Growth hormone/JAK-STAT axis signal-transduction defect A novel treatable cause of growth failure Andrea P Rojas-Gil1, Panos G Ziros2, Leonor Diaz2, Dimitris Kletsas3, Efthimia K Basdra4, Theodore K Alexandrides5, Zvi Zadik6, Stuart J Frank7, Vassiliki Papathanassopoulou1, Nicholas G Beratis1, Athanasios G Papavassiliou2 and Bessie E Spiliotis1 Division of Pediatric Endocrinology, Department of Pediatrics, University of Patras School of Medicine, Greece Department of Biochemistry, University of Patras School of Medicine, Greece Institute of Biology, NCSR ‘Demokritos’, Athens, Greece Department of Orthodontics, Aristotle University of Thessaloniki, Greece Division of Endocrinology, Department of Internal Medicine, University of Patras School of Medicine, Greece Division of Pediatric Endocrinology, Department of Pediatrics, Kaplan Medical Center, Rehovot, Israel Department of Medicine, Division of Endocrinology, Diabetes and Metabolism, University of Alabama at Birmingham and Endocrinology Section, Medical Service, Veterans Affairs Medical Center, AL, USA Keywords growth hormone; growth hormone receptor; insulin-like growth factor; idiopathic short stature; signal transducer and activator of transcription-3 Correspondence B E Spiliotis, Division of Pediatric Endocrinology, Department of Pediatrics, University of Patras School of Medicine, 26504 Rio-Patras, Greece Fax: +30 2610 910869 Tel: +30 2610 999544 E-mail: besspil@endo.gr A G Papavassiliou, Department of Biochemistry, School of Medicine, University of Patras, 26110 Rio-Patras, Greece Fax: +30 2610 996110 Tel: +30 2610 996144 E-mail: gpapavas@pat.forthnet.gr Primary cultured fibroblasts of four patients with idiopathic short stature and severe growth delay, which displayed normal growth hormone receptor expression presented a reduced ability for activation of signal transducer and activator of transcription-3 (STAT3) Impaired STAT3 activation was accompanied by cell-cycle arrest at the Go ⁄ G1 phase Increased levels of the cyclin-dependent kinase inhibitor, p21WAF ⁄ CIPI, and reduced levels of cyclins were also detected in these patients High concentrations of human growth hormone (1000 ngỈmL)1) added to the culture medium induced activation of STAT3 and reduced the levels of p21WAF ⁄ CIPI in the fibroblasts of the four idiopathic short stature children Treatment of these children with exogenous human growth hormone significantly augmented their growth velocity Overall, our study provides the first evidence linking the idiopathic short stature phenotype with a functional aberration in the growth hormone signal transduction cascade which can be successfully overcome by exposure to high doses of growth hormone (Received 13 March 2006, revised 30 April 2006, accepted 31 May 2006) doi:10.1111/j.1742-4658.2006.05347.x Idiopathic short stature (ISS) in children is characterized by a normal or retarded growth velocity, a height more than two standard deviations below the mean, a normal birth weight, an absence of endocrine abnormalities and no evidence of physical or psychological disease [1] When growth velocity is retarded, however, Abbreviations BrdU, 5-bromo-2¢-deoxyuridine-5¢-monophosphate; CDK, cyclin-dependent kinase; FACS, fluorescence-activated cell sorter; GH, growth hormone; GHIS, growth hormone insensitivity syndrome; GHR, growth hormone receptor; IGF-I, insulin-like growth factor-I; IFN-b, interferon-b; ISS, idiopathic short stature; JAK, Janus tyrosine kinase; STAT, signal transducer and activator of transcription 3454 FEBS Journal 273 (2006) 3454–3466 ª 2006 The Authors Journal compilation ª 2006 FEBS GH ⁄ JAK-STAT axis signal-transduction defect A P Rojas-Gil et al it is important that growth hormone (GH) deficiency has been completely ruled out before the child is diagnosed as having ISS This is because GH is crucial not only for skeletal growth, but also for the homeostasis of proteins, lipids and carbohydrates as well as for water–electrolyte balance, and its deficiency can cause metabolic problems [2] GH deficiency is diagnosed by the use of pharmacologic agents that stimulate GH release from the pituitary gland and by the evaluation of spontaneous 24-h GH secretion [3,4] GH insensitivity syndrome (GHIS) is another cause of significant short stature with retarded growth velocity that may be mistakenly diagnosed as ISS In GHIS, there are normal or elevated GH serum concentrations because of a GH receptor (GHR) or postreceptor defect, and exogenous human growth hormone (hGH) therapy fails to increase the abnormally low insulin-like growth factor-I (IGF-I) concentrations that are present Exogenous hGH therapy is also incapable of increasing the retarded growth velocity of the GHIS children The majority of patients with GHIS have low GH-binding protein concentrations due to mutations or deletions in the GHR gene [5–7], although mutations in this gene can also be seen in GHIS patients with normal or elevated GH-binding protein levels [8–14] Recently, a patient with GHIS was found to have a homozygous missense mutation in the gene for the signal transducer and activator of transcription (STAT) 5b [15], which plays a crucial role in the GHinduced activation of IGF-I [16,17] The growth-promoting and metabolic actions of GH are mediated through activation of the GH-signal transduction pathway When a GH molecule binds to a dimer of the GHR, it stimulates the receptorassociated Janus tyrosine kinase-2 (JAK2) [18] JAK2, in turn, phosphorylates itself and the GHR and subsequently STAT1, -3 and -5, which dimerize and translocate to the nucleus to activate the transcription of target genes [19] STATs play an important role in regulating cell-cycle progression [20] JAK2 also phosphorylates and potentiates the mitogen-activated protein kinase and phosphatidylinositol-3 kinase cascades, which together with the STATs mediate