Eur J Biochem 271, 3635–3645 (2004) Ó FEBS 2004 doi:10.1111/j.1432-1033.2004.04297.x Characterization of recombinant forms of the yeast Gas1 protein and identification of residues essential for glucanosyltransferase activity and folding Cristina Carotti1, Enrico Ragni1, Oscar Palomares2, Thierry Fontaine3, Gabriella Tedeschi4, ´ ´ ´ Rosalıa Rodrıguez2, Jean Paul Latge3, Marina Vai5 and Laura Popolo1 Dipartimento di Scienze Biomolecolari e Biotecnologie, Universita` degli Studi di Milano, Milano, Italy; 2Departamento de Bioquimica y Biologia Molecular, Facultad de Ciencias Quimicas, Universidad Complutense, Madrid, Spain; 3Institut Pasteur, Laboratoire des Aspergillus, Paris, France; 4Dipartimento di Patologia Animale, Igiene e Sanita` Pubblica Veterinaria, Universita` degli Studi di Milano, Milano, Italy; 5Dipartimento di Biotecnologie e Bioscienze, Universita` degli Studi di Milano-Bicocca, Milano, Italy Gas1p is a glycosylphosphatidylinositol-anchored plasma membrane glycoprotein of Saccharomyces cerevisiae and is a representative of Family GH72 of glycosidases/transglycosidases, which also includes proteins from human fungal pathogens Gas1p, Phr1-2p from Candida albicans and Gel1p from Aspergillus fumigatus have been shown to be b-(1,3)-glucanosyltransferases required for proper cell wall assembly and morphogenesis Gas1p is organized into three modules: a catalytic domain; a cys-rich domain; and a highly O-glycosylated serine-rich region In order to provide an experimental system for the biochemical and structural analysis of Gas1p, we expressed soluble forms in the methylotrophic yeast Pichia pastoris Here we report that 48 h after induction with methanol, soluble Gas1p was produced at a yield of % 10 mgỈL)1 of medium, and this value was unaffected by the further removal of the serine-rich region or by fusion to a · His tag Purified soluble Gas1 protein showed b-(1,3)-glucanosyltransferase activity that was abolished by replacement of the putative catalytic residues, E161 and E262, with glutamine Spectral studies confirmed that the recombinant soluble Gas1 protein assumed a stable conformation in P pastoris Interestingly, thermal denaturation studies demonstrated that Gas1p is highly resistant to heat denaturation, and a complete refolding of the protein following heat treatment was observed We also showed that Gas1p contains five intrachain disulphide bonds The effects of the C74S, C103S and C265S substitutions in the membrane-bound Gas1p were analyzed in S cerevisiae The Gas1-C74S protein was totally unable to complement the phenotype of the gas1 null mutant We found that C74 is an essential residue for the proper folding and maturation of Gas1p The cell wall is an extracellular compartment that plays several essential functions in yeast and fungal cells It determines the cell morphology and preserves osmotic integrity In fungal pathogens, the cell wall is involved in the interaction with the host cells and in virulence The biogenesis of the extracellular matrix is a fascinating aspect of yeast morphogenesis The elucidation of the enzymatic activities involved in its assembly could be relevant for the development of new antifungal drugs [1] The enzymes responsible for the architecture and remodelling of the cell wall are still largely unknown Several lines of evidence suggest that a class of recently identified enzymes, endowed with b(1,3)-glucanosyltransferase activity, could play a role in the cross-linking of cell wall components [2,3] This activity was detected for the first time in the Gel1 protein of Aspergillus fumigatus and subsequentially in the homologous proteins Gas1 of Saccharomyces cerevisiae and Phr1-2 of Candida albicans [3,4] On the basis of the sequence similarity, these enzymes have been grouped in a new family, called Family GH72, in the classification of glycoside hydrolases (Class Glycosidases/ Transglycosidases; http://afmb.cnrs-mrs.fr/CAZY/) Gas1p, Gel1p and Phr1-2p catalyze the splitting of an internal b(1,3)-glycosidic bond of a donor