAAC IE2 3¢ CCGCCCGGGTTAACGTCTAG GGCCCGGGCTCGAGACGTC ACATAACAG TAGACATAACAG P35 5¢ CATCACAGATCTATGTGTGT GGCCCGGGCTCGAGATGTGT AATTTTTCCGG GTAATTTTTCCGG P35 3¢ CCGCCCGGGTTATTTAATTG GGCCCGGGCTCGAGTTTAAT TGTTTAATATTAC TGTGTTTAATATTAC 6234 K. L. Hefferon and L. K. Miller (Eur. J. Biochem. 269) Ó FEBS 2002 for 48 h, washed in TC-100 medium without fetal bovine serum, pelleted by low-speed centrifugation and resuspended in 1500 lL of TC-100 without serum. One twentieth of the cell suspension was removed for the preparation of cell lysates for CAT assays. The final volume of cell lysate prepared from these cells was 25 lL. CAT activity was determined using 3 lL of each lysate [21]. Subcellular localization and immunofluorescence studies To determine LEF solubility, crude extracts of Sf-21 cells transfected with plasmids encoding the FLAG-tagged lef sequences were boiled for 5 min in buffer A [10 m M Tris, pH6.5,140m M NaCl, 3 m M MgCl 2 , 0.5% (v/v) NP-40], placed for 10 min on ice, subjected to centrifugation at 12 000 g for 5 min, and the supernatant containing the cytosolic fraction was collected. Sodium hydroxide was added to the supernatant for a final concentration of 0.1 M . The nuclear pellet was resuspended in 50 m M Tris, pH 8.0, 100 m M NaCl, 3 m M MgCl 2 and 1% (v/v) NP-40. To shear chromosomal DNA, the extract was forced through a 25-ga needle 20 times, pelleted by centrifugation at 12 000 g for 2 min, and the supernatant taken as the nuclear fraction. Both cytosolic and nuclear fractions were boiled in sample buffer for 3 min and subjected to Western blot analysis using anti-FLAG mAb (Berkeley Antibody Co.) followed by rabbit anti-mouse IgG conjugated to horseradish peroxidase (Amersham). For immunofluorescence, Sf-21 cells (1 · 10 6 )were seeded onto coverslips, placed in 35 mm plates, transfected and incubated for 1 h at 28 °C. Cells were heat-shocked by placing them at 42 °C for 30 min, then returned to 28 °C. At 2.5 h post-heatshock, cells were washed in NaCl/P i , pH 6.2. Cells were fixed in ice-cold methanol for 30 min on ice, followed by three washes in NaCl/P i , pH 7.2. Cells were permeabilized in NaCl/P i /Triton X-100 (pH 7.2) for 10 min, followed by three washes in NaCl/P i .Plateswere incubated in 1 mL blocking buffer [5% (w/v) skim milk powder, 1· NaCl/P i /TritonX-100,pH7.6]for1h.To detect FLAG-tagged constructs, blocking buffer was removed and coverslips were incubated face down in 200 lL of a 1 : 300 dilution of mouse M2 anti-FLAG mAb (Berkeley Antibody Co.) in blocking buffer for 1 h. Coverslips were washed four times in NaCl/P i /Triton X-100, pH 7.6 and incubated face down in 200 lLofa 1 : 60 dilution of lissamine rhodamine-conjugated anti- mouse IgG and IgM (Jackson ImmunoResearch Laborat- ories) in blocking buffer for 1 h. For HA-tagged constructs, the above protocol was used except that mouse anti-HA.11 polyclonal sera (Berkeley Antibody Co.) at a 1 : 500 dilution were used as the primary antibody. Coverslips were washed four times in NaCl/P i /Triton X-100, pH 7.6 and placed face down on slides containing glycerol. Immunofluorescent images were visualized with a Bio- Rad MRC 600 confocal microscope adapted to a Nikon Optiphat microscope, with a 40· Fluor. N.A. 1.30 oil immersion objective lens and the appropriate filter sets. Coprecipitation and immunoblotting Transfected cells were harvested at 4 h post-heatshock and pelleted at 500 g. Cells were lysed in 50 lLNP-40lysis buffer [50 m M Tris-Cl, pH 8.0, 150 m M NaCl, 1.0% (v/v) Nonidet P-40, 1 m M dithiothreitol, 1 m M phenyl- methylsulfonyl fluoride] at 4 °C for 30 min with agitation. The lysate was centrifuged at 12 000 g for 2 min, and 10 lL supernatant were reserved for immunoblot analysis of the total lysate. Five lL of anti-Flag M2 affinity resin (Eastman Kodak Company) were incubated with the remainder of the supernatant for 6 h at 4 °C with agitation. The resin was washed five times in 500 lL of NP-40 lysis buffer; each time the resin