Membrane targeting of a folded and cofactor-containing protein Thomas Bru¨ ser 1 , Takahiro Yano 2 , Daniel C. Brune 3 and Fevzi Daldal 1,2 1 Department of Biology, University of Pennsylvania, Philadelphia, PA 19104-6018, USA; 2 Johnson Research Foundation, Department of Biochemistry and Biophysics, University of Pennsylvania, Philadelphia, PA 19104-6059, USA; 3 Department of Chemistry and Biochemistry, Arizona State University, Tempe, AZ 85287-1604, USA Targeting of proteins to and translocation across the membranes is a fundamental biological process in all organisms. In bacteria, the twin arginine translocation (Tat) system can transport folded proteins. Here, we demonstrate in vivo that the high potential iron-sulfur protein (HiPIP) from Allochromatium vinosum is trans- located into the periplasmic space by the Tat system of Escherichia coli. In vitro, reconstituted HiPIP precursor (preHoloHiPIP) was targeted to inverted membrane vesicles from E. coli by a process requiring ATP when the Tat substrate was properly folded. During membrane targeting, the protein retained its cofactor, indicating that it was targeted in a folded state. Membrane targeting did not require a twin arginine motif and known Tat system components. On the basis of these findings, we propose that a pathway exists for the insertion of folded cofactor- containing proteins such as HiPIP into the bacterial cytoplasmic membrane. Keywords: ATP dependence; high potential iron–sulfur protein (HiPIP); in vitro folding; membrane targeting; twin arginine translocation. Bacteria translocate proteins across the cytoplasmic mem- brane by two main pathways, the general secretory (Sec) and the twin arginine translocation (Tat) systems [1,2]. In the past, most studies on protein targeting have focused on translocation or membrane integration of unfolded protein substrates by the Sec machinery, and many components have been identified that play specific roles in Sec-dependent targeting pathways [3]. On the other hand, the Tat system has been shown to translocate folded proteins powered by the transmembrane proton gradient [4]. So far, only four components, TatA, TatB, TatC and TatE, have been identified in Escherichia coli. Three of the corresponding genes, tatABC, are organized in an operon together with tatD, which encodes a nuclease that is probably unrelated to the Tat system [5]. TatE is a structural and functional homolog of TatA and encoded at a different locus [6]. TatA and TatB together can form a double-layered ring structure and are suggested to constitute the translocation pore [7]. The precise role of TatC remains to be determined, but it is already known that this component can form a functional unit with TatB [8]. It is currently believed that TatA or TatE, together with TatB and TatC, can carry out most of the required functions, such as binding of Tat substrates, recognition of the folded state, formation of a translocation pore, usage of the DpH for translocation, or prevention of ion leakage [2]. Protein substrates for both the Sec and Tat systems are synthesized with similar N-terminal signal peptides, com- posed of a hydrophilic and positively charged n-region, followed by a hydrophobic h-region and then often by a c-region which determines a cleavage site (Fig. 1). Sub- strates of the bacterial Tat system contain longer signal peptides which include a conserved (S/T)RRXFLK motif in their n-region [9,10] and a significantly less hydropho- bic h-region [11]. In addition, Tat signal peptides often contain charged amino-acid residues in their c-region, which are not common in Sec-typical signal peptides [2,12,13]. Folding of Tat substrates before their Tat-dependent translocation in E. coli has been demonstrated in vivo in several cases, including the green fluorescent protein and hydrogenase [14–16]. Furthermore, cytoplasmic matur- ation systems that induce protein folding such as iron- sulfur cluster assembly pathways can also act in conjunction with translocation [17]. Moreover, natural Tat substrates that acquire a folded and often cofactor- containing state before their translocation appear not be secreted by the Sec system [2]. On the other hand, Sanders et al. [18] have shown that typical Sec substrates such as c-type cytochromes can be translocated via the Tat system only when they are synthesized with Tat signal sequences and if they receive in the cytoplasm their heme cofactor allowing their folding. Recently, a functional in vitro Tat system has been established using in vitro translated and cofactor-free Tat Correspondence to T. Bru ¨ ser, Institut fu ¨ r Mikrobiologie, Universita ¨ t Halle, Kurt-Mothes-Str. 3, 06120 Halle, Germany. Fax: + 49 345 5527010, Tel.: + 49 345 5526360, E-mail: t.brueser@mikrobiologie.uni-halle.de Abbreviations: Tat, twin arginine translocation; HiPIP, high potential iron-sulfur protein; INV, inverted membrane vesicle; MalE, maltose-binding protein; DDM, dodecyl maltoside. Note: The prefixes ÔHoloÕ, ÔMalÕ and ÔApoÕ are used herein solely for the description of HiPIP, the cofactor content and folded state of which has been investigated in vitro. On the other hand, the prefixes ÔpreÕ and ÔmatÕ are used to distinguish precursor and mature proteins. For example, the precursor of the HiPIP holoprotein is termed preHoloHiPIP, whereas a HiPIP precursor of unknown folded state is termed preHiPIP. (Received 10 October 2002, revised 19 January 2003, accepted 27 January 2003) Eur. J. Biochem. 270, 1211–1221 (2003) Ó FEBS 2003 doi:10.1046/j.1432-1033.2003.03481.x substrates [19,20]. However, the mechanism of targeting and translocation of folded redox proteins by the Tat system remains largely unknown. In this study, we opted to use a fully folded and cofactor-containing Tat substrate. As the folded state is of importance for the Tat system in vivo,we expected that this approach might lead to new insights. We have chosen as a model substrate the high-potential iron- sulfur protein (HiPIP) from Allochromatium vinosum,which is a monomeric 9-kDa periplasmic protein containing one [4Fe)4S] 2+/3+ cluster bound via four cysteines [21,22]. As biosynthesis of iron-sulfur clusters is thought to take place in the cytoplasm, it is thought that HiPIP is folded and loaded with an iron-sulfur cluster before its translocation into the periplasmic space [17]. The signal peptide of HiPIP has all the characteristics of Tat substrates [23] (Fig. 1), and its structure and folding properties are well characterized [24]. In this work, we first demonstrated that the hetero- logously expressed HiPIP is translocated into the periplas- mic space in E. coli, and that its translocation requires the tatABC genes as well as the RR motif of the signal sequence. Next, we successfully reconstituted the [4Fe)4S] cluster into the HiPIP precursor (preHoloHiPIP) in vitro andusedthis folded protein for in vitro