laminarioligosaccharide followed by the transfer of the new reducing end to the nonreducing end of an acceptor molecule, with the formation of another b(1,3)-glycosidic bond [3] As the anomeric configuration of the linkage was conserved, these enzymes were also classified as retaining enzymes Correspondence to L Popolo, Dipartimento di Scienze Biomolecolari e ` Biotecnologie, Universita degli Studi di Milano, Via Celoria 26, Milano, Italy Fax: +39 02 50314912, Tel.: +39 02 50314919, E-mail: Laura.Popolo@unimi.it Abbreviations: DTNB, 5,5¢-dithiobis(2-nitrobenzoate); Endo H, endob-N-acetylglucosaminidase H; GH, glycoside hydrolases; GluTD, b-(1,3)-glucan transferase domain; GPI, glycosylphosphatidylinositol; H, · His (Received 20 May 2004, revised 15 July 2004, accepted 21 July 2004) Keywords: b(1,3)-glucanosyltransferase; Gas1 protein; Pichia pastoris; yeast cell wall Ó FEBS 2004 3636 C Carotti et al (Eur J Biochem 271) The reaction mechanism proposed for these enzymes is a general acid/base catalysis [5] Protonation of the glycosidic oxygen by a catalytic acid residue is followed by the release of the cleaved product and stabilization of the carbon cation by the catalytic nucleophile The new reducing end is then transferred to the hydroxyl group at the 3-position of the nonreducing end of another acceptor molecule, yielding a linear transfer product longer than the original substrate [3,4] At low concentrations of substrate, the reaction is preferentially hydrolytic, the hydroxyl group of a water molecule being the final acceptor In glycoside hydrolases, as for many cellulases, mannanases or glucanases, the proton donor and the nucleophile residues are usually aspartates or glutamates [6–8] These residues are located in different microenvironments that influence the protonation state of the carboxyl group of their side-chain [7] The aim of the present study was to express Gas1p at high levels for biochemical and structural characterization of the protein as a representative of the GH72 family Spectroscopic analyses of the purified proteins were performed, and the behaviour of the purified protein upon heat treatment was also monitored By combining heterologous expression and site-directed mutagenesis, the role of two putative catalytic residues was investigated Moreover, the disulphide bonds present in Gas1p were quantified and the intra- or intermolecular bonding was determined The effects of the replacement of C74, C105 and C265 with a serine residue on the expression and complementation of the mutant phenotype of the gas1 null mutant of S cerevisiae were examined These data provide a first insight into the biochemical features of proteins of the GH72 family and demonstrate that the most N-terminal highly conserved cysteine is crucial for the folding and maturation of Gas1p Materials and methods Strains and growth conditions Pichia pastoris strain GS115 (his4) (Invitrogen, Leek, the Netherlands) was used for the heterologous expression of Gas1p To select His+ transformants, regeneration dextrose plates [2% (w/v) dextrose, M sorbitol, 1.34% (w/v) Difco yeast nitrogen base (YNB), · 10)5 % (w/v) biotin, 2% (w/v) agar] were used For Mut+ or Muts phenotype screening, the minimal dextrose [2% (w/v) dextrose, 1.34% (w/v) YNB, · 10)5 % (w/v) biotin, 2% (w/v) agar] and minimal methanol plates [0.5% (v/v) methanol, 1.34% (w/v) YNB, · 10)5 % (w/v) biotin, 2% (w/v) agar] were used To induce the expression of recombinant proteins, the His+ Muts colonies were shifted from a glycerol-complex medium [1% (w/v) yeast extract, 2% (w/v) peptone, 1% (v/v) glycerol, 1.34% (w/v) YNB, · 10)5 % (w/v) biotin] to a methanol-complex medium [1% (w/v) yeast extract, 2% (w/v) peptone, 0.5% (v/v) methanol, 1.34% (w/v) YNB, · 10)5 % (w/v) biotin], according to the manufacturer’s instructions Cells were grown in batches at 30 °C with strong agitation, and the growth was monitored through the increase in attenuance at 600 nm The S cerevisiae haploid strain, WB2d, carrying an inactivated GAS1 gene (gas1::LEU2), was