was pelleted by centrifugation at 12 000 g for 30 s and the supernatant was removed. After the last wash, the resinwasagitatedfor15minatroomtemperaturein25lL of a solution containing 0.5 M Tris/HCl, pH 6.8, 10% (w/v) SDS, 10% (v/v) glycerol and 0.001% (w/v) bromophenol blue. The resin was pelleted, and 2-mercaptoethanol was added to the supernatant to a final concentration of 1.43 M . For immunoblot analysis, 5 lL of total cell lysate or 40 lL coprecipitation supernatant were heated at 95 °Cfor5min, separated on SDS-15% (w/v) polyacrylamide gels and transferred onto Immobilon P membranes (Millipore). HA-tagged constructs were detected with a 1 : 10 000 dilu- tion of rabbit anti-HA.11 polyclonal sera (Berkeley Anti- body Co) followed by a goat anti-rabbit IgG–horse radish peroxidase conjugate (Promega). FLAG-tagged constructs were detected with a 1 : 5000 dilution of anti-FLAG M2 mAb (Berkeley Antibody Co.) followed by anti-mouse IgG conjugated to horseradish peroxidase (Amersham). Immu- noblots were visualized with the Enhanced Chemilumines- cence (ECL) Western blotting system (Amersham). Yeast two-hybrid cloning The yeast strain YRG-2 (Stratagene) was used in all the two- hybrid procedures and screening was conducted according to the manufacturer’s procedures. Colonies which grew on His – plates were screened further for b-galactosidase activity. b-Galactosidase assays b-Galactosidase assays were performed as follows: trans- formed yeast colonies were grown in 2 mL yeast peptone dextrose medium overnight at 30 °C with shaking. Cultures were pelleted and resuspended in 100 lL Z buffer (0.06 M NaHPO 4 ,0.04 M NaH 2 PO 4 ÆH 2 O, 0.01 M KCl, 0.001 M MgSO 4 Æ7H 2 O, 2-mercaptoethanol) and the extract was spun down for 5 min at 10 000 g.FiftylL supernatant was addedto950lL Z buffer, 200 lL 4 mg mL )1 ONPG (o-nitrophenyl-b- D -galactopyranoside) and 0.1 M NaPO 4 , pH 7.0, and incubated at 30 °C for 1 h. Four hundred lL of 0.1 M NaCO 3 were added to stop the reaction. The specific activity of the extract was calculated by using the following formula: [D 420 · 1.6]/[0.0045 · protein (mgÆmL )1 ) · extract volume (mL) · time (min)]. Specific activity is expressed as nmoles per minute per milligram of protein [22]. RESULTS Expression and characterization of HA- and FLAG-tagged lef s To investigate the interactions among different late expres- sion factors required for DNA replication, we PCR Ó FEBS 2002 Reconstructing the AcMNPV replication complex (Eur. J. Biochem. 269) 6235 amplified and subcloned each lef into the constructs phsp70HAHisVI+ and phsp70FLAGHisVI+ to generate N-terminally HA- and FLAG-tagged versions of each. Constructs were transfected into Sf-21 cells and the expression level of each lef was examined by Western blot analysis (Fig. 1A). After heat shock, all HA and FLAG- tagged lef constructs could be detected by Western blot analysis using either anti-FLAG (Fig. 1A) or anti-HA.11 sera (data not shown). All lefs were readily expressed and corresponding protein bands were found to be at their predicted molecular masses (LEF-1; 30.8 kDa, LEF-2; 23.9 kDa, LEF-3; 44.5 kDa, LEF-7; 26.6 kDa, HEL; 143.2 kDa, DNApol; 114.3 kDa, P35; 34.8 kDa, IE1; 66.9 kDa and IE2; 47.0 kDa). HA and FLAG-tagged CAT were included as controls; expression levels of CAT were similar to levels observed for other lefs (Fig. 2B, lane 9). The relative levels of expression of the different lefswere quite variable; the greatest expression was observed for LEF-3, and the least expression was observed for DNApol. The variability in expression level of each lef remained consistent when the experiment was repeated, indicating that these differences in expression are not the result of variations in the amount of total protein loaded on the gel or blotted onto membranes. A CAT assay was performed to determine whether the HA- and FLAG-tagged lefs could substitute in late gene expression for its counterpart in the lef library. Sf-21 cells were transfected