the cellular effects of GH [21] This study was undertaken to explore the GH cellsignaling axis in a group of ISS children with severe growth failure, who had a normal GH response to pharmacologic stimuli, normal spontaneous 24-h GH secretion and a normal increase in their abnormally low serum IGF-I concentrations after hGH administration GHIS and bioinactive GH were further excluded by sequencing the GHR and GH-1 genes Our analyses suggest a novel molecular defect that appears to be responsible for these children’s growth failure Results Sequencing of the GHR and GH-1 genes Mutations of the GHR or GH-1 genes in the heterozygous state have been implicated in the pathogenesis of short stature [5,22] To exclude any abnormalities in the GHR or GH-1 genes, the affected children were screened for mutations in the above genes No abnormality was detected in any of the 10 exons of the GHR gene or the five exons and splice sites of the GH-1 gene, in any of the patients, by employing gene sequencing Expression of GHR The fact that no mutations were found in the GHR or GH-1 genes prompted us to investigate the signaltransduction pathway of GH To this end, fibroblast cultures were established from original gingival biopsies derived from four children with ISS (S) and three control children (C) To exclude any abnormalities of GHR at the transcriptional, post-transcriptional or translational level, we checked the expression of GHR in terms of mRNA and protein produced The S cells expressed GHR mRNA at levels similar to those of the C cells (Fig 1A) Both the C and the S fibroblasts yielded similar amounts of GHR by immunoprecipitation with an anti-GHR IgG Culturing the fibroblasts with 200 ngỈmL)1 hGH for and 15 min, resulted in a reduction in GHR levels in both the C and the S fibroblasts [23] (Fig 1B) Induction of the JAK/STAT pathway after cultivation with GH The next question was whether and to what extent the GH-transduction pathway is functional To answer this, the relative levels of activation (i.e tyrosine phosphorylation) of JAK2, STAT3 and STAT5 were examined Activation of JAK2 and STAT5b, as monitored by western immunoblotting of total cell lysates (after culturing the cells in fetal bovine serum-free medium for 24 h and subsequently in medium containing 200 ngỈmL)1 hGH) employing specific anti-(phosphoTyr) IgG, was similar in the C and S fibroblasts (Fig 2) Normal expression of JAK2 and STAT5 was verified with antibodies specific for the nonphosphorylated form of each protein (data not shown) No defect FEBS Journal 273 (2006) 3454–3466 ª 2006 The Authors Journal compilation ª 2006 FEBS 3455 GH ⁄ JAK-STAT axis signal-transduction defect A P Rojas-Gil et al A No hGH F ib r o bl a s t S1 S2 S3 S4 C1 C2 RT GHR no-RT ACTIN B Fibroblast C1 hGH C2 15 C3 15 15 GHR (116KD) A C TI N S1 hGH S2 15 S3 15 S4 15 15 GHR (116KD) A CT I N Fig GHR expression in cultured fibroblasts from normal children (C) and children with idiopathic short stature (S) (A) PCR amplification of cDNA derived from four S (S1, S2, S3, S4) and two C (C1, C2) fibroblast cultures (In order to exclude genomic contamination PCR was also performed in the same RNA samples omitting the RT step.) Results are normalized according to the measurement of actin Data are the mean ± SD from three different experiments (B) GHR immunoprecipitation using an anti-GHR IgG in total cell lysates from four S (S1, S2, S3, S4) and three C (C1, C2, C3) fibroblast cultures starved for 24 h and subsequently stimulated with hGH (200 ngỈmL)1) for 0, and 15 In the histogram, the GHR levels of the nontreated cells normalized according to the measurement of actin are presented Data are the mean ± SD from three different experiments in the nonphosphorylated or phosphorylated STAT5b was found in the S fibroblasts (Fig 2) In contrast to the normal activation of JAK2 and STAT5 after the addition of 200 ngỈmL)1 hGH into the culture medium, hGH-induced Tyr phosphorylation of STAT3 was either absent or significantly decreased in the fibroblast cultures derived from the four S patients, when compared with the C fibroblasts (Figs 3A and 4) Differences in the expression levels of the nonphosphorylated STAT3 protein and unequal loading of the samples were excluded (Fig 3B,C) STAT3 activation by different concentrations of hGH From the clinical data it is evident that the S patients respond to pharmacological doses of GH and display increased growth velocities (Table 1) This led us to use higher doses of GH in the cell cultures of S cells, 3456 and to assess whether these high doses are capable of bypassing the block in STAT3 activation The C fibroblasts displayed a net increase in STAT3 phosphorylation when hGH was added to the culture medium at 200 and 500 ngỈmL)1, whereas STAT3 phosphorylation was almost completely suppressed at an hGH concentration of 1000 ngỈmL)1 By contrast, the S fibroblasts exhibited significantly low activation of STAT3 when hGH was added to the culture medium at concentrations up to 500 ngỈmL)1 There was a moderate increase, however, in the activation of STAT3 in all S fibroblasts after the addition of hGH at a concentration of 1000 ngỈmL)1 (Fig 4) STAT3 activation by interferon-b To confirm the specificity of STAT3 malfunctioning we sought to investigate the STAT3 activation in response to another stimulus, interferon (IFN)-b, which is FEBS Journal 273 (2006) 3454–3466 ª 2006 The Authors Journal compilation ª 2006 FEBS GH ⁄ JAK-STAT axis signal-transduction defect A P Rojas-Gil et al C1 C2 30 S1 30 S2 30 S3 30 S4 30 30 pJAK2 pSTAT5 TUBULIN Fig Phosphorylation of JAK2 and STAT5b Equal amounts of lysates from fibroblasts derived from four children with ISS (S) and two normal children (C), cultured in the absence or presence of hGH (200 ngỈmL)1) for 30 min, were subjected to western immunoblotting using a p-Tyr-JAK2 or a p-Tyr-STAT5b