Differential regulation of telomerase activity by six telomerase subunits Joseph Tung-Chieh Chang 1 , Yin-Ling Chen 2 , Huei-Ting Yang 2 , Chi-Yuan Chen 2 and Ann-Joy Cheng 2 1 Department of Radiation Oncology, Chang Gung Memorial Hospital, Taoyuan, Taiwan; 2 School of Medical Technology and Graduate School of Basic Medical Science, Chang Gung University, Taoyuan, Taiwan Telomerase is a specialized reverse transcriptase responsible for synthesizing telomeric DNA at the ends of chromo- somes. Six subunits composing the telomerase complex have been cloned: hTR (human telomerase RNA), TEP1 (telomerase-associated protein 1), hTERT (human telom- erase reverse transcriptase), hsp90 (heat shock protein 90), p23, and dyskerin. In this study, we investigated the role of each the telomerase subunit on the activity of telomerase. Through down- or upregulation of telomerase, we found that only hTERT expression changed proportionally with the level of telomerase activity. The other components, TEP1, hTR, hsp90, p23, and dyskerin remained at high and unchanged levels throughout modulation. In vivo and in vitro experiments with antisense oligonucleotides against each telomerase component were also performed. Telomerase activity was decreased or abolished by antisense treatment. To correlate clinical sample status, four pairs of normal and malignant tissues from patients with oral cancer were examined. Except for the hTERT subunit, which showed differential expression in normal and cancer tissues, all other components were expressed in both normal and malignant tissues. We conclude that hTERT is a regulatable subunit, whereas the other components are expressed more constantly in cells. Although hTERT has a rate-limiting effect on enzyme activity, the other telomerase subunits (hTR, TEP1, hsp90, p23, dyskerin) participated in full enzyme activi‘ty. We hypothesize that once hTERT is expressed, all other telomerase subunits can be assembled to form a highly active holoenzyme. Keywords: hTERT; hTR; telomerase activity; telomerase subunit; TEP1. Normal human somatic cells have a limited proliferative capacity. Malignant cells, in contrast, have acquired the ability to override senescence. Telomere length and telom- erase activity have recently been implicated in the control of the proliferative capacity of normal and malignant cells [1,2]. Telomeres consist of hundreds to thousands of tandem repeats of the sequence TTAGGG, which are specifically extended by telomerase [1,2]. In most human somatic cells, except for regenerating tissues and activated lymphocytes, telomerase activity is undetectable and telo- mere length is progressively shortened during cell replica- tion [3,4]. Cell senescence is though to occur when the telomere length is critically shortened. On the other hand, most immortalized and human cancer cells exhibit stabil- ized telomere lengths, and are positive for telomerase activity [5–7]. The above evidence suggests that mainten- ance of telomeric length is required for cells to escape from replicative senescence and to acquire the ability to proliferate indefinitely. Telomerase reactivation thus appears to play an important role in cellular immortality and oncogenesis. The subunits comprising the human telomerase complex have been identified: human telomerase RNA (hTR), telomerase-associated protein 1 (TEP1), and human telomerase reverse transcriptase (hTERT). hTR functions as a template for telomere elongation by telomerase [8]. TEP1, which is homologous to the gene of Tetrahymena telomerase component p80, contains WD40 repeats [9,10]. As p80 interacts with telomerase RNA, the function of TEP1 is suspected to be associated with RNA and protein binding. hTERT contains reverse transcriptase motifs and functions as the catalytic subunit of telomerase [11,12]. Recently, other proteins associated with the telomerase holoenzyme have been reported. Heat shock protein 90 (hsp90) and molecular chaperon p23 have been demon- strated to bind to hTERT and contribute to telomerase activity [13]. Another nucleolar protein, dyskerin, which is the pseudouridine synthase component of the box H + ACA snoRNAs, also interacts with hTR [14,15]. It is conceivable that dyskerin mediates interaction of the telomerase ribonuclear protein with the nucleolus to facilitate hTR processing or assembly of the telomerase complex [14–16]. Greater expression of hTERT, but less of hTR or TEP1, has been reported to correlate with telomerase activity in cancer cells [17,18]. An association of telomerase activity with the expression of hsp90, p23 or dyskerin has not been reported. Correspondence to A J. Cheng, School of Medical Technology, Chang Gung University, 259 Wen-Hwa 1st Road, Taoyuan 333, Taiwan. Fax: + 886 3328 0174, E-mail: ajchen@mail.cgu.edu.tw Abbreviations: hTR, human telomerase RNA; TEP1, telomerase associated protein 1; hTERT, human telomerase reverse transcriptase; hsp90, head shock protein 90; PTA, phorbol- 12-myristate-13 acetate; PHA, phytohaemagglutinin; PBMC, peripheral blood mononuclear cells; SFM, serum-free medium; TRAP/EIA, telomeric repeat amplification protocol-enzyme immunoassay; TBP, TFIID-binding protein; TAF, TBP-associated factors; mTEP1, mouse TEP1. (Received 13 December 2001, revised 25 April 2002, accepted 28 May 2002) Eur. J. Biochem. 