with the plasmid pCAPCAT alone (Fig. 1B, lane 1), or in combination with the original k library or lef plasmid library as described in Passarelli and Miller [15]. In a series of separate experiments, the plasmid containing each replication lef ORF was removed from the lef library one at a time, then replaced with its HA- or FLAG-tagged counterpart. Relative levels of late gene expression, determined by CAT activity, were compared with those of the original lef library as described in detail in Rapp et al. 1998 [7]. A representative example is shown in Fig. 1B, lanes 4 and 5. Removal of pSDEM2, containing the LEF-3 open reading frame from the original plasmid library significantly reduced CAT activity (Fig. 1B, lane 4). Addition of phsp70FLAGHISLEF-3VI+ to the lef library minus pSDEM2 restored late gene expression (Fig. 1B, lane 5). Since optimal CAT activity requires the presence of each tagged lef and removal of any of these tagged lefs resulted in a severe reduction in late gene expression, it was concluded that all other tagged replication lefswere Fig. 1. Western blot analysis of FLAG-tagged LEFs. (A) Equal proportion of cell lysates representing equal numbers of cells were loaded onto each lane. Lane 1: FLAG-tagged IE1; lane 2: nontransfected cells; lane 3: FLAG-tagged LEF-2; lane 4: FLAG-tagged HEL; lane 5: FLAG-tagged IE2; lane 6: FLAG-tagged LEF-1; lane 7: FLAG-tagged LEF-7; lane 8: FLAG-tagged P35; lane 9: FLAG-tagged CAT; lane 10: FLAG-tagged LEF-3; lane 11: FLAG-tagged DNApol. (B) CAT assay of FLAG-tagged lefs. Results shown for one FLAG-tagged lef only.Lane1:pCAPCAT alone; lane 2: pCAPCAT + k library;lane3:pCAPCAT+lef library;lane4:pCAPCAT+lef library minus Psdem2 (containing lef-3); lane 5: pCAPCAT + lef library with FLAG-tagged lef-3 replacing pSDEM2. Fig. 2. Immunofluorescence of FLAG-tagged LEFs. Sf-21 cells trans- fected with each FLAG-tagged LEF. (A,C,E,G): UV light; (B,D,F,H): visible light. (A,B): FLAG-tagged LEF-2; (C,D): FLAG-tagged LEF-7; (E,F): FLAG-tagged LEF-1; (G,H): FLAG-tagged DNApol. 6236 K. L. Hefferon and L. K. Miller (Eur. J. Biochem. 269) Ó FEBS 2002 functional (data not shown). Little difference in late gene expression was observed between the tagged lefsandlefs expressed from their native promoters, as demonstrated by the CAT assay (Fig. 1B, compare lanes 3 and 5). The solubility and subcellular localization of each FLAG-tagged lef was examined. In this case, FLAG-tag signal was detected in all soluble fractions with the exception of the sample expressing FLAG-tagged IE2, where signal was detected in the insoluble fraction only. Subcellular localization of HA- and FLAG-tagged LEFs were determined by immunofluorescence using anti-HA or anti- FLAG sera as the primary antibody, and a rhodamine– conjugated anti-mouse sera as the secondary antibody. The results are summarized in Fig. 2. Using this technique, FLAG-tagged LEF-1, LEF-2, LEF-7 and DNAPOL were determined to reside in the nuclei of transfected cells (Fig. 2A–H). The subcellular localizations of HEL, LEF-3, IE1, IE2 and P35 have been determined in other reports [23–26]. Similar results were observed when HA-tagged versions of each lef were transfected into cells and examined by immunofluorescence (data not shown). Interactions between replication LEFs determined from the yeast two-hybrid system To gain insight into the nature of the AcMNPV DNA replication complex, we examined the ability of each tagged lef to interact with other replication lefs. This was accom- plished by employing both yeast two-hybrid and coprecipi- tation techniques. In the case of the yeast two-hybrid system, each lef was cloned into bait and prey plasmids, cotransformed into yeast YRG-2 cells, and observed for growth on His – plates. Colonies that were robust in growth when restreaked onto fresh selection plates were then tested for b-galactosidase activity. Each construct was also trans- formed separately and examined for its ability to produce false positive