antibody The same membrane was stripped out and reprobed with an anti-tubulin serum (lower) Activation of JAK2 and STAT5 is depicted in the histogram Data were normalized according to the measurement of tubulin Data are the mean ± SD from three different experiments Fig STAT3 activation in S and C fibroblasts after stimulation with or without hGH (200 ngỈmL)1) for 30 Tyrosine phosphorylation of STAT3 (activation) was detected using specific anti-pTyr serum (A) To verify equal loading of the samples, the membrane was stripped out and reprobed with an anti-STAT3 serum (B) and subsequently with an anti-actin serum (C) S1 S2 S3 30 30 30 S4 C1 30 C2 30 C3 30 30 A pTyr STAT3 B STAT3 C ACTIN Table Growth velocities (GV) (mean ± SD) and height SDS of the S children with idiopathic short stature before and during hGH therapy GV ⁄ SDS n Before 1st Year 2nd Year 3rd Year 4th Year GV (cmỈ year)1) SDS 4 2.3 ± 0.6 3.1 ± 0.3 9.5 ± 0.2* 2.1 ± 0.3* 8.8 ± 1.0* 1.7 ± 0.2* 6.5 ± 0.7** 1.6 ± 0.1* 5.8 ± 0.3** 1.4 ± 0.2* Difference from pretreatment values: * p ¼ 0.001, ** p ¼ 0.005 known to signal through the same JAK ⁄ STAT pathway as GH [24] STAT3 Tyr phosphorylation was reduced in the four S fibroblast cultures in comparison with the C fibroblasts after induction with 100 mL)1 IFN-b Culturing of the C fibroblasts for 30 in the presence of a wide range of IFN-b concentrations (0– 1000 mL)1), elicited activation of STAT3 that was evident at 10 mL)1 and progressively increased with FEBS Journal 273 (2006) 3454–3466 ª 2006 The Authors Journal compilation ª 2006 FEBS 3457 GH ⁄ JAK-STAT axis signal-transduction defect S1 pTyr STAT3 S2 A P Rojas-Gil et al S3 S4 200 500 1000 200 500 1000 200 500 1000 200 500 1000 C 200 500 1000 ng hGH ACTIN Fig Dose-dependent activation of STAT3 in fibroblasts from four S and one C stimulated with increasing doses of hGH (200, 500 and 1000 ngỈmL)1) To verify equal loading of the samples, the membrane was stripped out and reprobed with an anti-actin serum Activation of STAT3 normalized according to the measurement of actin is depicted in the histogram Data are the mean ± SD from three different experiments the increase of the IFN-b dose (Fig 5A,B) In contrast, STAT3 Tyr phosphorylation was not apparent at lower doses (0, 0.1, and 10 mL)1) in the S fibroblast cultures in response to IFN-b, whereas it was slightly detectable in response to IFN-b at doses of 100 and 1000 mL)1 (Fig 5A,B) Sequencing of the STAT3 gene In order to exclude any defects in the STAT3 gene, children with aberrant STAT3 phosphorylation were screened for mutations in the above gene No abnormality was detected in any of the STAT3 coding regions of the four S children Effect of GH on p21WAF/CIP1 expression It has been shown that the cyclin-dependent kinase (CDK) inhibitor p21WAF ⁄ CIP1 impairs STAT3 transcriptional activation [25] It is also known that impaired STAT3 activation is associated with elevated p21 protein levels [26] Bearing that in mind, we investigated a putative link between the elevated p21 and the decreased STAT3 activation in the fibroblasts of the four S patients Expression of p21 was studied by western blotting after h starvation and subsequent induction with 200 ngỈmL)1 GH for 24 h The S fibroblasts (S1, S2, 3458 S3 and S4 cultures) displayed p21WAF ⁄ CIPI protein expression without GH induction, which was augmented after hGH stimulation (200 ngỈmL)1), compared with C fibroblasts (Fig 6A) Cultivation of the fibroblasts in the presence of 1000 ngỈmL)1 hGH, which induces STAT3 activation in the four S fibroblasts, reduced the expression level of the p21WAF ⁄ CIPI protein in the S cells (Fig 6A) Taking into account that the S fibroblasts had high p21WAF ⁄ CIPI protein levels, we wanted to investigate whether the over-expression of p21WAF ⁄ CIPI protein could induce the same phenotype in the C fibroblasts To this end, C fibroblasts were transiently transfected with an expression vector bearing the p21 gene or an empty vector and were subsequently stimulated with GH As shown in Fig 6B the over-expression of p21 does not influence the ability of GH to induce STAT3 activation in the C fibroblasts because no difference was observed between the cells over-expressing the p21 gene (lanes and 4) and those that did not (lanes and 3) Analysis of cell growth rates Increased amounts of p21 in the quaternary complex with cyclins, CDKs and proliferating cell nuclear antigen led to inhibition of DNA synthesis and cell-cycle arrest [27] STATs play an important role in controlling cell-cycle progression and apoptosis STAT3 FEBS Journal 273 (2006) 3454–3466 ª 2006 The Authors Journal compilation ª 2006 FEBS GH ⁄ JAK-STAT axis signal-transduction defect A P Rojas-Gil et al A 100 U/ml INF-β C2 C1 S1 S2 S3 S4 pTyr STAT3 TUBULIN B U/ml INF-β C1 0.1 S2 10 100 1000 0.1 10 100 1000 pTyr STAT3 TUBULIN Fig STAT3 activation after IFN-b stimulation in starved S and C fibroblasts (A) Detection of STAT3 phosphorylation after 30 stimulation with IFN-b (100 mL)1) Activation of STAT3 normalized according to the measurement of tubulin is depicted in the histogram Data are the mean ± SD from three different experiments (B) Detection of STAT3 phosphorylation in C and S fibroblasts stimulated for 30 with increasing doses of IFN-b (0–1000 mL)1) Activation of STAT3 normalized according to the measurement of tubulin is depicted in the histogram (1–6 are C1 fibroblasts and 7–12 are S2 fibroblasts.) The results are expressed as a relative difference as compared with untreated cells Data are the mean ± SD from three different experiments activation prevents apoptosis and promotes proliferative processes including cellular transformation [20] The impaired STAT3 activation and the concomitant increased p21 expression in the S cells prompted us to investigate the growth and cell-cycle state of the S cells The S cells grew