269, 3442–3450 (2002) Ó FEBS 2002 doi:10.1046/j.1432-1033.2002.03025.x The mechanism by which telomerase is activated in human cancers is unclear. In vitro reconstitution experi- ments have shown that hTR and hTERT are sufficient for telomerase activity, suggesting minimal catalytic function of the enzyme [19]. Ectopic expression of hTERT in normal human cells restored telomerase activity, extended the replicative life span of the cells [20,21], maintained telomere length, and eliminated tumorigenicity [22,23]. The level of hTERT in cells seems to be a sole component necessary for regulation of the enzyme’s activity. Nevertheless, it remains unclear whether other telomerase subunits are essential for the holoenzyme function. Down-regulation of telomerase activity by induction of differentiation of HL-60 cells has been reported [24,25]. To understand the role of each telomerase subunit in enzyme activity, we used down- regulation of telomerase by inducing differentiation of HL-60 cells, and up-regulation of telomerase by stimulating proliferation of peripheral blood mononuclear cells (PBMC) to evaluate changes in the telomerase components. We then investigated alterations in telomerase activity after blocking each telomerase component by antisense oligonu- cleotides using in vitro and cellular models. We also examined normal and malignant human tissue samples for the expression of each telomerase subunit and correlated it with telomerase activity. MATERIALS AND METHODS Chemicals Dimethylsulfoxide, phorbol-12-myristate-13 acetate (PTA), phenylmethanesulfonyl fluoride, and Wright and Trypan blue dyes were from Sigma. Giemsa stain was from Aldrich, and phytohaemagglutinin (PHA) and lipofectin reagent were from Gibco BRL. Oligonucleotides The oligonucleotides used for PCR amplification are listed in Table 1. The antisense oligonucleotide against the hTR gene (anti-hTR) was designed to be complementary to the template region sequences. Other antisense oligonucleo- tides against TEP1 (anti-TEP1), hsp90 (anti-hsp90), p23 (anti-p23), dyskerin (anti-dkc) were designed to be comple- mentary to the region )2 to +20 of the coding sequences. All gene sequences were found in the GenBank database. Non-specific oligonucleotides, designated as non-hTR, non- TEP1, non-hsp90, non-p23, and non-dkc, having the same base composition as the antisense oligonucleotides but with different sequences, were used as controls. Oligonucleotides used for transfection experiments were modified by phos- phorothiolation. All oligonucleotides were from Genasia Scientific Inc., Taipei, Taiwan. Tissue samples, cell lines, and cell culture Human tissues used for this study were from oral cancer patients, admitted to Chang Gung Memorial Hospital of Taiwan. Written consent was obtained before use of the tissues in our experiments. For each patient, one sample each of malignant tissue and normal mucosa were surgically dissected and frozen immediately in liquid nitrogen until used for molecular assay. Cells used included oral cancer cell lines OECM1, OC2 [26], KB, the cervical cancer cell line HeLa, and the leukaemia cell line HL-60. HL-60 cells were grown in RPMI-1640 (Gibco BRL), while others were maintained in Dulbecco’s modified Eagle’s medium (Gibco BRL). Both media were supplemented with 10% fetal bovine serum and antibiotics, and the cells were cultured in a humidified atmosphere containing 5% CO 2 . Cultures from each cell were harvested every 24 h and monitored for cell number by counting cell suspensions with a haemocytometer. Cell viability was determined by staining cells with 0.25% Trypan blue, with the fraction of stain-negative cells taken as the surviving fraction. In all experiments, the cell viability rates were >75%. Induction and assessment of differentiated HL-60 cells Induction of differentiation in HL-60 cells was performed either by treatment with 1.4% dimethylsulfoxide or with 100 ngÆmL )1 TPA for up to 4 days. The differentiated HL-60 cells were assessed by morphological change. Induction with dimethylsulfoxide led to granulocytic differ- entiation, which was assessed using Wright–l Giemsa stain. Cells (5 · 10 4 ) were prepared on slides by Cytospin (Shandon Southern) and stained, then examined under a light microscope (·1000). Granulocytic differentiation was determined according to the presence of an eccentric or segmented nucleus and the increase in the nucleus/ cytoplasm ratio. Induction with TPA led to monocytic differentiation and attachment to the bottom of the culture flask. For morphological assessment, the supernatant was aspirated and the TPA-treated cells were examined with a phase contrast microscope (·400). Monocytic cells were identified by the presence of dendriform cytoplasm. Isolation, culture, and activation of PBMC Heparinized peripheral blood was drawn from normal volunteer donors, and the PBMC were separated and isolated from the interface of Ficoll-Hypaque (Pharmacia Biotech). The isolated PBMC were washed three times with Table 1. Names and the sequences of oligodeoxyribonucleotides used for RT-PCR analysis. Gene Name Sequences (5¢fi3¢) Annealing temperature hTR F2b tccctttataagccgactcg 58 °C R3c gtttgctctagaatgaacggtggaag TEP1 TEP1.1 tcaagccaaacctgaatctgag 58 °C TEP1.2 ccccgagtgaatctttctacgc hTERT LT5 cggaagagtgtctggagcaa 56 °C LT6 ggatgaagcggagtctgga hsp90 hsp90-f tccttcgggagttgatctctaatgc 60 °C hsp90-r gaattttgagctctttaccactgtccaa p23 p23-f accagttcgcccgtccc 60 °C p23-r ccttcgatcgtaccactttgcaga Dyskerin dkc-f cctcggctgtggaccgg 60 °C dkc-r aaataattacttccgcatccgcca Actin actin-s gtggggcgccccaggcacc 58 °C actin-a ctccttaatgtcacgcacgatttc Ó FEBS 2002 Telomerase activity and the six subunits (Eur. J. Biochem. 