results (data not shown). A summary of the results are presented in Table 2. P35 and IE2 were not included in this study. By substituting each lef as both bait and prey plasmids, it was possible to confirm each interaction. Besides interacting with itself, LEF-3 was also observed to interact with several other LEFs. LEF-3–LEF-3 interactions were in fact the strongest (30.5), as determined by b-galactosidase activity (Table 2), while LEF-3 interac- ted to a lesser degree with HEL (LEF-3 as bait and HEL as prey gave a value of 22.1; HEL as bait and LEF-3 as prey gave a value of 24.3). The weakest interaction was found to be between LEF-3 and IE1 (LEF-3 as bait, IE1 as prey: 1.5; IE1 as bait, LEF-3 as prey: 2.7). LEF-1 was found to interact with LEF-2 (LEF-1 as bait, LEF-2 as prey: 17.4; LEF-2 as bait, LEF-1 as prey: 18.2). IE1 displayed a strong interaction with itself (27.3). LEF-7 was not observed to interact with itself or any other LEF. No interactions were observed between HEL and DNApol. Interactions between LEFs determined from coprecipitation studies Interactions between LEFs were further examined using coprecipitation studies (Fig. 3). Various HA-tagged lef constructs were cotransfected along with FLAG-tagged constructs, coprecipitated with anti-FLAG M2 affinity resin and subjected to Western blot analysis using anti-HA.11 Table 2. Examination of LEF interactions using the two-hybrid yeast system. LEFs listed on the horizontal axis represent bait while those on the vertical axis represent prey. Lac Z expression was calculated as the mean value from three liquid assays (± SD) and is expressed as nmolÆ min )1 Æmg )1 [22]. All experiments were supported by coprecipitation experiments with the exception of those in square brackets. LEF-1 LEF-2 LEF-3 LEF-7 IE1 DNApol HEL LEF-1 < 1 18.2 ± 1 < 1 < 1 < 1 < 1 [< 1] LEF-2 7.4 ± 1.4 < 1 < 1 < 1 < 1 < 1 < 1 LEF-3 < 1 < 1 30.5 ± 4 < 1 [2.7 ± 0.9] 6.9 ± 0.7 24.3 ± 6 LEF-7 < 1 < 1 < 1 < 1 < 1 < 1 < 1 IE1 < 1 < 1 1.5 ± 0.6* < 1 27.3 ± 6 < 1 < 1 DNApol < 1 < 1 9.8 ± 2 < 1 < 1 < 1 < 1 HEL [< 1] < 1 22.1 ± 4 < 1 < 1 < 1 < 1 Fig. 3. Coprecipitation of FLAG and HA-tagged LEFs. FLAG-tagged HEL was cotransfected into Sf-21 cells with each of the HA-tagged lef plasmids. Cells were lysed and FLAG-tagged HEL and any interacting HA-tagged LEFs were then coprecipitated with anti-FLAG M2 affinity resin. Coprecipitation products were immunoblotted and probed with rabbit anti-HA.11 polyclonal sera. Lanes contain FLAG- tagged HEL and the following: lane 1: HA-tagged CAT; lane 2: HA-tagged HEL; lane 3: HA-tagged DNApol; lane 4: HA-tagged IE1; lane 5: HA-tagged LEF-2; lane 6: HA-tagged LEF-7; lane 7: HA-tagged LEF-3; lane 8: HA-tagged LEF-1. Ó FEBS 2002 Reconstructing the AcMNPV replication complex (Eur. J. Biochem. 269) 6237 polyclonal sera. The clone pSDEM2, containing lef-3 under the control of its native promoter, was added to all transfections of tagged –HEL to ensure that HEL was transported to the nucleus and had the opportunity to interact with other replication LEFs [27]. HA-tagged CAT was included in the coprecipitation experiments as a negative control. All FLAG and HA-tagged constructs could be detected from each sample prior to coprecipitation by Western blot analysis. Sample coprecipitation results for HA-tagged LEFs and FLAG-tagged HEL are presented in Fig. 3. LEF-3 and LEF-1 were found to each coprecipitate with HEL (Fig. 3 lanes 7 and 8). No other HA-tagged LEFs nor CAT appeared to interact with HEL (Fig. 3 lanes 1–6). It is not surprising that no interaction between LEF-1 and HEL was found using the yeast two-hybrid system because HEL is restricted to the cytoplasm in the absence of LEF-3 and unavailable to interact with nuclear proteins [23]. No interaction between LEF-1 and HEL with the yeast two- hybrid system had also been observed by Evans et al. (1999) [28]. Results from other coprecipitation studies supported the yeast two-hybrid results with the exception of the weak