used for the expression of the glycosylphosphatidylinositol (GPI)- anchored forms Gas1-C74S, Gas1-C103S and Gas1C265S S cerevisiae cells were cultured in batches at 30 °C in SC medium [0.67% (w/v) YNB, 2% (w/v) glucose and the required supplements at 50 mgỈL)1 for amino acids and uracil and 100 mgỈL)1 for adenine] Construction of expression vectors Recombinant plasmids for integrative recombination in P pastoris were generated by cloning BamHI/XhoI-digested PCR fragments into the corresponding sites of the P pastoris expression vector, pHIL-S1, to obtain in-frame fusion with the secretion signal of the P pastoris PHO1 gene The recombinant plasmids were named as follows: pSC18 (sGas1523), pSC36 (sGas1523-H), pSC7 (sGas1482) and pSC68 (sGas1482-H) The plasmid pXH, carrying the full coding sequence of the GAS1 gene, was used as a template for PCR amplifications [9] The soluble forms – Gas1523p (lacking the C-terminal GPI-attachment signal) and Gas1482p (also lacking the Serbox region) – were obtained using the forward primer XHup (5¢-GCATATTCGACTGACTCGAGACGATGT TCCAGCGATTGAA-3¢) and the reverse primers XHdown (5¢-ATCGTCGGGCTCAGGATCCTTAAGATGAAGA TGAAGCTGAAGA-3¢) or XH-Sdown (5¢-GTCGTCG AGCTCAGGATCCTTAATCAACACTACCTGATGC AGA-3¢), respectively XHup is complementary to nucleotides +68 to +87 of the coding region of GAS1 and has an XhoI site incorporated (underlined) XHdown and XHSdown are complementary to nucleotides +1549 to +1569 and to nucleotides +1426 to +1446, respectively, and have an in-frame TAA stop codon (shown in bold) and a BamHI site (underlined) For each construct, a · His (H)-tagged soluble form was prepared using the same forward primer, Xhup, and the reverse primer His-XHdown (5¢-ATCGTCGGG CTCAGGATCCTTAGTGATGGTGATGGTGATGAGA TGAAGATGAAGCTGAAGA-3¢), for Gas1523-H, or His-XH-Sdown (5¢-GTCGTCGAGCTCAGGATCCTTA GTGATGGTGATGGTGATGATCAACACTACCTGAT GCAGA-3¢), for sGas1482-H (the histidine coding sequence is shown in italics) Plasmid DNA was purified using plasmid purification kits (Qiagen) DNA sequencing was routinely used to confirm the correct fusions and the absence of undesired mutations throughout the coding sequence (BMR-Servizio ` sequenziamento; Universita di Padova, Padova, Italy) Mutagenesis of E161 and E262 The mutant soluble forms of sGas1523 – sGas1E161Q-H and sGas1E262Q-H – were obtained by overlap extension PCR [10] In the first PCR step, two partially overlapping fragments of GAS1 were amplified using two sets of primers For sGas1E161Q-H, a pairing of the forward primer XHup and reverse primer RMGLN161 (5¢-TGTTAGTAACTTGATTACCGGCGAAG-3¢), and a pairing of the forward primer FMGLN161 (5¢-CTT CGCCGGTAATCAAGTTACTAACA-3¢) and reverse primer His-XHdown were used Similarly, for sGas1E262Q-H, the amplification was carried out using a pairing of the forward primer XHup and reverse primer Ó FEBS 2004 Production and characterization of Gas1p (Eur J Biochem 271) 3637 RMGLN262 (5¢-TACAACCGTATTGAGAGAAGA AAAC-3¢), and a pairing of the forward primer FMGLN262 (5¢-GTTTTCTTCTCTCAATACGGTTG TA-3¢) and reverse primer His-XHdown RMGLN161 and FMGLN161 are complementary to nucleotides +467 to +493 of the coding region of GAS1, while RMGLN262 and FMGLN262 are complementary to nucleotides +771 to +796 In these primers, a Gln codon (shown in bold), instead of the Glu codon, was incorporated For Gas1E161Q-H, 20 cycles of a 45 s melting step at 94 °C, a annealing step at 50 °C and a 2.5 extension step at 72 °C were performed using the Pfu Turbo DNA polymerase (Stratagene) For Gas1E262Q-H, the temperature of the annealing step was 62 °C with primers XHup and RMGLN262, and 57 °C with primers FMGLN262 and His-XHdown The mutations of interest are located in the region of overlap between the amplified fragments The pairing of overlapping fragments was used for a second PCR step, using the forward primer XHup and the reverse primer His-XHdown, to amplify the full-length mutated sequence of GAS1 Twenty-five cycles of a 45 s melting step at 94 °C, a annealing step at 50 °C for Gas1E161Q-H and 