269) 3443 HBSS solution (Gibco BRL) and resuspended at a density of 2 · 10 6 cellsÆmL )1 in RPMI-1640 supplemented with 20% fetal bovine serum and antibiotics. PBMC (1 · 10 6 cellsÆmL )1 ) were cultured in the presence or absence of PHA (20 lLÆmL )1 PBMC), and incubated at 37 °Cina humidified atmosphere containing 5% CO 2 . Transfection with antisense and nonspecific oligonucleotides For the transfection of HL-60 cells, cells were seeded at a density of 2 · 10 6 per well in a six-well culture plate in 0.8 mL serum-free medium (SFM). Antisense or nonspecific oligonucleotides in a final concentration of up to 0.7 l M and 20 lL of lipofection reagent in a total of 0.2 mL SFM were mixed gently at room temperature for 45 min. The DNA mixture was added to the HL-60 cells and incubated for 20 h at 37 °CinaCO 2 incubator. The culture medium was then replaced with fresh complete RPMI and further incubated for 3 days. For the transfection of PBMC, cells were seeded at a density of 2 · 10 6 cellsÆmL )1 in SFM, followed by transfection with the DNA mixture as described above. After DNA transfection, the culture medium was replaced with fresh complete RPMI containing 20 lLÆmL )1 PHA, and incubated for a further 3 days. Protocols for transfection of other cells were similar as described above, except that final concentrations of up to 0.7 l M oligonuc- leotides and 15 lL lipofection reagent were used to maintain cell viability. Cellular protein extraction and analysis of telomerase activity Treated cells were suspended in a lysis buffer (10 m M Tris/ HCl, pH 7.5, 1 m M MgCl 2 ,1m M EGTA, 0.5% Chaps, 10% glycerol, 0.1 m M phenylmethanesulfonyl fluoride and 5m M 2-mercaptoethanol), and incubated for 30 min at 4 °C while being gently mixed. After centrifuging at 14 000 g for 30 min at 4 °C, the supernatants were trans- ferred to fresh tubes for the telomerase activity assay. Protein concentrations were determined using the Coomas- sie Protein Assay Reagent (Pierce). Assay of telomerase activity was performed by the telomeric repeat amplification protocol-enzyme immunoas- say (TRAP/EIA) as described previously [27]. Telomerase activity was determined by the ability to produce telomere repeats by a PCR-based TRAP assay and measuring the PCR products using a EIA-based assay. Briefly, 0.3 lg proteinextractwasaddedto30lL of the TRAP reaction buffer and incubated at 25 °C for 15 min, followed by amplification by 25 cycles of PCR at 94 °C for 30 s, 55 °C for 30 s, and 72 °C for 1 min in a DNA Thermal Cycler. After the PCR reactions, 5 lL of the PCR products were dispensed into streptavidin-coated wells and incubated with 100 lL of antidigoxigenin antibody conjugated with horse- radish peroxidase (10 mUÆmL )1 ) at room temperature for 60 min in an EIA reaction buffer. After washing, enzyme reactions were initiated by the addition of 100 lLof tetramethylbenzidine substrate solution to each well. Ten min later, the reactions were stopped by the addition of 100 lL2 M HCl to each well. Colorimetric signals were determined by measuring the absorbance at 450 nm using an automatic microwell reader. RNA extraction and analysis of telomerase subunit genes The expression of each of the telomerase subunit genes (hTR, TEP1, hTERT, hsp90, p23 and dyskerin) were analysed by using RT/PCR. Total RNA from cells or tissues was isolated by using the TRIzol reagent (Gibco BRL) following the manufacturer’s instructions. The con- centration, purity, and amount of total RNA were deter- mined by ultraviolet spectrophotometry. The reverse transcription reaction was performed in a total volume of 30 lL containing 30 ng RNA, 100 pmol poly T oligonucleotide, 4 U avian myeloblastosis virus reverse transcriptase (HT Biotech Ltd, UK), 10 U RNase inhibitor (CalBiochem), and 25 m M dNTP at 42 °Cfor1h. The number of PCR cycles was titrated to avoid reaching the amplification plateau. PCR was performed with 30 cycles of denaturation at 94 °C for 40 s, annealing at 56– 60 °C for 40 s and extension at 72 °Cfor1minPCR products were analysed by either 8% polyacrylamide or 1.5% agarose gel electrophoresis, stained with SyBr Green I (Molecular Probes), then visualized and photographed by illuminating with 254 nm UV. RESULTS Cellular changes in HL-60 cells after induction of differentiation Over 80% of the HL-60 cells remained viable over the entire course of treatment with dimethylsulfoxide . The ratio of differentiated cells (Fig. 1A and B) was estimated to be 25% after 2 days of treatment and 70% after 4 days. After 4 days of treatment with 100 ngÆmL )1 TPA, > 90% of the HL-60 cells became attached to the flask and developed dendriform cytoplasm, indicating successful induction (Fig. 1C and D). Longer treatment led to cell death, with an increased