interaction observed between LEF-3 and IE1 with the yeast two-hybrid system (Table 2). This interaction was not detected in the coprecipitation experiments. Interactions between multiple LEFs: reconstruction of the DNA replication complex To further elucidate the interactions between multiple replication LEFs, we cotransfected FLAG-tagged HEL or DNApol with all of the HA-tagged constructs simulta- neously into AcMNPV-infected Sf-21 cells and examined the coprecipitation products by Western blot analysis using the anti-HA.11 polyclonal sera (Fig. 4). Bands correspond- ing in size to LEF-1, LEF-2, LEF-3 and LEF-7 were observed from samples taken from cells cotransfected with FLAG-tagged HEL and all HA-tagged replication LEFs (Fig. 4, lanes 1, 2). No HA-tagged LEFs appeared to interact with FLAG-tagged DNApol (Fig. 4, lanes 3, 4). Sf-21 cells were also cotransfected with phsp70FLAGHIS LEF-3VI+ and either phsp70HAHISLEF-3VI+ or phsp70HAHISCATVI+ (Fig. 4, lanes 5,6). The detection of HA-tagged LEF-3, but not HA-tagged CAT confirmed results predicted of the controls. DISCUSSION In this report, a transient LEF assay was generated by substituting regular replication LEFs with their HA- or FLAG-tagged counterparts, each under the control of the Drosophila heat shock 70 promoter. Replacing native replication LEFs in this assay with tagged versions did not adversely affect the efficiency of late gene expression. A close examination of relative CAT activities revealed no significant difference in late gene expression when either HA- or FLAG-tagged versions of the replication LEFs were substituted with the original replication LEF plasmids [7]. Western blot analysis revealed a large variability in the expression levels of tagged LEF gene products. The solubility and subcellular localization of each repli- cation LEF was determined. IE2 was found to be an insoluble protein. Previous studies by Pridhod’ko et al. (1999), suggested that IE2 is bound to the nuclear envelope [22]. All replication LEFs were localized to the nucleus, except for P35 and HEL. P35 has previously been demon- strated to reside in the cytoplasm where it regulates the process of programmed cell death [13]. HEL is restricted to the cytoplasm and requires interaction with LEF-3 to escort it into the nucleus [23,28]. Possible interactions among different replication LEFs were examined by utilizing the yeast two-hybrid system. Using HA- and FLAG-tagged versions of each replication LEF, we were able to further confirm these interactions with coprecipitation experiments. Our studies indicated that LEF-1 was able to interact with LEF-2. Interaction between LEF-1 and LEF-2 was previously demonstrated by Evans and Rohrmann, using both yeast two-hybrid and GST-fusion affinity experiments [29]. The authors showed that DNA replication could no longer be supported when the interaction domain of LEF-1 was destroyed, indicating that interaction between LEF-1 and LEF-2 is critical for AcMNPV infection to proceed. Coprecipitation experi- ments revealed that LEF-1 also interacted with HEL. LEF-3–LEF-3 interactions were demonstrated to be the strongest. Previous studies by Evans and Rohrmann have shown that LEF-3 forms a homotrimer in solution [30]. In addition, the yeast two-hybrid and coprecipitation studies demonstrated that LEF-3 interacts with both DNApol and HEL. The ability of LEF-3 to bind nonspecifically to single-stranded DNA and enhance strand displacement during DNA replication has suggested that LEF-3 is a Fig. 4. Interactions between multiple replication LEFs by coprecipita- tion. FLAG-tagged HEL (lanes 1 and 2) or DNApol (lanes 3 and 4) were cotransfected into AcMNPV-infected cells with all HA-tagged replication LEFs simultaneously. Lanes 1 and 3; 12 h post infection; lanes 2 and 4; 24 h post infection; lane 5: FLAG-tagged LEF-3 and HA-tagged LEF-3; lane 6: FLAG-tagged LEF-3 and HA-tagged CAT. 6238 K. L. Hefferon and L. K. Miller (Eur. J. Biochem. 