targeting experiments. We found that freshly prepared preHoloHiPIP can be targeted efficiently to inverted cytoplasmic membrane vesicles (INVs) from E. coli, that this process requires ATP hydrolysis and an ATP-regeneration system, and that the membrane-associated preHoloHiPIP undergoes a conform- ational change without losing its [4Fe)4S] cofactor. Fur- thermore, this in vitro targeting reaction requires neither the known Tat components (TatABCE) nor the RR motif in the signal peptide. We also observed that, on extended storage, preHoloHiPIP could be converted into a form capable of integrating into the membrane without ATP, probably because of conformational changes induced by the loss of its cofactor. The overall findings suggest that a pathway exists for the membrane insertion of folded and cofactor-containing proteins. Such a pathway may play a role in the biogenesis of membrane-bound redox proteins, or it may precede recognition and translocation by the Tat system in vivo. Materials and methods Genetic methods TatABC genes (including the tatA promoter region) were amplified with Pfu polymerase (Stratagene) from genomic DNA from E. coli MC4100 using the primers 5¢-AGTCGTGGATCCAAGATCAGGTCGGTATT-3¢ and 5¢-TGCGCGGCGAGCTCAATAATCGCTTC-3¢.ThePCR product was cleaved with BamHI and SacI at primer- generated cleavage sites and cloned into the corresponding sites of pRK415, resulting in pRK-tatABC.TheXbaI– BamHI fragment of pCVH1 [23], which contains hip and its promoter region, was cloned into the corresponding sites of pRK-tatABC, resulting in pRK-tatABC-hip. For construc- tion of the hip expression vector pRK-hip,thetatABC- containing fragment from pRK-tatABC-hip was removed by restriction with SacI–BamHI and self-ligation of the remaining vector. The RR in the signal peptide of preHiPIP was mutated to KK using the primer couples 5¢-AAGAGC AAGAAAGACGCTGTCAAAGTGATG-3¢/5¢-TCCGG ATATAGTTCCTCCT-3¢ and 5¢-ACGTTACTGGTTTC ACATTC-3¢/5¢-AGCGTCTTTCTTGCTCTTGCTGATT GGCTT-3¢ to generate two overlapping PCR fragments with pEXH5 as template [13]. These two PCR fragments were subjected to a second round of PCR to generate the RRfiKK-mutant fragment, which was then cleaved by NdeIandHindIII and cloned into the corresponding sites of pET22b+ (Novagen), resulting in pEXH15 used for inclu- sion body formation of the mutant protein. For the in vivo analyses, the RRfiKK exchange was achieved using the primers 5¢-CATCACTTTGACAGCGTCTTTCTTGCTC TTGCTGATTGGCTTATCG-3¢ and 5¢-CGATAAGCCA ATCAGCAAGAGCAAGAAAGACGCTGTCAAAGTG ATG-3¢ using the QuikChange kit (Stratagene) with pCVH1 as a template. The RRfiKK exchanges were confirmed by sequencing. In vivo analysis of preHiPIP translocation E. coli strain MC4100 and its derivatives B1LK0 (DtatC) [25] and DADE (DtatABCDE) [5] were generously provided by T. Palmer (University of East Anglia, Norwich, UK) and grown on Luria–Bertani medium under aerobic conditions, or on Luria–Bertani medium supplemented with 0.4% NaNO 3 and 0.5% glycerol under anaerobic growth condi- tions. hip was expressed from its own promoter using either pRK-hip or pRK-tatABC-hip, which also contains tatABC under the control of the tat promoter, and which was used for complementation of HiPIP translocation in Tat mu- tants. Periplasmic fractions were prepared using 50 mL anaerobically grown cell cultures, as described elsewhere [26]. Immunoblot analysis was carried out as described previously [13]. Preparation of fully folded precursor HiPIP (preHoloHiPIP) For preparation of preApoHiPIP inclusion bodies, a 1-L E. coli BL21 DE3 culture carrying pEXH5 [13] was grown in Luria–Bertani medium with high aeration, and hip expression was induced for 3 h with 1 m M isopropyl Fig. 1. The signal peptide of A. vinosum HiPIP contains all known determinants specific of the Tat translocation pathway. The Tat signal peptide of A. vinosum HiPIP (upper sequence) is compared with the Sec-typical signal peptide sequence of the outer membrane protein A (OmpA) from E. coli. Note that, compared with Sec signal peptide sequences, the Tat signal peptide sequence is generally longer, it has a twin arginine motif (underlined bold) within a conserved pattern (bold), an extended hydrophilic N-terminus (n-region), a longer uncharged region with moderate hydrophobicity (h-region), and often a charged residue near the cleavage site (c-region followed by an arrow). 1212 T. Bru ¨ ser et al.(Eur. J. Biochem. 270) Ó FEBS 2003 thio-b- D -galactoside at D 600 ¼ 1. Harvested cells were washed once in 50 mL 100 m M Tris/HCl, pH 8.0, resus- pended in 30 mL of the same buffer, and broken by two passages through a French pressure cell operating at 138 MPa. Inclusion bodies and cell debris were sedimented and washed twice by centrifugation (20 min, 25 000 g, 4 °C), dissolved in 20 mL ice-cold 50 m M Tris/HCl (pH 8.0)/2 m M dithiothreitol/8 M urea, and cell debris was separated by centrifugation (30 min, 30 000 g,4°C). The supernatant (inclusion body solution) was shock-frozen in liquid nitrogen in 1 mL aliquots and stored at )80 °C. For in vitro folding, preApoHiPIP was first allowed to assemble iron at room temperature in a reaction mixture containing 43 l M preApoHiPIP, 220 l M Fe(NH 4 )SO 4 , 2m M dithiothreitol and 5 M urea in a total volume of 15 mL. After 5 min of incubation, 1.25 m M Na 2 Swas added and folding was continued for 20 min. The solution was then applied to a 2-mL DEAE-Sephacryl (Pharmacia) column equilibrated with 20 m M Tris/HCl, pH 9.0. Folded and cofactor-containing preHoloHiPIP passed through the column and was subsequently dialyzed against STM buffer (250 m M sucrose, 5 m M Tris/HCl pH 8.0, 5 m M MgSO 4 ). PreHoloHiPIP prepared in this way was stable for about 1 week on ice. Iron content of HiPIP was determined using the bathophenanthrolinedisulfonate method [27]. UV/vis spectra were recorded using an Hitachi U3210 spectro- photometer. Preparation of inverted cytoplasmic membrane vesicles Cells (6 g wet weight) were resuspended in 40 mL 10 m M Tris/acetate, pH 7.6, containing 20% sucrose, 0.1 m M EDTA, and 1 m M dithiothreitol, incubated for 10 min at room temperature, and sedimented at 5000 g for 20 min at 4 °C. The pellet was resuspended in 40 mL ice-cold 5 m M MgSO 4 and incubated on ice for 20 min, followed by centrifugation at 5000 g for 20 min at 4 °C. The pellet was resuspended in 50 m M Tris/acetate, pH 7.6, containing 250 m M sucrose, 1 m M dithiothreitol, and 50 lgÆmL )1 DNase I, and passed through a French pressure cell operating at 27.6 MPa to produce INVs [28]. The solution was then centrifuged for 10 min at 5000 g,andthe supernatant was centrifuged again at 150 000 g for 2 h at 4 °C. The membrane pellet was resuspended in 2 mL STM buffer supplemented with 1 m M dithiothreitol. Aggregated material was removed by a final centrifugation at 15 000 g, and the clear supernatant was divided into aliquots and frozen