fraction of floating rather than attached cells. Therefore, we harvested cells treated only for up to 4 days for evaluation of telomerase activity and the subunit expression studies. hTERT expression after modulation of telomerase activity DMSO treatment led to a decrease in telomerase activity to  70% of baseline after 1 day, 40% after 2 days, and > 10% after 4 days (Fig. 2A). The expression of hTERT was dramatically decreased after 1 day of treatment, indicating that the hTERT subunit was significantly corre- lated with the decrease in telomerase activity, and was an earlier event than the change in holoenzyme acti- vity.However, other telomerase components remained unchanged during the entire course of treatment (Fig. 2B). Similar results were found in the TPA-treated HL-60 cells. Telomerase activity was gradually decreased over 4 days of treatment, accompanied by diminished hTERT expression but little change in other telomerase components (data not shown). Both of these results indicate that hTERT is the component primarily responsible for regulation of telomerase activity. As shown in Fig. 3, telomerase activity was up-regulated after 8 h of PHA treatment of PBMC, reaching the highest level at 2–4 days, and gradually decreasing after 4 days. 3444 J. Tung-Chieh Chang et al. (Eur. J. Biochem. 269) Ó FEBS 2002 hTERT expression increased with the increase in telomerase activity, while expression of the other telomerase subunits remained unchanged. This result further demonstrates that hTERT is the major component responsible for the regulation of telomerase activity. Telomerase activity after blockade of telomerase subunits Antisense inhibition of each telomerase subunit was carried out in vitro. In this experiment, 5–200 n M of each antisense or nonspecific oligonucleotide was added to the TRAP reaction buffer containing the protein extract from HL-60 cells. After brief incubation (5 min) on ice, the reaction mixtures were subjected to telomerase activity assay as described in Materials and methods. Telomerase activity was inhibited by antisense oligonucleotides in a dose- dependent manner (Fig. 4). For each gene treated with antisense oligonucleotides at 200 n M , telomerase activity was completely inhibited (< 5% of untreated control). Treatment with 50 n M antisense oligonucleotides led to a dramatic reduction of telomerase activity, to < 20% of the untreated control, except for anti-dyskerin, which reduced telomerase activity to only  60%. Treatment with 50 n M nonspecific oligonucleotides did not inhibit telomerase activity, except for slight inhibition with non-TEP1 (to 80% of control values). A low dose (5 n M )ofantisense oligonucleotides, resulting in lower levels of subunit inhibi- tion, led to variable but significant effects on telomerase activity for hTR, TEP1 and p23, whereas inhibition of dyskerin had the least effect. From these antisense studies, it appears that all of the telomerase subunits contribute to the full activity of the holoenzyme, although dyskerin plays a lesser role. Transfection of HL-60 cells with anti-TEP1 led to a specific inhibition of TEP1 (Fig. 5A). There was no obvious effect on the expression of hTR after transfection of HL-60 cells with anti-hTR, as this antisense oligonucleotide was designed to be complementary to the template region sequence (Fig. 5A). Telomerase activity was gradually decreased in cells transfected with specific antisense oligo- nucleotides, to  60% after 2 days and to almost undetect- able levels after 3 days (Fig. 5B). However, transfection with nonspecific oligonucleotides had no effect on telom- erase activity (Fig. 5B). For the effects of hTR and TEP1 on the activation of telomerase, the model of stimulating PBMC was applied. As shown in the Fig. 5C, the addition of anti-hTR or anit-TEP1 to PHA-stimulated PBMC resulted in significantly reduced activation of telomerase after 48 h. For the other cell lines studied (OECM1, KB, OC2, and HeLa), inhibition of the various telomerase subunits (hTR, TEP1, hsp90, p23 and dyskerin) with antisense oligonucleo- tides resulted in a reduction of specific mRNA expression (Fig. 6A) and inhibition of telomerase activity in a dose- and time-dependent manner (partial results shown in Fig. 6B). The exact effect of each antisense oligonucleotide on telomerase activity varied according to the cell line. This may have resulted from differing endogenous cellular regulatory responses or differing transfection efficiency in the various cell types. For example, OECM1 cells generally showed more significant inhibition than other cells (Fig. 6B). Nevertheless, inhibition of each telomerase sub- unit caused a reduction of telomerase activity, suggesting Fig. 1. Changes in cell morphology after induction of differentiation of HL-60 cells by dimethylsulfoxide and TPA. (A) HL-60 cells cultured in RPMI for 3 days (control for B), followed by cytospin analysis and staining (·1000). (B) HL-60 cells treated with 1.4% dimethylsulfoxide, followed by cytospin analysis and staining (·1000). (C) HL-60 cells in suspension after culture in RPMI for 3 days (control for B) (·400). (D) HL-60 cells after treatment with 100 ngÆmL )1 TPA for 3 days, attached to flask (·400) suspension and photographed the attached cells. Ó FEBS 2002 Telomerase activity and the six subunits (Eur. J. Biochem. 