269) Ó FEBS 2002 single-stranded DNA binding protein [28]. Wu and Carstens demonstrated that LEF-3 escorts HEL into the nucleus of infected cells during virus infection, and proposed that LEF-3 may assist in targeting HEL to the partially melted origin of DNA replication [23]. The ability of LEF-3 to stimulate DNApol function, demonstrated by McDougal and Guarino (1999; [31,32]) supports the observations presented in this paper that these proteins can interact with each other. The interactions between IE1 with itself using the yeast two-hybrid system were also confirmed by coprecipitation studies. Indeed, IE1 has been shown in the past to oligomerize as a dimer and bind to a palindrome sequence within the homologous region that serves as the origin of replication [24]. Although the coprecipitation experiments failed to demonstrate an interaction between IE1 and LEF-3, this interaction would support the contention that IE1 targets the replication machinery to the origin of DNA replication. Such an arrangement in the formation of the preinitiation replication complex has been suggested in a model describing herpes simplex virus-1 (HSV-1) [33]. IE2, LEF-7 and P35 are stimulatory, but not essential, during AcMNPV replication in Sf-21 cells and not required at all in Tn-368 cells [6]. IE2 and P35 were not examined any further because these factors appeared unlikely to have a direct interaction with other replication LEFs. Although LEF-7 resides in the nucleus, no interaction was observed between it and any of the other replication LEFs in either Sf-21 cells or Tn-368 cells (data not shown). The fact that LEF-7 coprecipitated with HEL in the context of a virus infection suggests that additional, virus-derived or virus- induced host factors may be required for this interaction and that LEF-7 may be a component of a complex containing HEL. Besides containing a sequence motif corresponding to a metal coordination site, LEF-7 possesses a small degree of sequence homology to the UL29 gene of HSV-1, encoding a single-stranded DNA binding protein [19]. It is possible that LEF-7 may act as an additional single-stranded DNA binding protein, perhaps by assisting in the melting or stabilization of recently unwound ssDNA. Neither HEL nor DNApol were demonstrated to dimer- ize or interact with each other when transfected alone or in the context of a virus infection, suggesting that these two large proteins assemble into two distinct complexes which are separate, yet essential during AcMNPV replication. Such a ÔsetupÕ has been proposed for HSV-1; in this case, a helicase–primase complex binds to the origin of DNA replication and initiates unwinding while DNA synthesis takes place from a separate DNA polymerase complex [34–36]. Based on the results of the current study, a similar model can be proposed for AcMNPV and is depicted in Fig. 5. While this model incorporates what is known of lef interactions from this and other reports, it does not take into account the role these interactions may play in other aspects of virus replication or even in enhancer function. AcMNPV replication has been compared in the past to HSV-1, which also possesses a large double-stranded DNA genome as well as multiple homologous regions composed of palindrome sequences and flanked by inverted repeats. Like AcMNPV, HSV-1 requires the coordination of early, late and very late gene expression [36]. Although HSV-1 and AcMNPVmayresembleeachotherinarudimentarysense, a number of modifications can be found between the two systems. UL9, the HSV-1 analogue of IE1, possesses both NTPase and helicase activities which are stimulated by DNA. ICP8, the single-stranded DNA binding protein of HSV-1, has been shown to engage in multiple protein– protein interactions and assist in the assembly of compo- nents of the DNA replication complex into prereplicative sites. This may in fact turn out to be a similar role for LEF-3, which has been demonstrated in this paper to be involved in multiple interactions