at a slower rate compared to the C cells A large number of senescent cells were present in the S cultures already after the first passage They were characterized by an increased cell size and perinuclear autofluorescent aggregates The mean growth rate of the fibroblasts of the four S patients, as reflected by the growth curves of the cultures, was always lower than that of the C fibroblasts days after plating the cells (Fig 7A) Addition of increasing concentrations of hGH (200–500 ngỈmL)1) enhanced the growth rate of both the C and S fibroblasts Although greatly enhanced by the addition of hGH in the culture medium, the growth rate of the S fibroblasts always remained lower than that of the C cells (Fig 7B,C) The highest growth rate of the C fibroblasts was achieved with the addition of 200 ngỈmL)1 hGH (Fig 7B), whereas the S fibroblasts achieved the highest growth rate with the addition of 500 ngỈmL)1 hGH (Fig 7C) It is noteworthy that with the addition of 200 ngỈmL)1 hGH the growth curve plateau was reached after  days for both groups of cells, whereas with the addition of 500 ngỈmL)1 this plateau was not reached even after days The addition of 1000 ngỈmL)1 hGH caused a slight decrease in the growth rate of both the C and the S fibroblasts (Fig 7D), whereas the addition of hGH at 5000 ngỈmL)1 caused even greater suppression of both the C and the S fibroblasts (Fig 7E) Cell population doubling time and fold proliferation of the fibroblasts within 48 h were determined FEBS Journal 273 (2006) 3454–3466 ª 2006 The Authors Journal compilation ª 2006 FEBS 3459 GH ⁄ JAK-STAT axis signal-transduction defect A P Rojas-Gil et al A hGH F ib robla sts Without hGH S3 C1 C2 S1 S2 S4 P21WAF/CIPI ACTIN h GH F i b r o bl a s t s Fig Effect of hGH on the expression of p21WAF ⁄ CIP1 in normal (C) fibroblasts and fibroblasts from children with ISS and deficient phosphorylation of STAT3 (S) (A) Expression of p21WAF ⁄ CIP1 in C (C1, C2) and S (S1, S2, S3, S4) fibroblasts was monitored by western immunoblotting of cell lysates, after h of fetal bovine serum starvation and subsequent stimulation with hGH (0, 200 and 1000 ngỈmL)1) for 24 h Data were normalized according to the measurement of actin The results are expressed as a relative difference as compared with untreated cells Data are the mean ± SD from three different experiments (B) C fibroblasts were transfected with p21WAF ⁄ CIP1 (lanes and 4) or with an empty parental plasmid (lanes and 3) After 24 h, the medium was changed and the cells were starved for 24 h and subsequently stimulated with 200 ngỈmL)1 hGH for 30 STAT3 phosphorylation was monitored by western immunoblotting (first panel) Over-expression of p21WAF ⁄ CIP1 was confirmed by reprobing the membrane with anti-(p21WAF ⁄ CIP1)-specific IgG (second panel), and equal loading was verified by reprobing with an anti-STAT3 IgG hG H 20 ng /m l C1 C2 S1 S2 S3 S4 WAF/CIPI P21 ACTIN hG H 00 n g /m l h GH Fibr obl asts C1 C2 S2 S1 S4 S3 WAF/CIPI P21 ACTIN B - - GH pTyr STAT3 + + p21WAF/CIPI STAT3 S fibroblasts displayed a longer population doubling time than C fibroblasts (79.9 ± 11.0 and 1.5 ± 0.12 h, respectively) They also showed a lower fold proliferation than C fibroblasts within the same period (4.2 ± 0.23 and 16.55 ± 0.77 h, respectively) S fibroblasts also had a lower bromouridine (BrdU) incorporation into DNA than C fibroblasts A drastic inhibition in growth, as reflected by the percentage of DNA-synthesizing cells, was observed in all the S cultures (Fig 8A) The addition of different doses of hGH increased the percentage of DNA-synthesizing cells with the same kinetics in the C and S cells, albeit the differences between C and S cells were maintained (Fig 8A) The reduced incorporation of BrdU, which directly measures S-phase cells, suggests a defect in the G1 ⁄ S transition of S fibroblasts The latter was explored by fluorescence-activated cell sorting (FACS) analysis FACS analysis showed that 69 and 93% of the C and the S fibroblasts, respectively, resided in the Go ⁄ G1 phase of the cell cycle Addition of hGH (200 3460 and 1000 ngỈmL)1) decreased the percentage of S cells in the Go ⁄ G1 phase from 93 to 80 and 72%, respectively, whereas the percentage of the C cells was almost the same (from 69 to 76 and 70%, respectively) (Fig 8B) Low expression of the cell-cycle proteins, cyclin A, cyclin D and CDT1 was found in the S fibroblasts after h of fetal bovine serum starvation and 24-h stimulation with hGH (200 ngỈmL)1), when compared to the C cells (Fig 9) Discussion This is the first identification of a functional defect in the activation of STAT3 in the signal transduction pathway of GH in fibroblasts from children with ISS This defect is associated with a cell-cycle arrest at the Go ⁄ G1 phase, which is also reflected by increased levels of p21WAF ⁄ CIPI and reduced expression of cyclin A, cyclin D and CDT1 The defect does not appear to be specific to hGH stimulation, because IFN-b, a cytokine that also signals through the same JAK ⁄ STAT FEBS Journal 273 (2006) 3454–3466 ª 2006 The Authors Journal compilation ª 2006 FEBS GH ⁄ JAK-STAT axis signal-transduction defect A P Rojas-Gil et al Fold increas A ng/ml hGH 12 10 C 5.8 S 0.87 0 Days B C 200 ng/ml hGH 500 ng/ml hGH 15 10 9.92 5.56 C S Fold increas Fold increas 15 0 10 9.6 C S Days 1000 ng/ml hGH E 12 Fold increas 10 6.56 C 4.58 S 5000 ng/ml hGH 10 C S 3.5 0.5 0 Days Fold increas D 2 Days Days Fig Growth curves of fibroblast from four C children (Ô) and S children (n) cultured in the presence of increasing concentrations of hGH The growth of cells is during their exponential phase of growth and is expressed as the fold increase from the original number of cells (A) No hGH added, (B) hGH 200 ngỈmL)1, (C) hGH 500 ngỈmL)1, (D) hGH 1000 ngỈmL)1 and 5000 ngỈmL)1 Each point is the mean ± SD from three different experiments