in liquid nitrogen. Cofactor tracing and membrane-targeting assays The [4Fe)4S] 2+/3+ cofactor was radioactively labeled by including 50 lCi 55 FeCl 3 in the iron-assembly step of the folding protocol described above. PreHoloHiPIP was targeted to INVs in a mixture containing  600 pmol preHoloHiPIP ( 40 000 c.p.m.), 26 lg INV protein, 250 m M sucrose, 5 m M MgSO 4 ,5m M ATP, 60 m M phos- phocreatine, 100 lgÆmL )1 creatine kinase, 5 mgÆmL )1 BSA, 1m M dithiothreitol, and 15 m M Tris/HCl, pH 7.5. The reaction was started after 1 min preincubation by addition of INVs, carried out for the indicated amounts of time at 37 °C, and terminated by rapid vacuum filtration through 0.22-lm pore size GV-type membranes (Millipore). The filtered INVs were immediately washed with 3 mL STM/ 200 m M NaCl/50 m M MgSO 4 ,and 55 Fe bound to INVs was monitored by determination of the radioactivity thus retained by liquid scintillation counting. For immunoblots, filter membranes were extensively washed with 100 lL SDS/PAGE sample buffer, and 10 lL were used for SDS/ PAGE and blotting as described elsewhere [13]. [ 35 S]Met- labeled maltose-binding protein (MalE) was produced by in vitro translation with rabbit reticulocyte lysate (Promega protocol) from RNA obtained by in vitro transcription of HindIII-digested pBAR107N [29]. The MalE used herein is a C-terminally truncated form which cannot fold and therefore has been found to be more suitable for Sec- dependent in vitro translocation than full-length MalE [29]. MalE was targeted for 40 min at 37 °CtoINVsina mixture containing 1 lLMalEand50lg INV protein under conditions identical with the targeting assay of preHoloHiPIP described above. The assay mixture was then incubated on ice with or without thermolysin (200 lgÆmL )1 , 1 h), followed by trichloroacetate precipitation, SDS/PAGE analysis, and analysis of the radioactive protein bands by use of the phosphoimager system and the quantification program IMAGEQUANT (Molecular Dynamics). When indicated, the targeting reaction was carried out in the presence of gramicidine (10 l M ) or cyanide m-chlorophenyl- hydrazone (CCCP, 100 l M ), or ATP was replaced by NADH. Other biochemical methods Mature HiPIP (matHoloHiPIP) was purified from photo- heterotrophically grown A. vinosum. Cells (10 g) were broken in 20 m M Tris/HCl, pH 8.5, by two passages through a French pressure cell operating at 138 MPa. After low-speed and ultracentrifugation steps, the supernatant containing the soluble proteins was loaded onto a 100-mL DEAE-Sephacel column equilibrated with the same buffer. After washing of the column, matHoloHiPIP was eluted by changing the buffer to 20 m M Tris/HCl, pH 7.0. HiPIP- containing fractions were dialyzed against 20 m M Tris/HCl, pH 8.5, and further purified using a 1-mL Mono Q FPLC column and a 40-mL gradient of 0–200 m M NaCl in 20 m M Tris/HCl, pH 8.5. MatHoloHiPIP was homogeneous as judged by Coomassie-stained SDS/PAGE gels. SDS/PAGE analysis was carried out with 15% T Laemmli gels, and protein was determined by the Lowry method [30,31]. For N-terminal amino-acid sequence determination of Coomassie-stained, Immobilon filter blot- ted proteins, Edman degradation was carried out using a Proton 2090E gas-phase protein sequencer (Beckman, Fullerton, CA, USA) equipped with an online Hewlett– Packard 1090L HPLC [32]. For affinity purification, 150 nmol preHoloHiPIP was coupled to a 2-mL Aminolink column matrix (Pierce, Rockford, IL, USA). Membranes from 6 g cells of the E. coli strain DADE lacking TatA- BCDE were resuspended in STM buffer, and solubilized for 1 h by stirring at 4 °C and addition of dodecyl maltoside (DDM) to a final concentration of 1%. Solubilized mem- branes were centrifuged (145 000 g, for 1 h) and the supernatant was diluted with STM buffer to 0.2% DDM. The Aminolink-preHiPIP column (operated by gravity Ó FEBS 2003 Membrane targeting of HiPIP (Eur. J. Biochem. 270) 1213 flow) was equilibrated to STM/0.2% DDM, and solubilized membranes were loaded, followed by a wash with 10 column volumes (20 mL) of STM/0.2% DDM and elution with 10 mL STM/0.2% DDM/2 m M ATP. The column wasthenwashedwith10mLSTM/0.2%DDM/200m M NaCl, followed by a final wash with 10 mL STM/0.2% DDM/500 m M NaCl in order to detect any additional preHoloHiPIP-binding protein not eluted by ATP. EPR measurements X-band (9.4 GHz) EPR spectra were recorded by a Bruker ESP 300E spectrometer using an Oxford Instruments ESR-9 helium flow cryostat to control desired sample temperature. HiPIP preparations were oxidized with 5 m M ferricyanide. Final EPR spectra were obtained after subtracting a spectrum of the buffer containing 5 m M ferricyanide measured under the same conditions. EPR conditions used are described in detail in the legends to the individual figures. Chemicals 55 FeCl 3 and [ 35 S]Met were obtained from Perkin–Elmer Life Sciences. DNA-modifying enzymes were from Bio- Labs, and in vitro transcription and translation kits from Promega. All other chemicals and enzymes were from Sigma or from Fisher Scientific and were of the highest available purity. Results A. vinosum HiPIP is a Tat substrate in E. coli The gene hip from A. vinosum encoding HiPIP was expressed from its own promoter in various E. coli strains and their subcellular fractions were prepared. Western-blot analyses indicated that HiPIP was translocated into the periplasm under anaerobic growth conditions (Fig. 2). In wild-type cells carrying the plasmid pRK-hip, all processed HiPIP was detected in the periplasmic fraction (Fig. 2A, lanes 1–3). In contrast, no HiPIP could be detected in the periplasm of tat mutants deficient in TatC or TatABCDE, indicating that translocation of HiPIP to the periplasm does not occur (Fig. 2A, lanes 4–9). Consequently, HiPIP precursor accumulated in the cytoplasm fraction of the mutant strains. Translocation of HiPIP could be restored in the tatABCDE mutant by providing only the tatABC genes in trans (Fig. 2A, lanes 10 and 11), demonstrating that the lack of translocation of HiPIP was due to the absence of the tatABC genes. To further establish that HiPIP is indeed a substrate of the Tat translocon in E. coli, the twin arginine residues in its signal peptide were exchanged with lysines. This kind of substitution has been reported to block Tat- dependent translocation of other Tat substrates in E. coli [9]. When the RRfiKK signal sequence mutant of HiPIP was analyzed, we observed that the translocation was blocked, and that the precursor as well as a degradation product with the size of mature HiPIP accumulated inside the cytoplasm in large amounts (Fig. 2B). These findings confirmed that the twin arginine motif in the signal peptide of A. vinosum preHiPIP is required for its Tat-dependent translocation in E. coli, and established A. vinosum HiPIP as a bona fide Tat substrate. HiPIP precursor can be folded in vitro to