269) 3445 that each component plays a distinct role in the full enzyme function. Telomerase activity and the expression of each subunit in normal and malignant tissues In four pairs of normal and malignant tissue from oral cancer patients, telomerase activity, as expected, was found in all the malignant tissue samples but was absent in the normal counterparts. Results of analysis of the expression of each telomerase subunit are shown in Fig. 7. hTERT expression correlated with telomerase activity, that is, it was expressed in all telomerase-positive malignant tissue but was undetectable in all telomerase-negative normal tissue. Other telomerase subunits, however, were found to be more constantly expressed in both normal and malignant tissue. DISCUSSION Telomerase activation is stringently repressed in normal human somatic tissues but reactivated in immortal cells, suggesting that up-regulation of telomerase participates in cellular aging and oncogenesis. Therefore, understand- ing telomerase regulatory mechanisms is valuable in understanding tumour biology as well as in defining molecular targets for clinical application. Thus far, six major components of telomerase have been identified; Fig. 2. Changes in telomerase subunits and telomerase activity in response to induction of differentiation in HL-60 cells with dimethyl- sulfoxide. HL-60 cells were treated with 1.4% dimethylsulfoxide for 4 days. Cells were harvested, and RNA and protein fractions were extracted for subunit expressions and telomerase activity analysis. (A) Relative telomerase activity on each day. (B) RNA expression of telomerase subunits analysed by RT-PCR and resolved in 1.5% agarose gel. Genes are listed on the left. Actin expression was analysed as a control. See Materials and methods for experimental details. Fig. 3. Activation of telomerase activity by stimulating PBMC with PHA. (A) Relative telomerase activity on each day. (B) RNA expression of telomerase subunits, analysed by RT-PCR and resolved in 1.5% agarose gel. Genes are listed on the left. Actin expression was analysed as a control. N, sample was not determined. See Materials and methods for experimental details. Fig. 4. In vitro analysis of changes in telomerase activity after intro- duction of antisense or nonspecific oligonucleotides. Results are presented as the means of duplicate experiments. Antisense oligonucleotides were used at either 200, 50 or 5 n M , while nonspecific oligonucleotides were used at 50 n M as indicated at the top of the figure. Relative telomerase activity was obtained after comparing the control sample without treatment with oligonucleotides. Telomerase activity was measured by TRAP/EIA. 3446 J. Tung-Chieh Chang et al. (Eur. J. Biochem. 269) Ó FEBS 2002 except for hTR and hTERT, however, the roles of the other subunits in enzyme function are still unclear. TEP1 protein is thought to be associated with hTR, as the N- terminal region of TEP1 is homologous to the gene of Tetrahymena telomerase component p80, which interacts with telomerase RNA [9,10]. The WD40 repeats are found in proteins involved in a wide variety of cellular processes ranging from signal transduction to RNA processing [28]. Proteins containing WD repeats are often physically associated with other proteins and are believed in many cases to act as scaffolds upon which multimeric complexes are built [29]. Recently, a novel protein containing WD40 repeats was cloned and found to be overexpressed in breast cancer [30]. Moreover, a cytoplasmic ribonucleo- protein complex Vaults also shares a common subunit of TEP1 [31,32]. Therefore, TEP1 protein in telomerase may play a role in ribonucleoprotein structure, assembly, or may also be involved in cancer progression. The essential roles of hTR and TEP1 in telomere length maintenance and telomerase activity have been investigated in vivo, using mouse embryonic stem cells lacking mouse telomerase RNA or the mouse TEP1 (mTEP1) gene. Functional analysis of mouse embryonic stem cells with- out mouse telomerase RNA shows a lack of detectable Fig. 6. Telomerase activity after introduction of antisense oligonucleo- tides into various cells. Resultsarepresentedasthemeansoftwo independent experiments. Antisense oligonucleotides at 0.2 l M (anti- TEP1 or anti-hTR) or 0.5 l M (anti-hsp90, anti-p23 or anti-dyskerin) were transfected into various cells and telomerase activity was meas- ured after 2 days by TRAP/EIA. (A) OECM1 cells were transfected with each antisense oligonucleotide and the expression of each telomerase subunit gene was measured. Actin expression for each treatment was determined as an mRNA control. C, Control sample, with lipofectin transfection only; A, antisense transfected sample. (B) Cells included OECM1, HeLa, KB, and HL-60, and OC2 as indicated each at the top of the figure. Relative telomerase activity was obtained by comparison with the untreated control sample. Fig. 5. Telomerase activity after introduction of antisense oligonucleo- tides. (A) Antisense oligonucleotides against either TEP1 (anti-TP1) or hTR (anti-hTR) were transfected into HL-60 cells and TEP1 and hTR expression was measured after 3 days by TRAP/EIA. Actin