axis, had similar defective activation of STAT3 in the cultured fibroblasts of the affected children This result further strengthens the notion that the observed defect in these children resides at the postreceptor level It is noteworthy that the defect in the activation of STAT3 in cultured fibroblasts from the four ISS patients was overcome by exposing the cells to high concentrations of hGH Moreover, administration of exogenous hGH to the ISS patients during the 5-day IGF-I generation test as well as during the years of hGH therapy, increased the low serum IGF-I concentrations to normal levels Accordingly, the children’s growth velocities increased substantially showing significant ‘catch-up’ growth during the years of hGH therapy The regulation of IGF-I expression by GH has been documented in many tissues, including hepatocytes, chondrocytes, glioma cells and muscle cells [28,29], whereas much less is known about the action of hGH on cultured fibroblasts [30] The role of STAT5 in IGF-I production is well established, whereas that of STAT3 in GH-induced IGF-I expression was just recently shown in C2C12 myoblasts, whereby STAT3 is involved in the induction of IGF-I mRNA via GH-ignited JAK3 signaling [28] The predominant JAK associated with GHR is JAK2, although GH has been reported to evoke Tyr phosphorylation of JAK1 and JAK3 as well [21,31] A possible explanation for the ability of high concentrations of hGH to increase STAT3 phosphorylation in the fibroblasts of the four ISS patients studied, could be through the induction of alternative pathways engaging JAK1, JAK3 or the epidermal growth factor receptor [21,23,30,31] Activation of STAT3 has been correlated with positive regulation of cell growth, and is highly augmented in cancer cells [20,32] STAT3 also plays a pivotal role in the G1 to S-phase transition, through upregulation of cyclins A and D and the cyclin-dependent kinase-25 (cdk25), and the concomitant downregulation of the CDK inhibitor p21WAF ⁄ CIPI [33] In agreement with previous reports, the prospect that the primary defect FEBS Journal 273 (2006) 3454–3466 ª 2006 The Authors Journal compilation ª 2006 FEBS 3461 GH ⁄ JAK-STAT axis signal-transduction defect A % BrdU incorporating cells B C A P Rojas-Gil et al S 60 50 40 30 20 10 0 200 500 1000 5000 ng/ml hGH C C 200 500 1000 5000 ng/ml hGH S 120 % of Cells 100 80 60 40 20 implicated in exerting a negative control on STAT3 [25], the hypothesis that the STAT3-impaired activation might be a consequence of p21WAF ⁄ CIPI upregulation was explored by over-expressing p21WAF ⁄ CIPI in normal fibroblasts cultivated under high concentrations of hGH and examining the effect on STAT3 activation The fact that no defect in STAT3 activation after over-expression of p21WAF ⁄ CIPI was observed, excludes this possibility Collectively, our findings suggest a novel defect of impaired activation of STAT3 in cultured fibroblasts of children with ISS that exhibit severe growth delay The impaired STAT3 activation was corrected in vitro by culturing the fibroblasts in medium supplemented with high concentrations of hGH Moreover, the growth failure of these children was successfully treated with exogenous hGH We propose that this new clinical entity be named ‘growth hormone transduction defect’ (GHTD) The exact molecular ‘coordinates’ of the defect underlying the impaired STAT3 activation in GHTD remain uncertain at this stage Further studies are necessary to shed light on the possible impact of this defect of GH-mediated signal transduction on other GH-driven actions, besides growth, such as its effect on the metabolism of proteins, lipids and carbohydrates as well as on the immune system C S C S 200 S C 1000 Experimental procedures hGH ng/ml Fig (A) DNA synthesis assay of S and C fibroblast Cultures of the second passage of these cells were labeled by BrdU without GH and monitored with immunofluorescence (B) BrDU colorimetric ELISA of S and C fibroblasts induced with various doses of hGH (200 ngỈmL)1, 500 ngỈmL)1, lgỈmL)1 and lgỈmL)1) Values are the mean of four patients and four controls, standard deviation was calculated for each time point Each experiment was performed three times (C) Cell-cycle analysis of four S and four C fibroblasts cultured in the absence or presence of hGH (200 and 1000 ngỈmL)1) was performed using FACS Open bars, G0 ⁄ G1; black bars, G2 ⁄ M; grey bars, S phase The values are the means of each group of samples (S and C) The results are expressed as mean ± SD from three different experiments in our patients resides at the level of STAT3 activation is further supported by the fact that the S fibroblasts displayed an elevated expression of p21WAF ⁄ CIPI and low levels of cyclins A and D In addition, as expected, impaired STAT3 activation was accompanied by cellcycle arrest Notably, high concentrations of hGH in the culture medium restored the activation of STAT3 and, at the same time, downregulated the expression levels of p21WAF ⁄ CIPI Because p21WAF ⁄ CIPI has been 3462 Subjects The study group (S) comprised four prepubertal children (9.4–10.3 years of age), with severe growth failure (height standard deviation scores 2.96 ± 0.30), bone age retardation ()3.4 ± 0.5 years) and abnormally low serum IGF-I concentrations (60 ± ngỈmL)1) The control group (C) included three prepubertal age-matched children of normal stature All children were recruited from the outpatient clinic of the Pediatric Endocrine Division of the University Hospital of Patras, Greece The S children had normal peak GH concentrations after provocation with the pharmacologic agents clonidine (22.3 ± 4.3 ngỈmL)1) and levo-Dopa (13.7 ± 1.9 ngỈmL)1) They also had normal 24-h spontaneous GH secretion (mean 24-h GH: 4.0 ± 0.13 ngỈmL)1 and 24-h GH secretion rate: 240 ± 12 lgỈ L)1Ỉ24 )1h), compared with 54 normal prepubertal control children (mean 