native conformation Highly purified HiPIP precursor apoprotein (preApo- HiPIP) was obtained from inclusion bodies and folded to its native conformation in vitro as described in Materials and Methods. Reconstituted HiPIP precursor (preHolo- HiPIP) contained 3.9 Fe atoms per protein and showed the typical optical absorption spectrum of purified mature HiPIP (matHoloHiPIP) with maxima at 283 nm and 388 nm and an absorbance ratio A 282 /A 388 of 2.6 ± 0.1 [13,33]. Further, EPR spectra of reconstituted preHolo- HiPIP exhibited the well-characterized matHoloHiPIP signature with g x , g y and g z tensor values of 2.037, 2.045 and 2.122 and a g av value of 2.068 (Fig. 3). The data indicate that preHoloHiPIP was folded fully under the conditions used, as shown previously for mature HiPIP [24]. As the dimerization of HiPIP induces well-characterized hetero- geneities in the g z region [34], a close examination of our data indicated that in vitro folded preHoloHiPIP is mono- meric in solution. Treatments of preHoloHiPIP with proteinase K, thermolysin, trypsin or chymotrypsin as well as with combinations of these proteases generated a mature Fig. 2. Translocation of A. vinosum HiPIP depends on the Tat system in E. coli. Detection of A. vinosum HiPIP precursor (pre) and mature HiPIP (mat) by Western blotting in cell fractions from E. coli wild-type (MC4100) and Tat-deficient strains expressing hip.Strainsandplas- mids are indicated above corresponding lanes, as follows: wt, wild type E. coli MC4100 in (A), or XL1-BLUE in (B) and (C); DtatC,B1LK0; DtatABCDE, DADE strains. The plasmid pRK-tatABC-hip contained both the E. coli tatABC and A. vinosum hip genes, expressed inde- pendently (see Materials and methods for description of this plasmid). In each lane, protein corresponding to  375 lL bacterial culture were loaded, and the applied cell fractions are indicated: c, cytoplasm; m, membrane; p, periplasm. (A) Restoration of HiPIP translocation in a DtatABCDE deletion strain complemented with the tatABC genes carried by pRK-tatABC-hip; (B) effect of replacing the conserved arginine residues R(10)R(11) with K(10)K(11) residues of hip on the translocation of HiPIP protein. (C) Coomassie-stained gel from a representative cell fractionation. Molecular mass markers are indicated on the left. 1214 T. Bru ¨ ser et al.(Eur. J. Biochem. 270) Ó FEBS 2003 form of HiPIP, suggesting that only its 4-kDa signal peptide could be truncated by protease treatment without losing or perturbing the EPR characteristics of its [4Fe)4S] cluster (data not shown), and indicated that the iron-sulfur cluster- binding domain of preHoloHiPIP is highly resistant to proteases. The cleavage site of protease-treated preHolo- HiPIP was determined by N-terminal amino-acid sequen- cing. Proteinase K cleaved at position )3, )2, )1, 0 and +1 relative to the natural signal peptide cleavage site, with 80% cleavage at position )2. Thermolysin treatment on the other hand resulted in a clean single cut of the signal peptide at position )3. This indicated that these proteases indeed cleaved off the signal peptide from in vitro folded pre- HoloHiPIP without affecting the remainder of the protein. Therefore, preHoloHiPIP treated with proteinase K or thermolysin was regarded as mature matHoloHiPIP. ATP-dependent targeting of HiPIP precursor into inverted membrane vesicles from E. coli In vitro folded and [4Fe)4S] cluster-containing preHolo- HiPIP was next incubated with INVs under the conditions described in Materials and Methods. In the presence of ATP and an ATP-regenerating system consisting of phosphocre- atine and creatine kinase, we observed that a large amount of preHoloHiPIP accumulated in the membranes (Fig. 4A). To quantify this membrane-targeting reaction, and also to monitor the fate of the cofactor during this process, preHoloHiPIP was radiolabeled by including 55 FeCl 3 into the folding procedure, and time-dependent 55 Fe accumula- tion was monitored. The data indicated that only a small amount of 55 Fe could be associated with the membrane in the absence of ATP, and addition of ATP enhanced it by about 5- to 20-fold (Figs 4B and 5). From 55 Fe label tracing Fig. 3. preHoloHiPIP reconstituted in vitro has native spectroscopic properties. EPR spectra of in vitro reconstituted preHoloHiPIP are compared with those of mature HiPIP as purified from A. vinosum.The EPR spectroscopy conditions were as follows: modulation frequency, 100 kHz; modulation amplitude, 10.145 G; time constant, 163.84 ms; conversion time, 163.84 ms (see Materials and methods for more details). Note that the reconstituted preHoloHiPIP exhibits a symmet- ricalpeakintheg z region (seeinsert), indicatingits monomeric state [34]. Fig. 4. ATP-dependent targeting of preHoloHiPIP to INVs from E. coli. (A) Immunoblot analysis using anti-HiPIP serum after tar- geting. INVs from 15 min targeting assays were filtered and resus- pended in 100 lL SDS/PAGE sample buffer for analysis, and samples were separated by SDS/PAGE (15% T) and blotted on nitrocellulose for HiPIP detection using polyclonal antibodies. Lane 1, HiPIP pre- cursor standard (solubilized inclusion bodies,  0.25 lg); lanes 2–5, HiPIP after targeting to INVs in the absence (lanes 2 and 3) or presence (lanes 4 and 5) of ATP; lane 6, mature HiPIP purified from A. vinosum ( 0.25 lg, see Materials and methods), used as a control. The posi- tions of precursor (pre) and mature (mat) HiPIP bands are indicated. Note that without INVs no significant preHoloHiPIP was retained on the filter, and that ATP had no effect when INVs were absent (not shown). (B) 55 Fe-labeled preHoloHiPIP was targeted to E. coli INVs. Targeting was terminated using a rapid filtration assay, and filter retained 55 Fe radioactivity was monitored by liquid scintillation counting (see Materials and methods). Assay mixtures contained besides the standard mix (see Materials and methods) 5 m M ATP/ 10 l M gramicidin (r), 5 m M ATP (j); no ATP (negative control) (e); 5m M NADH (h). Each data point is the mean of three independent incubation/filtration assays, and error bars show the standard devia- tions observed between samples. The presence of a DpH is indicated and generated by either addition of ATP or NADH. The formation of a DpH under the assay conditions used was confirmed by fluorescence quenching assays performed separately (data not shown). Ó FEBS 2003 Membrane targeting of HiPIP (Eur. J. Biochem. 