with other replication lefs. Again, similar to lef-3, ICP8 has also been shown to stimulate DNA synthesis activity through the formation of a DNA helicase–primase complex [35,36]. The focus of this paper was to further elucidate the roles of replication LEFs and the nature of the AcMNPV replication complex by studying their interaction properties. The work presented here, in combination with contributions by other groups regarding LEF function and interaction, can be regarded as a step towards the clarification of the AcMNPV replication process in general. ACKNOWLEDGEMENTS The author wishes to acknowledge the late Dr L.K. Miller, in whose lab the above work was accomplished. The author also wishes to thank E. Pridhod’ko, J. Rapp and S. Yang for their helpful discussions in the putting together of this manuscript. This work was funded by the National Institute of Health. REFERENCES 1. Leisy, D.J. & Rohrmann, G.F. (1993) Characterization of the replication of plasmids containing hr sequences in baculovirus- infected Spodoptera frugiperda cells. Virology 196, 722–730. 2. Kool, M., Ahrens, C.H., Goldbach, R.W., Rohrmann, G.F. & Vlak, J.M. (1994) Identification of genes involved in DNA replication of the Autographa californica baculovirus. Proc. Natl Acad.Sci.USA91, 11212–11216. 3. Kool, M., Ahrens, C.H., Vlak, J.M. & Rohrmann, G.F. (1995) Replication of baculovirus DNA. J. General Virol. 76, 2103–2118. 4. Friesen, P.D. (1997) Regulation of baculovirus early gene expression. In The baculoviruses (Fraenkel-Conrat, H. & Wagner, R.R., eds), pp. 141–166. Plenum Press, New York, USA. Fig. 5. Model of the AcMNPV replication complex. Long arrows point in the direction of DNA synthesis. The model is based on the accu- mulation of LEF interaction data presented in this and other publi- cations, and on the proposed model of HSV-1 replication [34]. Ó FEBS 2002 Reconstructing the AcMNPV replication complex (Eur. J. Biochem. 269) 6239 5. Todd, J.W., Passarelli, A.L. & Miller, L.K. (1995) Eighteen baculovirus genes, including lef-11, 35, 39K and p47, support late gene expression. J. Virol. 69, 968–974. 6. Lu, A. & Miller, L.K. (1995) The roles of eighteen baculovirus late expression factor genes in transcription and DNA replication. J. Virol. 69, 975–982. 7. Rapp, J.C., Wilson, J.A. & Miller, L.K. (1998) Nineteen baculo- virus open reading frames, including LEF-12, support late gene expression. J. Virol. 72, 10197–10206. 8. Lu, A. & Carstens, E.B. (1991) Nucleotide sequence of a gene essential for viral DNA replication in the baculovirus Autographa californica nuclear polyhedrosis virus. Virology 181, 336–347. 9. Passarelli, A.L. & Miller, L.K. (1994) A baculovirus gene involved in late gene expression predicts a large polypeptide with a con- servedmotifofRNApolymerases.J. Virol. 68, 4673–4678. 10. Guarino,L.A.,Xu,B.,Jin,J.&Dong,W.(1998)Avirus-encoded RNA polymerase purified from baculovirus-infected cells. J. Virol. 72, 7985–7991. 11. Ahrens, C.H. & Rohrmann, G.F. (1995) Replication of Orgyia pseudotsugata baculovirus DNA: lef-2 and ie-1 are essential and ie-2, 34 and Op-iap are stimulatory genes. Virology 212, 650–662. 12. Guarino, L.A. & Dong, W. (1991) Expression of an enhancer- binding protein in insect cells transfected with the Autographa californica nuclear polyhedrosis virus IE1 gene. J. Virol. 65, 3676– 3680. 13. Prikhod’ko, E.A. & Miller, L.K. (1998) Role of baculovirus IE2 and its RING finger in cell cycle arrest. J. Virol. 72, 684–692. 14. Clem, R.J. & Miller, L.K. (1994) Control of programmed cell death by the baculovirus genes p35 and iap. Mol. Cell. Biol. 14, 5212–5222. 15. Passarelli, A.L. & Miller, L.K. (1993) Identification and char- acterization of lef-1, abaculovirus gene involved in late and very late gene expression. J. Virol. 67, 3481–3488. 16. Sriram, S. & Gopinathan, K.P. (1998) The potential role of a late gene expression factor, Lef2, from Bombyx mori nuclear poly- hedrosis virus in very late gene transcription and DNA replication. Virology 251, 108–122. 