24-h GH: 3.97 ± 0.18 ngỈmL)1 and 24-h GH secretion rate: 231 ± 15 lgỈL)1Ỉ24 )1h) from the Division of Pediatric Endocrinology, Department of Pediatrics, Kaplan Medical Center, Rehovot, Israel All four ISS children had a normal increase of their abnormally low IGF-I concentrations during a 5-day IGF-I generation test (baseline IGF-I: FEBS Journal 273 (2006) 3454–3466 ª 2006 The Authors Journal compilation ª 2006 FEBS GH ⁄ JAK-STAT axis signal-transduction defect A P Rojas-Gil et al C1 C2 S1 S2 S3 S4 Cyclin A ACTIN C1 C2 S1 S2 S3 S4 Cyclin D ACTIN Fig Effect of hGH on the expression of cyclin A, cyclin D and CDT1 in normal fibroblasts (C) and fibroblasts from children with ISS and deficient phosphorylation of STAT3 (S), as monitored by western immunoblotting of h starved cells and subsequent stimulated with hGH (200 ngỈmL)1) for 24 h Equal loading of the samples was verified by stripping the membrane and reprobing with a specific anti-actin serum Data were normalized according to the measurement of actin Data are the mean ± SD from three different experiments C1 C2 S1 S2 S3 S4 CDT1 ACTIN 60 ± ngỈmL)1; peak IGF-I: 280 ± 20 ngỈmL)1), compared with 15 normal prepubertal control children (baseline IGF-I: 148 ± ngỈmL)1; peak IGF-I: 287 ± 11 ngỈnL)1) from the Pediatric Endocrine Division of the University Hospital of Patras, Patras, Greece Because of the vigorous increase in the low IGF-I concentrations during the IGF-I generation test, the S patients were treated daily with exogenous hGH (0.03 mgỈkg)1Ỉ day)1) for years All four S patients showed a significant increase in their growth velocities and height SDS following the long-term exogenous hGH therapy (Table 1) and they maintained their serum IGF-I concentrations at normal levels over all years of hGH therapy Informed parental consent and children’s assent were obtained in all cases The study was approved by the Ethics Committee of the University Hospital of Patras Analysis of genomic DNA for GH and GHR mutations Genomic DNA was isolated from peripheral blood leukocytes for the analysis of the GH-1 gene and was amplified using PCR, with three pairs of oligonucleotide primers, according to Takahashi et al [22] GHR individual exons 2–10 were amplified by PCR using primers complementary to flanking intronic sequences, as described previously [11,12] PCR products were recovered from 1% agarose gel using the Macherey Nagel kit (Macherey-Nagel Inc., Easton, PA), and sequencing was performed by the MWGBiotech AG sequencing service (Ebersberg, Germany) Cell cultures Fibroblast cultures were established from gingival biopsies obtained from the four S and three C children Tissue pieces (0.5–1.0 mm3; 2–3 pieces per dish) were plated onto 60-mm2 culture dishes in Dulbecco’s modified Eagle’s medium, supplemented with 10% fetal bovine serum, mm l-glutamine, 50 ImL)1 penicillin and 50 lgỈmL)1 streptomycin (Gibco, Carlsbad, CA), and incubated at 37 °C in 5% CO2 atmosphere Cultures were replenished with fresh medium every days and then subcultivated in a : split ratio upon reaching confluency by using a trypsin ⁄ EDTA solution (Gibco) All experiments were FEBS Journal 273 (2006) 3454–3466 ª 2006 The Authors Journal compilation ª 2006 FEBS 3463 GH ⁄ JAK-STAT axis signal-transduction defect A P Rojas-Gil et al carried out with cultured fibroblasts between the second to sixth passages GH induction Cell cultures at ~ 80% confluency were washed twice with NaCl ⁄ Pi and maintained for or 24 h in serum-free Dulbecco’s modified Eagle’s medium and then treated with various concentrations of hGH (200, 500 and 1000 ngỈmL)1) Subsequently, the cells were washed with ice-cold NaCl ⁄ Pi, harvested by scraping and centrifuged The cell pellets were snap-frozen and stored in liquid nitrogen until further use For the STAT3 activation experiments, the S and C fibroblasts were cultured in the absence of fetal bovine serum for 24 h and subsequently stimulated with hGH (200, 500 and 1000 ngỈmL)1) for 30 p21WAF ⁄ CIPI expression was assessed in cultured fibroblasts that were fetal bovine serum-starved for h and then cultivated in the presence of hGH (200 and 1000 ngỈmL)1) for 24 h IFN-b induction The specificity of the defective Tyr phosphorylation of STAT3 in response to hGH in the S fibroblasts was tested by the induction of STAT3 phosphorylation with IFN-b The fibroblasts were cultured in the presence of a wide range of IFN-b concentrations (0–1000 mL)1) for 30 Immunoprecipitation Equal amounts of all cell extracts (200 lg of protein) from fibroblasts cultured in the absence or presence of hGH (200 ngỈmL)1) for 15 and 30 min, were subjected to immunoprecipitation with an anti-GHR IgG against an overlapping cytoplasmic domain of hGHR (GHR AL-37) [23] The immunocomplexes were resolved by SDS ⁄ PAGE, electrotransferred onto poly(vinylidene difluoride) membranes and the blot was probed with an polyclonal anti-(GHR rabbit IgG) serum The same membrane was stripped out and reprobed with an anti-actin IgG Determination of the fibroblasts’ proliferative capacity RT-PCR Total RNA was prepared with Trizol reagent (Invitrogen, Grand Island, NY) according to the manufacturer’s instructions from near-confluent cultured fibroblasts Preparation of cDNA from total RNA was performed using a Reverse Transcription System (Thermoscrip RT, Invitrogen) Human GHR was amplified from cDNA with primers ACACTCAAGAATGGACTCAAG and TGTAAATTGG CTCATCTGAG under the following conditions: denaturation at 95 °C for min, annealing at 52 °C for min, extension at 72 °C for min, for 40 cycles All samples were treated with DNAse A and the RT-PCR reaction was checked for contaminating genomic DNA by omitting the RT Western immunoblotting Western blotting was performed as described previously [14] For the analysis of GHR expression in the lysis buffer, 1% deoxycholate was added The following dilutions