270) 1215 kinetics, the specific activity of ATP-dependent membrane insertionwasestimatedtobe33±10pmoltargeted preHiPIPÆmin )1 Æ(mg INV protein) )1 .Upto18pmol ( 0.3 lg) preHoloHiPIP could be targeted to 26 lgmem- branes, indicating thatthe membranes were efficiently loaded with preHoloHiPIP. An ATP-regenerating system was required for targeting, indicating that ATP is hydrolyzed in the assay. Additional experiments indicated that hydrolysis of ATP is required for this process, as neither the non- hydrolyzable ATP analogue p[NH]ppA nor AMP could substitute for ATP (S. Trautmann and T. Bru ¨ ser, unpub- lished results). The existence of a transmembrane proton gradient, as generated by either reverse action of ATP synthase or NADH-dependent electron transport, was not required for membrane targeting, and it rather affected negatively the kinetics (Fig. 4B). Moreover, with a similar assay, matHoloHiPIP could not be targeted to INVs, indicating that the signal peptide is required for the targeting process (Fig. 5A). Next, to probe whether the ATP-dependent targeting of preHoloHiPIP to the membrane required the twin arginine motif in the signal peptide or the known Tat components, membrane targeting with an in vitro folded R(10)R(11)fi K(10)K(11) signal sequence mutant (preHoloHiPIP-KK) and targeting to INVs derived from various Tat-deficient mutant strains were tested. The data indicated that preHoloHiPIP-KK was accepted as an efficient substrate for ATP-dependent membrane insertion, and that deletion of tatC or tatABCDE did not significantly affect the ATP- dependent targeting of preHoloHiPIP to INVs (Fig 5B,C). Therefore, the ATP-dependent membrane-targeting reac- tion does not appear to require the twin arginine motif in vitro, nor does it depend on any of the as yet known Tat components. To examine the possibility that the ATP dependence results from an involvement of SecA in the targeting process, we compared the azide sensitivity of preHoloHiPIP targeting with that of the targeting of the Fig. 5. Requirements for membrane targeting of HiPIP. (A) 55 Fe tracing data obtained using standard targeting assays (see Materials and methods) with matHoloHiPIP and preHoloHiPIP to INVs. To produce matHoloHiPIP, preHoloHiPIP reconstituted in vitro was digested for 60 min on ice with 100 lgÆmL )1 proteinase K. The reac- tion was stopped by addition of phenylmethanesulfonyl fluoride (10 m M ,10 min,0 °C) in dimethyl sulfoxide. It was confirmed that this phenylmethanesulfonyl fluoride treatment resulted in complete inac- tivation of proteinase K. For assays with the unprocessed substrate, preHoloHiPIP was incubated in parallel on ice without protease, and treated thereafter with phenylmethanesulfonyl fluoride. Note that the absence of the N-terminal signal peptide in the matHoloHiPIP results in targeting deficiency even in the presence of ATP. (B) 55 Fe tracing data obtained using standard targeting assays with either wild-type preHoloHiPIP (RR) or its RRfiKK signal peptide mutant (KK) derivative. (C) 55 Fe tracing data obtained using standard targeting assays with preHoloHiPIP and INVs prepared from wild-type E. coli (wt ¼ MC4100), a DtatC mutant (B1LK0) and a DtatABCDE mutant (DADE). Incubation times (min) and ATP addition are also indicated. All values are given as a percentage of ATP-dependent targeting of preHoloHiPIP observed using wild-type E. coli INVs, and error bars indicate the standard deviation observed under the assay conditions used. 1216 T. Bru ¨ ser et al.(Eur. J. Biochem. 270) Ó FEBS 2003 model Sec substrate MalE. In protease-protection assays as described in Materials and methods, we observed an inhibition of 37 ± 5% of MalE targeting, whereas mem- brane targeting of preHoloHiPIP was inhibited by 12.5 ± 7.5% under the same conditions. Characterization of membrane-targeted preHoloHiPIP To determine whether or not the targeted preHoloHiPIP retained the [4Fe)4S] cluster, EPR spectroscopy was used. After ATP-dependent preHoloHiPIP targeting, membrane fractions exhibited EPR signals that were not detectable when ATP was omitted from the assay (Fig. 6, upper two traces). The difference of both spectra gave a typical HiPIP spectrum (Fig. 6, lower trace). Moreover, mem- brane-associated preHoloHiPIP could be degraded by thermolysin or proteinase K treatment (Fig. 7A, lane 1). These data indicate that, during ATP-dependent mem- brane targeting, preHoloHiPIP retained its iron-sulfur cofactor, and that the cofactor-binding domain was exposed on the INV membrane surface, and not trans- located across the membrane. Apparently, this protease sensitivity of targeted preHoloHiPIP was induced by INV binding (Fig. 7A, lanes 1/5), as nontargeted preHolo- HiPIP could be digested only to mature size by various proteases (Fig. 7A,B, lanes 5 and 6). This suggested to us that membrane targeting alters the conformation of preHoloHiPIP, thereby increasing its protease sensitivity. Interestingly, when membrane-associated preHoloHiPIP was treated with protease, a small peptide of similar size to that of the signal peptide of HiPIP remained protected, and could be detected with polyclonal antibodies raised against the precursor of HiPIP (Fig. 7A, lane 1). The detection of the protease-protected HiPIP fragment in conjunction with the salt-wash-resistant association of the precursor with the membranes suggests a membrane- insertion process. As the C-terminus of preHoloHiPIP binds the cofactor that is retained during membrane targeting (Fig. 6), this membrane-insertion process appears to be mediated by the N-terminus of this protein. Thus, association of the preHoloHiPIP with the mem- brane apparently reflects two distinct processes: (a) the insertion of the N-terminus into the membrane, and (b) a change in the preHoloHiPIP conformation. Change in preHoloHiPIP conformation requires ATP and not insertion of the signal peptide When older preparations (over 1 week) of in vitro reconstituted preHoloHiPIP were used instead of fresh preparations, we found that ATP dependence of target- ing disappeared (Fig. 7B, lane 4). These ÔagedÕ prepara- tions exhibited significantly altered optical spectroscopic properties such that the [4Fe)4S] cluster absorbance significantly decreased and the absorption maximum in the UV area was shifted from 283 nm to 275 nm, indicating that up to 40% of the preparation shifted to a modified conformation, lacking its cofactor (called pre- MalHiPIP; Fig. 7C). Nonetheless, even when this pre- MalHiPIP was targeted to the membrane, a peptide of the size of the signal peptide became protease-protected, as in the case of preHoloHiPIP (Fig. 7B, lanes 1 and 2). These observations suggest that the membrane insertion per se does not require ATP, but rather ATP is needed for structural conversion of preHoloHiPIP into a Ôless tightlyÕ folded, protease-digestible form capable of membrane insertion. Attempts to purify this ATPase by affinity with preHoloHiPIP covalently attached to an ÔAminolinkÕ matrix resulted in isolation of a protein identified as DnaK by N-terminal amino-acid sequencing. However, preliminary data obtained using DnaK-deficient mutants suggest that DnaK is not essential for the translocation of HiPIP in vivo, and it is also not the ATPase responsible for the above targeting process in vitro. Fig. 6. Membrane-associated HiPIP precursor contains its high-poten- tial iron-sulfur cofactor. Membranes from several independent stand- ard targeting reactions with or without ATP were pooled and analyzed by EPR spectroscopy (see Materials and methods). Total INVs (130 lg) from five standard assays were used to obtain each spectrum. The spectrum obtained with samples that contained ATP showed that preHoloHiPIP was targeted to INVs and the [(+ATP) – (–ATP)] difference spectrum revealed a typical EPR signature that is charac- teristic of HoloHiPIP. The EPR spectroscopy conditions were as described in Fig. 3, and spectra were averaged from 10 scans. Ó FEBS 2003 Membrane targeting of HiPIP (Eur. J. Biochem. 