expression for each treatment was determined as mRNA control. TEP1 expres- sion was inhibited significantly by anti-TP1 treatment. The expression of hTR has not much affected by anti-hTR, because this antisense oligonucleotide was designed to be complementary to the template region sequence. (B) Antisense oligonucleotides against either TEP1 (anti-TP1) or hTR (anti-hTR), or nonspecific oligonucleotides (non- TP1 and non-hTR) were transfected into HL-60 cells and telomerase activity was measured by TRAP/EIA cells 3 days later. (C) Telomerase activity after introduction of antisense oligonucleotides into PHA- stimulated lymphocytes. Ficoll-Hypaque isolated lymphocytes were treated with PHA with or without anti-TP1 or anti-hRT and cultured forupto48h. Ó FEBS 2002 Telomerase activity and the six subunits (Eur. J. Biochem. 269) 3447 telomerase activity but maintenance of telomere length [33]. These results demonstrate the necessity for hTR in telom- erase and suggest a telomerase-independent pathway in maintaining telomere length. Our results of antisense manipulation of the hTR subunit are in agreement with this finding. Embryonic stem cells without mTEP1 reveal no alteration in telomerase activity compared to wide-type cells, suggesting a redundant role for mTEP1 [34]. When we inhibited TEP1, however, there was complete inhibition of telomerase activity in vitro and significant inhibition in cells, indicating that this protein is required for full activity of the telomerase. Several possibilities may explain this finding. In the in vivo mouse model, mTEP1 may be associated with only a fraction of the total telomerase activity, or other telomerase-associated proteins may share a redundant role with mTEP1, so that its disruption might have no overt phenotypic consequence [34]. In our in vitro experiment, because of the shortage of cellular salvage pathways and the complete inhibition of TEP1 function by high concentra- tions of antisense oligonucleotides, telomerase activity was dramatically diminished. Alternatively, hTR and hTERT may play a minimal catalytic activity in telomerase, while the assembly of other telomerase subunits may amplify the enzyme function. In this scenario, deletion of mTEP1 in embryonic stem cells would have no effect on telomerase activity, and the level may be sufficient for mouse develop- ment. In our experiments, the relatively high levels of telomerase present in cancer cell lines were significantly decreased upon inhibition of TEP1 by antisense oligonu- cleotides. A similar example can be found in transcription factor TFIID. TFIID contains a core TFIID-binding protein (TBP) plus several TBP-associated factors (TAFs). TBP alone stimulates minimal transcriptional activity in the TATA box region of the promoter, but when it is associated with complete TAFs, it strongly facilitates transcriptional activity [35]. Recently, an in vitro reconstitution study has been reported to support this hypothesis. A reconstituted complex of hTERT and hTR was detected by EMSA, and its activity was stimulated more than 30-fold by the addition of cell extract, indicating the presence of a cellular factor contributing to the stimulatory effect of telomerase activity [36]. Hsp90 and molecular chaperon p23 have been demon- stratedtobindtohTERTandareconsideredtobe telomerase subunits [13]. P23 was first identified as a component of progesterone and glucocorticoid receptor complexes [37]. Subsequently, it was found that p23 is associated with hsp90 in these complexes and that the presence of both molecules is required to maintain these receptors in a ligand binding state [37]. These observations led to the concept of a molecular chaperon machine or foldosome that mediates assembly of a biologically active protein complex. Similarly, hsp90 and p23 in the telom- erase complex may also serve this foldosome function to assemble the active holoenzyme. Geldanamycin, an hsp90 inhibitor, has been found to reduce the activity of reconstituted telomerase in cell extracts, demonstrating the role of hsp90 in the holoenzyme complex [36]. In our in vitro and cellular study of antisense oligonucleotide inhibition, blockage of hsp90 or p23 significantly decreased telomerase activity, further supporting the inference that these molecules play a role in the assembly of active telomerase. Whether these molecules, like TEP1, have an additional stimulatory effect on telomerase requires further investigation. Antisense inhibition of dyskerin, although showing comparable inhibition of telomerase function in cells, exhibited a weaker inhibition of telomerase activity in the in vitro assay. As dyskerin is believed to be involved in hTR processing or assembly into the telomerase complex [14], the weaker inhibition leads us to suspect that this processing occurs at an earlier step of telomerase holoen- zyme assembly. The correlation of telomerase activity with the expression of telomerase subunits hTERT, hTR and TEP1 has been reported. Expression of hTERT, and less so of hTR or TEP1, has been found to correlate with telomerase activity in many cancer cells [17,18]. We further studied telomerase activity in relation to the expression of hsp90, p23 and dyskerin in human tissue samples and found no