and incubation times were employed for each individual IgG: anti-GHR (University of Alabama at Birmingham, AL; : 800, overnight, °C), anti-(pTyr-STAT5b) (Cell Signalling Technology, Inc., Danvers, MA; : 500, 3464 overnight, °C), anti-STAT3 (Santa Cruz Biotechnology, Santa Cruz, CA; : 1000, h, room temperature), anti-p21 (Transduction Laboratories, Lexington, KY; : 500, overnight, °C), anti-(cyclin A) (SantaCruz Biotechnology; : 1000, overnight, °C), anti-CDT1 (a gift from Z Lygerou, University of Patras, Patras, Greece; : 500, overnight, °C) Two anti-(pTyr-STAT3) IgG were used; one from Cell Signalling Technology, Inc at a dilution of : 500, overnight at °C, and the other from Upstate USA (Waltham, MA) at a dilution of : 1000, overnight at °C Quantification of the western signals (complexed protein bands) was performed using the image analysis program, image-pro plus (version 4.5, Media Cybernetics, Inc., Silver Spring, MD) Cells were suspended in Dulbecco’s modified Eagle’s medium supplemented with 10% fetal bovine serum and plated at a density of 10 000 cellsỈcm)2; they were supplemented with fresh medium every days Cells were detached, suspended in culture medium and counted at 24 and 72 h after plating, while cultures were still at the exponential phase of growth To determine the growth curves, · 104 cells were plated onto six-well plates, without hGH or at hGH concentrations of 200, 500, 1000 and 5000 ngỈmL)1 Over days, the cells were trypsinized and counted using a hematocytometer Cell-cycle analysis Fibroblasts were plated at a density of 104 cells per plate in Dulbecco’s modified Eagle’s medium with 10% fetal bovine serum Control fibroblasts were harvested after culturing for 72 h Alternatively, cells were fetal bovine serum-starved for h and then treated with hGH (200 or 1000 ngỈmL)1) Cells were collected by trypsinization, fixed in 70% ice-cold ethanol and stained with an RNAse-containing propidium iodide solution Cell-cycle analysis was performed on a FACS calibre flow cytome- FEBS Journal 273 (2006) 3454–3466 ª 2006 The Authors Journal compilation ª 2006 FEBS GH ⁄ JAK-STAT axis signal-transduction defect A P Rojas-Gil et al ter (Becton Dickinson, San Jose, CA) employing the modfit software (Verity Software House, Topsham, ME) The data were analyzed by using the spss program (SPSS Inc., Chicago, IL) BrdU incorporation To study the effect of GH on the proliferation of the fibroblasts, we measured the BrdU incorporation into the cells For BrdU labeling, 104 cells were plated on ELISA plates and cultivated in Dulbecco’s modified Eagle’s medium supplemented with 10% fetal bovine serum medium with or without hGH (0, 200, 500, 1000 and 5000 ngỈmL)1) for 72 h Subsequently, cells were incubated in the presence of lgỈmL)1 BrdU (Roche, Mannheim, Germany) at 37 °C and after h, ELISA colorimetric assay (Roche) was performed Analysis of the cDNA for STAT3 Total RNA was prepared with the Trizol reagent from peripheral blood leukocytes Preparation of cDNA from total RNA was performed using an RT System (Thermoscript RT, Invitrogen) Human STAT3 was amplified from cDNA with specific primers (STAT3 R: TAGGCGCCTCA GTCGTATCT and STAT3 F: AGCATCGAGCAGCT GACTAC), under the following conditions: denaturation at 95 °C for min, annealing at 58 °C for and extension at 72 °C for min, for 35 cycles Cloning of p21WAF/CIPI and transfections Human p21WAF ⁄ CIPI cDNA derived from the C children was amplified using the following primers: GGAAAT CATGTCAGAACCGGC and CTAGCTAGCTTAGGGC TTCCTCTTGGA Subsequently, it was cloned into the EcoRI ⁄ NheI sites of the pCMX-F plasmid Transient transfections were performed by using a Lipofectamine 2000 kit (Invitrogen) and were repeated at least three times The amount of transfected DNA was kept constant by the addition of appropriate amounts of the parental, empty expression vector Acknowledgements This work was supported by the NIH grant DK 46395 (to SJF) and in part by Novo Nordisk, Hellas References Ranke MB (1996) Towards a consensus on the definition of idiopathic short stature Hormone Res 45, 64–66 Carter-Su C (1996) Molecular mechanism of growth hormone action Annu Rev Physiol 58, 187–207 Spiliotis BE, August D, Hung W, Sonis W, Mendelson W & Bercu BB (1984) Growth hormone neurosecretory dysfunction: a treatable cause of short stature JAMA 251, 2223–2230 Bercu BB, Shulman D, Root AW & Spiliotis BE (1986) Growth hormone (GH) provocative testing frequently does not reflect endogenous GH secretion J Clin Endocrinol Metab 63, 709–716 Rosenfeld RG, Rosebloom AL & Guevara Aguirre J (1994) Growth hormone (GH) insensitivity due to primary GH receptor deficiency Endocrin Rev 15, 369–390 Woods KA, Dastot F, Preece MA, Clark AJ, PostelVinay MC, Chatelain PG, Ranke MB, Rosenfeld RG, Amselem S & Savage MO (1997) Phenotype: genotype relationships in growth hormone insensitivity syndrome J Clin Endocrinol Metab 82, 3529–3535 Wojcik J, Berg MA, Esposito N, Geffner ME, Sakati N, Reiter EO, Dower S, Francke U, Postel-Vinay MC & Finidori J (1998) Four continuous amino acid substitutions identified in patients with Laron syndrome differently affect the binding affinity and intracellular trafficking of the growth hormone receptor J Clin Endocrinol Metab 83, 4481–4489 Burren CP, Woods KA, Rose SJ, Tauber M, Price DA, Heinrich U, Gilli G, Razzaghy-Azar M, Al-Ashwal A, Crock PA et al (2001) Clinical and endocrine characteristics in atypical and classical growth hormone insensitivity syndrome Hormone Res 55, 125–130 Amit T, Youdim MB & Hochberg Z (2000) Clinical review 112: does serum growth hormone (GH) binding protein reflect human GH receptor function? J Clin Endocrinol Metab 85, 927–932 10 Duquesnoy P, Sobrier ML, Duriez B, Dastot F, Buchanan CR, Savage MO, Preece MA, Craescu CT, Blouquit Y & Goossens M (1994) A single amino acid substitution in the exoplasmic domain