270) 1217 Evidence for membrane targeting of HiPIP in vivo The in vitro data described above raised the possibility that preHiPIP could also be targeted to the membrane in vivo. However, membranes of wild-type E. coli expressing hip from its own promoter did not contain readily detectable preHiPIP (Fig. 2). As membrane-targeted preHoloHiPIP is highly protease sensitive, we considered that preHiPIP might be rapidly degraded in membranes. Thus we tested membrane targeting of preHiPIP-KK in an E. coli strain that expressed hip from the stronger T7 promoter (Fig. 8). In such a strain, preHiPIP-KK was readily detected in membranes that had been washed twice (once in low-salt and once in high-salt buffer) to ensure high purity. Moreover, degradation products of HiPIP were also detected, consistent with the high protease sensitivity of membrane-targeted HiPIP precursor. Thus, these results suggest that membrane targeting of HiPIP also occurs in vivo. Discussion Recent studies suggest that Tat substrates need to fold in the cytoplasm before translocation to their final destinations. For example, the Tat substrate glucose–fructose oxido- reductase from Zymomonas mobilis requires correct folding and cofactor binding for efficient translocation [35]. In addition, it has been demonstrated that translocation of c-type cytochromes via the Tat system requires cytoplasmic attachment of its cofactor, which induces folding [18]. It is also known that HiPIP can fold and assemble its cofactor in the cytoplasm [36]. Therefore, we chose HiPIP from A. vinosum, as a small and well-characterized [4Fe)4S] cluster-containing protein with a signal sequence exhibiting the known characteristics of typical Tat substrates (Fig. 1). Using the E. coli system as the best-characterized bacterial Tat system, we then established the Tat dependence of HiPIP translocation in vivo to pave the way for experiments in vitro. Fig. 8. Detection of the preHiPIP in membranes of E. coli expressing the RRfiKK signal peptide mutant derivative of HiPIP. Western-blot analysis of membrane fractions from E. coli strains BL21 DE3 car- rying plasmids pEXH15 (KK) or pEXH5 (RR). Membranes were prepared from crude extract after low-speed centrifugation (30 min, 23 000 g,4°C), ultracentrifugation (143 000 g,2h,4°C), a first wash in low-salt buffer (20 m M Tris/HCl, pH 8.0, followed by ultracentri- fugation), and a second wash and sonication in high-salt buffer (200 m M NaCl, 50 m M MgSO 4 ,5m M Tris/HCl, pH 8.0, 250 m M sucrose, followed by ultracentrifugation) and resuspension in 5 m M MgSO 4 /5 m M Tris/HCl (pH 8.0)/250 m M sucrose for Western-blot analysis. Each lane corresponds to material obtained from  100 lL E. coli culture. Fig. 7. Only correctly folded preHoloHiPIP requires ATP for mem- brane targeting. In (A) the ATP dependence of membrane insertion of preHoloHiPIP is shown by immunoblot analysis. Lanes 1–4 show the analysis of filtered and washed INVs after preHoloHiPIP targeting. The presence or absence of ATP in the assay mixture is indicated. The material analyzed in lanes 1 and 2 was further subjected to protease treatment [200 lgÆmL )1 thermolysin (TL) for 40 min on ice]. In par- allel assays, the effect of thermolysin treatment on soluble pre- HoloHiPIP in STM buffer was tested (lanes 5 and 6). In (B) the same analysis was carried out with preMalHiPIP. Lanes 1–4 show the analysis of filtered and washed INVs after preMalHiPIP targeting. The presence or absence of ATP in the assay mixture is indicated. The material analyzed in lanes 1 and 2 was further subjected to protease treatment [200 lgÆmL )1 proteinase K (PK) for 40 min on ice]. In parallel assays, the effect of proteinase K treatment on soluble preMalHiPIP in STM buffer was tested (lanes 5 and 6). (C) Com- parison of UV-visible spectra of preHoloHiPIP and preMalHiPIP ( 15 l M ) in STM buffer. Abbreviations: pre, precursor; mat, mature protein; ppf, protease-protected fragment. 1218 T. Bru ¨ ser et al.(Eur. J. Biochem. 270) Ó FEBS 2003 HiPIP is a bona fide Tat substrate in E. coli As expected, in vivo translocation of HiPIP required the tatABC gene products as well as the twin arginine motif in its signal peptide (Fig. 2). When the twin arginines in the signal peptide are replaced by lysines, the translocation is completely blocked, indicating that HiPIP is a substrate of the Tat system [9]. Some accumulating precursor is degraded to mature size, probably as the result of cytoplasmic folding before degradation (compare with Fig. 7A, lanes 5,6). There are known cases in which a Tat substrate signal sequence from one bacterial species is not accepted by the Tat system of another species. One such example is the glucose–fructose oxidoreductase from Z. mobilis, which is translocated by the E. coli Tat system only when its signal peptide is substituted by a signal peptide from the E. coli Tat substrate TorA [37]. Our results indicate that A. vinosum HiPIP behaves as an efficient Tat substrate in E. coli. Thus, the E. coli Tat system is not restricted to proteins with endogenous Tat signal sequences, and no general incompatibility between a Tat system and a heterologous substrate is apparent in this case. The use of heterologous but natural Tat substrates has the advantage that results are more likely to be related to general properties of the Tat system, as substrate-specific targeting factors can be excluded. In particular, HiPIP is an excellent tool for studies on the translocation of folded proteins, because its structure is known, it is small, it has only one cofactor, it is monomeric, and it is soluble. Its functionality as an E. coli Tat substrate was the basis for the following studies. Folded HiPIP can be targeted to the E. coli membranes We found that the preHoloHiPIP obtained by in vitro refolding, starting with inclusion bodies and reconstituting the [4Fe)4S] cluster, could be efficiently targeted in vitro to inverted membrane vesicles in the presence of ATP and an ATP-regeneration system (Fig. 4). The membrane-targeted preHoloHiPIP could not be washed from the vesicles with high-salt buffers. Furthermore, a 4-kDa fragment of preHoloHiPIP became protease-protected on targeting (Fig. 7A,B), suggesting