correlation. These results indicate that hTERT is strongly associated with telomerase activity while other components are more constantly expressed in cells. As described above, the experiments with ectopic expres- sion of hTERT suggests that the level of hTERT in cells is a rate-limiting component for the regulation of enzyme activity. Nevertheless, these results still cannot rule out the Fig. 7. Expressions of telomerase activity and the subunits in human tissues. Four pairs of normal (N) and tumour (T) tissues from oral cancer patients were examined. (A) Relative telomerase activity of each sample compared to the OC2 cancer cell line. Telomerase activities are determined by PCR/EIA. Each sample indicated as Ôpatient : tissueÕ below each bar represents the specific patient and tissue. (B) The expression of six telomerase subunits in the samples determined by RT-PCR. Each sample is indicated at the top of the figure. Lane C indicates the control experiment which contained all of the RT-PCR reagents except tissue RNA. Six telomerase subunits were examined by RT-PCR and are indicated at the left of the figure. See Materials and methods for experimental details. 3448 J. Tung-Chieh Chang et al. (Eur. J. Biochem. 269) Ó FEBS 2002 necessity of other telomerase components for full activity of the enzyme. In the present study, we demonstrated that hTERT is a regulatable component and responsible for the activation of telomerase, as it responded to environmental stimulation in both up- and down-regulation models. The other telomerase components retained expression at relat- ively constant levels in both human tissue samples and cell lines, and showed a lesser response to environmental changes. In addition, our antisense experiments showed that inhibition of any component could result in the reduction of telomerase activity, suggesting that each telomerase subunit is necessary for full enzyme activity. We conclude that hTERT is a regulatable subunit, while the other components are more constantly expressed. We hypothesize that once hTERT is expressed, all of the other telomerase subunits can be assembled to form a highly active holoenzyme. ACKNOWLEDGEMENTS This work was supported by National Science Council Research Grant NSC89-2314-B-182-068 of Taiwan and Chang Gung Medical Research Grant CMRP869. We thank M. J. Buttrey for critical reading and correction of the manuscript. REFERENCES 1. Blackburn, E.H. (1991) Structure and function of telomeres. Nature 350, 569–573. 2. Blackburn, E.H. (1992) Telomerase. Annu. Rev. Biochem. 61, 113–129. 3.Cheng,A.J.,Tang,R.,Wang,J.I.,See,L.C.&Wang,T.C.V. (1998) Possible role of telomerase activation in the cancer predis- position of patients with hereditary nonpolyposis colorectal can- cers. J. Natl Cancer. Inst 90, 316–321. 4. Bacchetti, S. (1996) Telomere dynamics and telomerase activity in cell senescence and cancer. Semin. Cell. Dev. Biol. 7, 31–39. 5. Cheng, A.J., Lin, J.D., Chang, T. & Wang, T.C.V. (1998) Telom- erase activity in benign and malignant human thyroid tissues. Br. J. Cancer 77, 2177–2180. 6. Tang, R., Cheng, A.J., Wang, J.Y. & Wang, T.C.V. (1998) Close correlation between telomerase expression and adenomatous polyp progression in multistep colorectal carcinogenesis. Cancer Res. 58, 4052–4054. 7. Shay, J.W. & Bacchetti, S. (1997) A survey of telomerase activity in human cancer. Eur. J. Cancer 33, 787–791. 8. Feng, J., Funk, W.D., Wang, S.S., Weinrich, S.L., Avilion, A.A., Chiu, C.P., Adams, R.R., Chang, E., Allsopp, R.C., Yu, J. et al. (1995) The RNA component of human telomerase. Science 269, 1236–1241. 9. Collins, K., Kobayashi, R. & Greider, C.W. (1995) Purification of Tetrahymena telomerase and cloning of genes encoding the two protein components of the enzyme. Cell 81, 677–686. 10.Nakayama,J.,Saito,M.,Nakamura,H.,Matsuura,A.& Ishikawa, F. (1997) TEP1: a gene encoding a protein component of mammalian telomerase is a novel member of WD repeats family. Cell 88, 875–884. 11. Meyerson, M., Counter, C.M., Eaton, E.N., Ellisen, L.W., Steiner, P.,Caddle,S.D.,Ziaugra,L.,Beijersbergen,R.L.,Davidoff, M.J., Liu, Q., Bacchetti, S., Haber, D.A. & Weinberg, R.A. (1997) hEST2, the putative human telomerase catalytic subunit gene, is up-regulated in tumor cells and during immortalization. Cell 90, 785–795. 12. Linger, J., Hughes, T.R., Shevchenko, A., Mann, M., Lundblad, V. & Cheh, T.R. (1997) Reverse transcriptase motifs in the cata- lytic subunit of telomerase. Science 276, 561–567. 13. Holt, S.E., Aisner, D.L., Baur, J., Tesmer, V.M., Dy, M., Ouellette, M., Trager, J.B., Morin, G.B., Toft, D.O., Shay, J.W., Wright, W.E. & White, M.A. (1999) Functional requirement of p23 and hsp90 in telomerase complexes. Genes Dev. 13, 817–826. 14. Mitchell, J.R., Cheng, J. & Collins, K. (1999) A box H/ACA small nuclear RNA-like domain at the human telomerase RNA 3¢ end. Mol. Cell. Biol. 19, 567–576. 15. Mitchell, J.R., Wood, E. & Collins, K. (1999) A telomerase component is defective in the human disease dyskeratosis con- genita. Nature 402, 551–555. 16. Shay, J.W. & Wright, W.E. (1999) Mutant dyskerin ends relationship with telomerase. Science 286, 2284–2285. 