17. Hang, X., Dong, W. & Guarino, L.A. (1995) The lef-3 gene of Autographa californica nuclear polyhedrosis virus encodes a single- stranded DNA-binding protein. J. Virol. 69, 3924–3928. 18. Chen, C. & Thiem, S.M. (1997) Differential infectivity of two Autographa californica nucleopolyhedrovirus mutants on three permissive cell lines is the result of lef-7 deletion. Virology 227, 88–95. 19. Morris, T.D., Todd, J.W., Fisher, B. & Miller, L.K. (1994) Iden- tification of lef-7: a baculovirus gene affecting late gene expression. Virology 200, 360–369. 20. O’Reilly, D.R., Miller, L.K. & Luckow, V.A. (1992) Baculovirus expression vectors: a laboratory manual. J. Virol. 70, 5123–5130. 21. Gorman, C.M., Moffat, L.F. & Howards, B.H. (1982) Recombinant genomes which express chloramphenicol acetyl- transferase in mammalian cells. Mol. Cell. Biol. 2, 1044–1051. 22. Himmelfarb, H.J., Pearlberg, J., Last, D.H. & Ptashne, M. (1990) GAL11P: a yeast mutation that potentiates the effect of weak GAL4-derived activators. Cell 63, 1299–1309. 23. Wu, Y. & Carstens, E.B. (1998) A baculovirus single-stranded DNA binding protein, LEF-3, mediates the nuclear localization of the putative helicase P143. Virology 247, 32–40. 24. Rodems, S.M. & Friesen, P.D. (1995) Transcriptional enhancer activity of hr5 requires dual-palindrome half sites that mediate binding of a dimeric form of the baculovirus transregulator IE1. J. Virol. 69, 5368–5375. 25. Krappa, R., Carati, R.R. & Knebel-Morsdorf, D. (1995) Expression of PE-38 and IE-2, viral members of the C3HC4 finger family, during baculovirus infection. PE-38 and IE2 localize to distinct nuclear regions. J. Virol. 69, 5287–5293. 26. Harvey, A.J., Bidwai, A.P. & Miller, L.K. (1997) Doom, a product of the Drosophila mod (dg4) gene, induces apoptosis and binds to baculovirus inhibitor-of-apoptosis proteins. Mol. Cell. Biol. 17 (5), 2835–2843. 27. Todd, J.W., Passarelli, A.L., Lu, A. & Miller, L.K. (1996) Factors regulating baculovirus late and very late gene expression in tran- sient-expression assays. J. Virol. 70, 2307–2317. 28.Evans,J.T.,Rosenblatt,G.S.,Leisy,D.J.&Rohrmann,G.F. (1999) Characterization of the interaction between the baculovirus ssDNA-binding protein (LEF-3) and putative helicase (P143). J. General Virol. 80, 493–500. 29. Evans, J.T., Leisy, D.J. & Rohrmann, G.F. (1997a) Character- ization of the interaction between the baculovirus replication factors LEF-1 and LEF-2. J. Virol. 71, 3114–3119. 30. Evans, J.T. & Rohrmann, G.F. (1997b) The baculovirus single- stranded DNA binding protein LEF-3, forms a homotrimer in solution. J. Virol. 71, 3574–3579. 31. McDougal, V.V. & Guarino, L.A. (1999) Autographa californica nuclearpolyhedrosis virus DNA polymerase: measurements of processivity and strand displacement. J. Virol. 73, 4908–4918. 32. Laufs, S., Lu, A., Arrell, K. & Carstens, E.B. (1997) Autographa californica nuclear polyhedrosis virus P143 gene product is a DNA-binding protein. Virology 228, 98–106. 33. Boehmer, P.E. (1998) The herpes simplex virus type-1 single- strand DNA-binding protein, ICP8, increases the processivity of the UL9 protein DNA helicase. J. Biol. Chem. 273, 2676–2683. 34. Knopf, C.W. (2000) Molecular mechanisms of replication of herpes simplex virus 1. Acta Virol. 5, 289–307. 35. Simonsson, S., Samuelsson, T. & Elias, P. (1998) The herpes simplex virus type I origin binding protein. J. Biol. Chem. 273, 24633–24639. 36. Boehmer, P.E. & Lehman, J.R. (1997) Herpes simplex virus DNA replication. Ann. Rev. Biochem. 66, 347–384. 6240 K. L. Hefferon and L. K. Miller (Eur. J. Biochem. 269) Ó FEBS 2002 . helicase–primase complex [35,36]. The focus of this paper was to further elucidate the roles of replication LEFs and the nature of the AcMNPV replication complex by studying. two-hybrid system To gain insight into the nature of the AcMNPV DNA replication complex, we examined the ability of each tagged lef to interact with other replication