that the targeting of preHoloHiPIP is a membrane-insertion process. We believe that the membrane-inserted peptide corresponds to the N-terminus of preHoloHiPIP for the following reasons: (a) the N-terminal signal sequence is required for membrane insertion (Fig. 5A) because matHoloHiPIP cannot be targeted to INVs; (b) the size of the protease-protected fragment is that of the signal sequence; (c) the C-terminus of HiPIP binds the cofactor and has a globular folded structure, and thus is not available for membrane insertion. The exact topology of the membrane-inserted N-terminus of preHoloHiPIP remains to be determined (Fig. 9). Membrane targeting of preHoloHiPIP appears to be a highly efficient process that requires ATP. However, this ATP dependence of membrane targeting vanishes when preHoloHiPIP loses its cofactor on prolonged storage, i.e. ÔagingÕ, that results in malfolding or partial unfolding (preMalHiPIP, Fig. 7B). Moreover, from studies on HiPIP structure flexibility and folding, it is known that only the N-terminal half of mature HiPIP can be unfolded without the loss of cofactor [38]. These facts suggest that ATP is not required for the membrane-insertion process per se,butit may rather serve to convert the protein structure, probably its N-terminus, into an insertion-compatible conformation (Fig.9).Theincreaseinproteasesensitivityonmembrane insertion indicates that the mature part of HiPIP remains on the cytoplasmic side of the membrane, and that its conformation is affected by membrane insertion. Searching for the ATPase responsible for membrane targeting of preHoloHiPIP, we purified the ATP-dependent chaperone DnaK from the membrane fraction by its affinity for preHoloHiPIP and release by ATP (see Materials and Fig. 9. Model for membrane targeting of HiPIP precursor. It is proposed that mem- brane targeting of native preHoloHiPIP requires an ATP-dependent step as indicated on the left, whereas ÔagedÕ and presumably partially unfolded preMalHiPIP can be inser- ted into the membrane without any ATP requirement as shown on the right. The latter ATP-independent step may involve additional specific protein(s) of currently unknown nature (not shown). Two alternatives for membrane topology of the N-terminus of membrane-inserted preHoloHiPIP (with N-terminal outside or inside shown as con- tinuous or dotted lines, respectively) are also indicated. The TatABC-independent mem- brane insertion observed in vitro is suggested to precede the TatABC-dependent transloca- tion observed in vivo, which is indicated with discontinuous arrows and a question mark. The fate of unfolded protein is unknown. See the text for more details. Ó FEBS 2003 Membrane targeting of HiPIP (Eur. J. Biochem. 270) 1219 methods). However, preliminary experiments using DnaK – mutant strains indicate that both in vivo translocation and in vitro membrane targeting still occur in the absence of this protein. Thus, although DnaK is a cytoplasmic protein, up to 25% of which may be membrane-associated [39], apparently it is not the ATPase observed during membrane targeting of preHoloHiPIP. Why DnaK recognizes pre- HoloHiPIP so efficiently in an ATP-dependent manner is at present unclear, but, considering that this chaperone can also bind specifically to other Tat signal peptides [40], its role could be to ensure complete folding of Tat substrates before membrane insertion. How could membrane insertion take place? Proteins may insert into the membrane in either a sponta- neous or a catalyzed mode. Our observation that a membrane potential can slow down the membrane-insertion process (Fig. 4B) suggests that a positively charged segment of preHoloHiPIP may be transferred across the membrane during this process. If such a charge translocation across a hydrophobic membrane takes place, then the process is likely to require a protein factor for catalysis. Currently known insertases, SecA and YidC, are thought to accept unfolded substrates [41], and their involvement in Tat substrate targeting has previously been ruled out in some cases [42,43]. It is unlikely that the ATPase SecA accounts for the membrane-insertion process described here, as no ATP dependence is observed in the case of preMalHiPIP (see Fig. 7B). Further evidence for the independence of the targeting reaction from SecA was obtained by including 3m M sodium azide in the assay, a well-known SecA inhibitor. At this concentration of azide, we observed only about 10–15% inhibition of the targeting process, whereas the targeting of the model Sec substrate MalE was about 37% inhibited. The higher azide sensitivity of Sec-dependent translocation and the ATP independence of preMalHiPIP targeting argue against the involvement of SecA in the targeting of preHoloHiPIP, suggesting that the ATP dependence may be due to another factor, which is required in the case of the correctly folded substrate only. However, SecA inhibition by azide is very leaky in vitro and therefore we do not rule out at this stage that SecA may be involved in the ATP-dependent targeting step of folded HiPIP. Thus, the molecular nature of the protein factor(s) required for preHoloHiPIP membrane insertion remains to be deter- mined. Does membrane targeting occur before the translocation? The fact that the twin arginine motif and the known Tat- system components are not required for membrane inser- tion of preHoloHiPIP indicates that the insertion process seen here is not confined to Tat substrates. If Tat substrates such as preHoloHiPIP are among the natural substrates of this membrane-targeting pathway, then Tat-substrate recognition and translocation by specific Tat-system compo- nents must occur after membrane insertion, and what we observe in vitro is the accumulation of the targeting intermediate in the membrane. This hypothesis has to be taken into consideration, because (a) HiPIP is a Tat substrate in vivo (Fig. 2), (b) membrane targeting is adapted to the folded state of the protein with an ATP-consuming step (Fig. 7), (c) Tat-independent membrane targeting of Tat substrates in vivo has been documented previously [8,44], and (d) translocation after membrane targeting has been described for the thylakoidal system [45]. As no in vitro translocation of folded and cofactor-containing natural Tat substrates could be demonstrated so far, we do not exclude the alternative that the observed membrane targeting may not be coupled to translocation. In this case, the data would suggest that there exists a pathway for the biogenesis of membrane proteins, which are allowed to fold before membrane targeting. In summary, we found that preHoloHiPIP can be inserted into the cytoplasmic membrane and that only correctly folded preHoloHiPIP requires ATP for this process. To our knowledge, this is the first description of membrane targeting of a [4Fe)4S] cluster-containing folded protein. This mem- brane-targeting pathway may be of importance for the biogenesis of membrane-bound redox proteins or for the targeting of folded Tat substrates. The molecular basis of this process is currently under investigation. Acknowledgements We are grateful to Tracy Palmer for providing us with various Tat deletion mutants and to Ute Lindenstrauß for excellent technical assistance. We are indebted to Jan R. Andreesen, Donna M. Gordon, Bo Hou, Ralf Bernd Klo ¨ sgen, Debkumar Pain, Mecky Pohlschro ¨ der, Philip Rea and Carsten Sanders for many valuable discussions and help. This work was supported by grants DOE 91ER20052 and NIH GM38237 to F. D. and by grant BMBF-LPD 9901/8-14 from the German Academy of Natural Scientists Leopoldina to T. B. References 1. Pugsley, A.P. (1993) The complete general secretory pathway in Gram-negative bacteria. Microbiol. Rev. 57, 50–108. 