of the human growth hormone (GH) receptor confers familial GH resistance (Laron syndrome) with positive GH-binding activity by abolishing receptor homodimerization EMBO J 13, 1386–1395 11 Woods KA, Fraser NC, Postel-Vinay MC, Savage MO & Clark AJ (1996) A homozygous splice site mutation affecting the intracellular domain of the growth hormone (GH) receptor resulting in Laron syndrome with elevated GH-binding protein J Clin Endocrinol Metab 81, 1686–1690 12 Iida K, Takahashi Y, Kaji H, Takahashi MO, Okimura Y, Nose O, Abe H & Chihara K (1999) Functional characterization of truncated growth hormone (GH) receptor (1–277) causing partial GH insensitivity syndrome with high GH-binding protein J Clin Endocrinol Metab 84, 1011–1016 FEBS Journal 273 (2006) 3454–3466 ª 2006 The Authors Journal compilation ª 2006 FEBS 3465 GH ⁄ JAK-STAT axis signal-transduction defect A P Rojas-Gil et al 13 Ayling RM, Ross R, Towner P, Von Laue S, Finidori J, Moutoussamy S, Buchanan CR, Clayton PE & Norman MR (1997) A dominant-negative mutation of the growth hormone receptor causes familial short stature Nat Genet 16, 13–14 14 Freeth JS, Silva CM, Whatmore AJ & Clayton PE (1998) Activation of the signal transducers and activators of transcription signaling pathway by growth hormone (GH) in skin fibroblasts from normal and GH binding protein-positive Laron syndrome children Endocrinology 139, 20–28 15 Kofoed EM, Hwa V, Little B, Woods KA, Buckway CK, Tsubaki J, Pratt KL, Bezrodnik L, Jasper H, Tepper A et al (2003) Growth hormone insensitivity associated with a STAT5b mutation N Engl J Med 349, 1139–1147 16 Udy GB, Towers RP, Snell RG, Wilkins RJ, Park SH, Ram PA, Waxman DJ & Davey HW (1997) Requirement of STAT5b for sexual dimorphism of body growth rates and liver gene expression Proc Natl Acad Sci USA 94, 7239–7244 17 Teglund S, McKay C, Schuetz E, van Deursen JM, Stravopodis D, Wang D, Brown M, Bodner S, Grosveld G & Ihle JN (1998) Stat5a and Stat5b proteins have essential and nonessential, or redundant, roles in cytokine responses Cell 93, 841–850 18 Argetsinger LS, Campbell GS, Yang X, Witthuhn BA, Silvennoinen O, Ihle JN & Carter-Su C (1993) Identification of JAK2 as a growth hormone receptor-associated tyrosine kinase Cell 74, 237–244 19 Herrington J, Smit LS, Schwartz J & Carter-Su C (2000) The role of STAT proteins in growth hormone signaling Oncogene 19, 2585–2597 20 Bromberg JF (2001) Activation of STAT proteins and growth control Bioessays 23, 161–169 21 Smit LS, Meyer DJ, Billestrup N, Norstedt G, Schwartz J & Carter-Su C (1996) The role of the growth hormone (GH) receptor and JAK1 and JAK2 kinases in the activation of Stats 1, 3, and by GH Mol Endocrinol 10, 519–533 22 Takahashi Y, Shirono H, Arisaka O, Takahashi K, Yagi T, Koga J, Kaji H, Okimura Y, Abe H, Tanaka T & Chihara K (1997) Biologically inactive growth hormone caused by an amino acid substitution J Clin Invest 100, 1159–1165 23 Jiang J, Liang L, Kim S-O, Zhang Y, Mandler R & Frank SJ (1998) Growth hormone-dependent tyrosine 3466 24 25 26 27 28 29 30 31 32 33 phosphorylation of a GH receptor-associated high molecular weight protein immunologically related to JAK2 Bioch Biophys Res Commun 253, 774–779 Yang CH, Murti A & Pfeffer LM (1998) STAT3 complements defects in an interferon-resistant cell line: evidence for an essential role for STAT3 in interferon signaling and biological activities Proc Natl Acad Sci USA 95, 5568–5572 Coqueret O & Gascan H (2000) Functional interaction of STAT3 transcription factor with the cell cycle inhibitor p21(WAF ⁄ CIP ⁄ SDI1) J Biol Chem 275, 18794–18800 Fukada T, Ohtani T, Yoshida Y, Shirogane T, Nishida K, Nakajima K, Hibi M & Hirano T (1998) STAT3 orchestrates contradictory signals in cytokine-induced G1 to S cell-cycle transition EMBO J 17, 6670–6677 Harper JW, Adami GR, Wei N, Keyomarsi K & Elledge SJ (1993) The p21 Cdk-interacting protein Cip1 is a potent inhibitor of G1 cyclin-dependent kinases Cell 75, 805–816 Frost RA, Nystrom GJ & Lang CH (2002) Regulation of IGF-I mRNA and signal transducers and activators of transcription-3 and -5 (Stat-3 and -5) by GH in C2C12 myoblasts Endocrinology 143, 492–503 Baixeras E, Jeay S, Kelly PA & Postel-Vinay MC (2001) The proliferative and antiapoptotic actions of growth hormone and insulin-like growth factor-1 are mediated through distinct signalling pathways in the Pro-B Ba ⁄ F3 cell line Endocrinology 142, 2968– 2977 Silva CM, Kloth MT, Whatmore AJ, Freeth JS, Anderson N, Laughlin KK, Huynh T, Woodall AJ & Clayton PE (2002) GH and epidermal growth factor signalling in normal and Laron syndrome fibroblasts Endocrinology 143, 2610–2617 Huang Y, Kim SO, Jiang J & Frank SJ (2003) Growth hormone-induced phosphorylation of epidermal growth factor (EGF) receptor in 3T3-F44a cells, modulation of EGF-induced trafficking and signalling J Biol Chem 278, 18902–18913 Horvath CM (2000) STAT proteins and transcriptional responses to extracellular signals Trends Biol Sci 25, 496–502 Carreira S, Goodall J, Aksan I, La Rocca SA, Galibert MD, Denat L, Larue L & Goding CR (2005) Mitf cooperates with Rb1 and activates p21Cip1 expression to regulate cell cycle progression Nature 433, 764–769 FEBS Journal 273 (2006) 3454–3466 ª 2006 The Authors Journal compilation ª 2006 FEBS ... from total RNA was performed using a Reverse Transcription System (Thermoscrip RT, Invitrogen) Human GHR was amplified from cDNA with primers ACACTCAAGAATGGACTCAAG and TGTAAATTGG CTCATCTGAG under... Takahashi Y, Shirono H, Arisaka O, Takahashi K, Yagi T, Koga J, Kaji H, Okimura Y, Abe H, Tanaka T & Chihara K (1997) Biologically inactive growth hormone caused by an amino acid substitution J Clin... Human STAT3 was amplified from cDNA with specific primers (STAT3 R: TAGGCGCCTCA GTCGTATCT and STAT3 F: AGCATCGAGCAGCT GACTAC), under the following conditions: denaturation at 95 °C for min, annealing