17. Nakayama, J., Tahara, H., Tahara, E., Saito, M., Ito, K., Nakamura, H., Nakanishi, T., Tahara, E., Ide, T. & Ishikawa, F. (1998) Telomerase activation by hTRT in human normal fibro- blasts and hepatocellular carcinomas. Nature Genet. 18, 65–68. 18. Dome, J.S., Chung, S., Bergemann, T., Umbricht, C.B., Saji, M., Carey, L.A., Grundy, P.E., Perlman, E.J., Breslow, N.E. & Sukumar, S. (1999) High telomerase reverse transcriptase (hTERT) messenger RNA level correlates with tumor recurrence in patients with favorable histology Wilm’s tumor. Cancer Res. 59, 4301–4307. 19. Beattie, T., Shou, W., Robinson, M.O. & Harrington, L. (1998) Reconstitution of human telomerase activity in vitro. Curr. Biol. 8, 177–180. 20. Bodnar, A.G., Ouellette, M., Frolkis, M., Holt, S.E., Chiu, C.P., Morin,G.B.,Harley,C.B.,Shay,J.W.,Lichtsteiner,S.&Wright, W.E. (1998) Extension of life-span by introduction of telomerase into normal human cells. Science 279, 349–352. 21. Counter, C.M., Meyerson, M., Eaton, E.N., Ellisen, L.W., Caddle, S.D., Haber, D.A. & Weinberg, R.A. (1998) Telomerase activity is restore in human cells by ectopic expression of hTERE (hEST2), the catalytic subunit of telomerase. Oncogene 16, 1217– 1222. 22. Hahn, W.C., Stewart, S.A., Brooks, M.W., York, S.G., Eaton, E., Kurachi, A., Beijersbergen, R.L., Knoll, J.H.M., Meyerson, M. & Weinberg, R.A. (1999) Inhibition of telomerase limits the growth of human cancer cells. Nature Med. 5, 1164–1170. 23. Zhang, X., Mar., V., Zhou, W., Harrington, L. & Robinson, M.O. (1999) Telomere shortening and apoptosis in telomerase-inhibited human tumor cells. Genes Dev. 13, 2388–2399. 24. Cheng, A.J., Liao, S.K., Chow, S.E., Chen, J.K. & Wang, T.C.V. (1997) Differential inhibition of telomerase activity during induc- tion of differentiation in hematopoietic, melanoma, and glioma cells in culture. Biochem. Biophys. Res. Commun. 237, 438–444. 25. Sharma, H.W., Sokoloski, J.A., Perez, J.R., Maltese, J.Y., Sartorelli, A.C., Stein, C.A., Nichols, G., Khaled, Z., Telang, N.T. & Narayanan, R. (1995) Differentiation of immortal cells inhibits telomerase activity. Proc. Natl Acad. Sci. U.S.A. 92, 12343–12346. 26. Wong, D.Y.K., Chang, K.W., Chen, C.F. & Chang, R.C.S. (1990) Characterization of two new cell lines derived from oral cavity human squamous cell carcinomas-OC1 and OC2. J. Oral Max- illofac. Surg. 48, 385–390. 27. Cheng, A.J., Tang, R., Wang, J.Y., Chang, J.T. & Wang, T.C. (1999) Polymerase chain reaction-based enzyme immunoassay for quantitation of telomerase activity: application to colorectal cancers. Jpn J. Cancer Res. 90, 280–285. 28. Vander, V.L. & Ploegh, H.L. (1992) The WD-40 repeat. FEBS Lett. 307, 131–134. 29. Neer, E.J., Schmidt, C.J., Nambudripad, R. & Smith, T.F. (1994) The ancient regulatory protein family of WD-repeat proteins. Nature 371, 297–300. 30. Matsuda, S., Katsumata, R., Okuda, T., Yamamoto, T., Miyazaki, K., Senga, T. et al. (2000) Molecular cloning and characterization of human MAWD, a novel protein containing WE-40 repeats frequently overexpressed in breast cancer. Cancer Res. 60, 13–17. Ó FEBS 2002 Telomerase activity and the six subunits (Eur. J. Biochem. 269) 3449 31. Kickhoefer, V.A., Stephen, A.G., Harrington, L., Robinson, M.O. & Rome, L.H. (1999) Vaults and telomerase share a com- mon subunit, TEP1. J. Biol. Chem. 274, 32712–32717. 32. Kickhoefer, V.A., Liu, Y., Kong, L.B., Snow, B.E., Stewart, P.L., Harrignton, L. & Rome, L.H. (2001) The telomerase/vault-asso- ciated protein TEP1 is required for vault RNA stability and its association with the vault particle. J. Cell. Biol. 152, 157–164. 33. Niida,H.,Shinkai,Y.,Hande,M.P.,Matsumoto,T.,Takehara, S., Tachibana, M., Oshimura, M., Lansdorp, P.M. & Furuichi, Y. (2000) Telomere maintenance in telomerase-deficient mouse embryonic stem cells: characterizaiton of an amplified telomeric DNA. Mol. Cell. Biol. 20, 4115–4127. 34. Liu, Y., Snow, B., Hande, M.P., Baerlocher, G., Kicihoefer, V.A., Yeung, D., Wakeham, A., Itie, A., Siderovski, D.P., Lansdorp, P.M., Robinson, M.O. & Harrington, L. (2000) Telomerase- associated protein TEP1 is not essential for telomerase activity or telomere length maintenance in vivo. Mol. Cell. Biol. 20, 8178– 8184. 35. Burey, S.K. & Roeder, R.G. (1996) Biochemistry and structural biology of transcription factor IID (TFIID). Ann. Rev. Biochem. 65, 769–799. 36. Masutomi, K., Kaneko, S., Hayashi, N., Yamashita, T., Shirota, Y., Kobayashi, K. & Murakami, S. (2000) Telomerase activity reconstituted in vitro with purified human telomerase reverse transcriptase and human telomerase RNA component. J. Biol. Chem. 275, 22568–22573. 37. Hutchison, K.A., Stancato, L.F., Owens-Grillo, J.K., Johnson, J.L., Krishna, P., Toft, D.O. & Pratt, W.B. (1995) The 23-kDa acidic protein in reticulocyte lysate is the weakly bound compo- nent of the hsp foldosome that is required for assembly of the glucocorticoid receptor into a functional heterocomplex with hsp90. J. Biol. Chem. 270, 18841–18847. 3450 J. Tung-Chieh Chang et al. (Eur. J. Biochem. 269) Ó FEBS 2002 . Differential regulation of telomerase activity by six telomerase subunits Joseph Tung-Chieh Chang 1 , Yin-Ling Chen 2 , Huei-Ting Yang 2 , Chi-Yuan. subunit in enzyme activity, we used down- regulation of telomerase by inducing differentiation of HL-60 cells, and up -regulation of telomerase by stimulating proliferation