2. Berks, B.C., Sargent, F. & Palmer, T. (2000) The Tat protein export pathway. Mol. Microbiol. 35, 260–274. 3. Mu ¨ ller, M., Koch, H G., Beck, K. & Scha ¨ fer, U. (2001) Protein traffic in bacteria: multiple routes from the ribosome to and across the membrane. Prog. Nucleic Acid Res. 66, 107–157. 4. Robinson, C. & Bolhuis, A. (2001) Protein targeting by the twin arginine translocation pathway. Nat. Rev. Mol. Cell. Biol. 2, 350–356. 5. Wexler,M.,Sargent,F.,Jack,R.L.,Stanley,N.R.,Bogsch,E.G., Robinson, C., Berks, B.C. & Palmer, T. (2000) TatD is a cyto- plasmic protein with DNase activity. J. Biol. Chem. 275, 16717– 16722. 6. Sargent, F., Bogsch, E.G., Stanley, N.R., Wexler, M., Robinson, C., Berks, B.C. & Palmer, T. (1998) Overlapping functions of components of a bacterial Sec-independent protein export path- way. J. Biol. Chem. 274, 36073–36082. 7. Sargent, F., Gohlke, U., de Leeuw, E., Stanley, N., Palmer, T., Saibil, H.R. & Berks, B.C. (2001) Purified components of the Escherichia coli Tat protein transport system form a double- layered ring structure. Eur. J. Biochem. 268, 3361–3367. 8. Bolhuis, A., Mathers, J.E., Thomas, J.D., Barrett, C.M.L. & Robinson, C. (2001) TatB and TatC form a functional and structural unit of the twin-arginine translocase from Escherichia coli. J. Biol. Chem. 276, 20213–20219. 9. Stanley, N.R., Palmer, T. & Berks, B.C. (2000) The twin arginine consensus motif of tat signal peptides is involved in Sec-independent 1220 T. Bru ¨ ser et al.(Eur. J. Biochem. 270) Ó FEBS 2003 [...]... translocation of bacterial ¨ proteins across the plasma membrane of Escherichia coli Proc Natl Acad Sci USA 81, 7421–7425 29 Watanabe, M & Blobel, G (1989) Binding of a soluble factor of Escherichia coli to preproteins does not require ATP and appears to be the first step in protein export Proc Natl Acad Sci USA 86, 2248–2252 30 Laemmli, U.K (1970) Cleavage of structural proteins during the assembly of. .. vinosum Biochim Biophys Acta 1352, 18–22 Natarajan, K & Cowan, J .A (1997) Identification of a key intermediate of relevance to iron-sulphur cluster biosynthesis mechanism of cluster assembly and implications for protein folding J Am Chem Soc 119, 4082–4083 Bogsch, E.G., Sargent, F., Stanley, N.R., Berks, B.C., Robinson, C & Palmer, T (1998) An essential component of a novel bacterial protein export system... (2000) Biogenesis of iron-sulfur proteins ¨ in eukaryotes: a novel task of mitochondria that is inherited from bacteria Biochim Biophys Acta 1459, 370–382 Sanders, C., Wethkamp, N & Lill, H (2001) Transport of cytochrome c derivatives by the bacterial Tat protein translocation system Mol Microbiol 41, 241–246 Yahr, T.L & Wickner, W.T (2001) Functional reconstitution of bacterial Tat translocation in vitro... efficient export of NADP-containing glucosefructose oxidoreductase to the periplasm of Zymomonas mobilis depends both on an intact twin-arginine motif in the signal peptide and on the generation of a structural export signal induced by cofactor binding Eur J Biochem 263, 543–551 36 Agarwal, A. , Tan, J., Eren, M., Tevelev, A. , Lui, S.M & Cowan, J .A (1993) Synthesis, cloning and expression of a synthetic... for protein translocation by a novel Sec-independent pathway in Escherichia coli FEMS Microbiol Lett 164, 329–336 Santini, C.-L., Bernadac, A. , Zhang, A. , Ize, B., Blanco, C & Wu, L.-F (2001) Translocation of jellyfish green fluorescent protein via the Tat system of Escherichia coli and change of its periplasmic localization in response to osmotic up-shock J Biol Chem 276, 8159–8164 Thomas, J.D., Daniel,... potential iron protein from Chromatium vinosum Biochem Biophys Res Commun 197, 1357–1362 37 Blaudeck, N., Sprenger, G .A. , Freudl, R & Wiegert, T (2001) Specificity of signal peptide recognition in tat-dependent bacterial protein translocation J Bacteriol 183, 604–610 38 Bertini, I., Cowan, J .A. , Luchinat, C., Natarajan, K & Piccoli, M (1997) characterization of a partially unfolded high potential iron protein. .. 1–8 Alami, M., Trescher, D., Wu, L.F & Muller, M (2002) Separate ¨ analysis of twin-arginine translocation (Tat)-specific membrane binding and translocation in Escherichia coli J Biol Chem 277, 20499–20503 Carter, C.W., Kraut, J., Freer, S.T., Xuong, N.-H., Alden, R .A & Bartsch, R.G (1974) Two-Angstrom crystal structure of oxidized Chromatium high potential iron protein J Biol Chem 249, 4212– 4225 Banci,... with homologues in plastids and mitochondria J Biol Chem 273, 18003–18006 Bolhuis, A. , Bogsch, E.G & Robinson, C (2000) Subunit interactions in the twin-arginine translocase complex of Escherichia coli FEBS Lett 472, 88–92 Membrane targeting of HiPIP (Eur J Biochem 270) 1221 27 Landers, J.W & Zak, B (1958) Determination of serum copper and iron in a single small sample Am J Clin Pathol 29, 590–592 28... Thomas, J.D., Daniel, R .A. , Errington, J & Robinson, C (2001) Export of active green fluorescent protein to the periplasm by the twin-arginine translocase (Tat) pathway in Escherichia coli Mol Microbiol 39, 47–53 Rodrigue, A. , Chanal, A. , Beck, K., Muller, M & Wu, L.-F ¨ (1999) Co-translocation of a periplasmic enzyme complex by a hitchhiker mechanism through the bacterial Tat pathway J Biol Chem 274, 13223–13228... 25 26 protein targeting in Escherichia coli J Biol Chem 275, 11591– 11596 Hinsley, A. P., Stanley, N.R., Palmer, T & Berks, B.C (2001) A naturally occurring bacterial Tat signal peptide lacking one of the ÔinvariantÕ arginine residues of the consensus targeting motif FEBS Lett 497, 45–49 ´ Cristobal, S., de Gier, J.-W., Nielsen, H & von Heijne, G (1999) Compeition between Sec- and Tat-dependent protein . 5¢-CATCACTTTGACAGCGTCTTTCTTGCTC TTGCTGATTGGCTTATCG-3¢ and 5¢-CGATAAGCCA ATCAGCAAGAGCAAGAAAGACGCTGTCAAAGTG ATG-3¢ using the QuikChange kit (Stratagene) with pCVH1 as a template. The RRfiKK exchanges were confirmed. couples 5¢-AAGAGC AAGAAAGACGCTGTCAAAGTGATG-3¢/5¢-TCCGG ATATAGTTCCTCCT-3¢ and 5¢-ACGTTACTGGTTTC ACATTC-3¢/5¢-AGCGTCTTTCTTGCTCTTGCTGATT GGCTT-3¢ to generate two