53 °C for Gas1E262Q-H, and a extension step at 72 °C were performed and the Taq DNA polymerase was used The corresponding P pastoris expression plasmids derived from pHIL-S1 were named pE161Q and pE262Q Mutagenesis of C74, C103 and C265 The mutant GPI-anchored forms – Gas1-C74S, Gas1C103S and Gas1-C265S – were constructed by PCR-based mutagenesis For Gas1-C74S, two fragments of GAS1 were amplified using two sets of primers: the primer pair OligoUP (5¢-TACCATTTATCGATTACTGGCATACAATGGT3¢), complementary to nucleotides )830 to )800, and Oligo1 (5¢-TCTGGAGCTCgaCTCATAATTGGCCAAAGG-3¢), partially complementary to nucleotides +199 to +228; and the primer pair Oligo2 (5¢-GAGtcGAGCTCCAG AGATATTCCATACCT-3¢), partially complementary to nucleotides +214 to +242, and OligoDOWN (5¢-ATAC GCTCCATCTACATATGCTGACG-3¢) complementary to nucleotides +2408 to +2433 Oligo1 and Oligo2 have a SacI site (underlined) containing a serine codon (in bold) instead of the C74 codon and two exchanged bases (lower case) that allow the retention of residue S73 For Gas1C103S, the reverse primer Oligo3 (5¢-AGCCTTC ATCGATTCGGAGTGATCTAGAGTG-3¢), partially complementary to nucleotides +288 to +318, and Oligo4 (5¢-CTCCGAATCGATGAAGGCTTTGAATGATGC-3¢) partially complementary to nucleotides +300 to +329 substituted for Oligo1 and Oligo2, respectively Oligo and Oligo4 have a ClaI site (underlined) containing a serine codon (shown in bold) instead of the C103 codon For Gas1-C265S, the reverse primer Oligo5 (5¢-TCGTTGGATCCGTATTCAGAGAAGAAAAC-3¢), partially complementary to nucleotides +772 to +800, and the forward primer Oligo6 (5¢-AATACGGATCCAA CGAAGTAACACCAAGAC-3¢), partially complementary to nucleotides +784 to +814, were used instead of Oligo1 and Oligo2 Oligo5 and Oligo6 have a BamHI site (underlined) containing a serine codon (in bold) instead of the C265 codon Pfu Turbo DNA polymerase was used All mutant forms of the GAS1 gene were cloned into the YCplac33 ARS-CEN shuttle vector and the resulting plasmids were used to transform the WB2d (gas1::LEU2) strain As a control, the same strain was transformed with the wild-type GAS1 gene cloned in the same single copy vector Transformation of P pastoris and expression of recombinant Gas1 proteins Plasmids, linearized with BglII, were transformed into P pastoris cells using the ÔEasyCompÕ chemical transformation method (Invitrogen) His+ Muts mutants were obtained by selecting His+ transformants that grew well on minimal dextrose, but poorly on minimal methanol plates To induce the expression of recombinant proteins, the positive clones were cultured at 30 °C overnight in 10 mL of glycerol-complex medium with strong agitation and the cells were spun down and resuspended in 20 mL of methanol-complex medium to an attenuance of 1.0 at 600 nm Fresh methanol was added daily to 0.5% (v/v) The culture medium was collected 48 h after the induction, centrifuged and culture supernatants were quickly frozen and stored at )20 °C prior to purification Purification of His-tagged Gas1 proteins A 10–20 mL sample of the culture supernatant was dialyzed at °C for 16 h against lysis buffer (50 mM sodium phosphate buffer, pH 8.0, 200 mM NaCl) Two millilitres of 50% (w/v) Ni-nitrilotriacetic acid agarose (Qiagen) was added to the dialyzed supernatant, the mixture was incubated at °C for h under gentle vertical rotation and then applied to the column (0.7 · 10 cm or · 10 cm; Econo Column, Bio-Rad) The resin was washed twice with mL of wash buffer (50 mM sodium phosphate buffer, pH 8.0, 200 mM NaCl, 3–5 mM imidazole) The His-tagged protein was eluted with elution buffer (50 mM sodium phosphate buffer, pH 8.0, 200 mM NaCl, 200 mM imidazole) and mL fractions were collected The position of Gas1 protein in the elution profile was determined Protein fractions, corresponding to the major peaks, were collected Protein concentration was determined by using the dye reagent protein assay (Bio-Rad) Endo-b-N-acetylglucosaminidase H treatment Endo-b-N-acetylglucosaminidase H (Endo H) treatment was performed on culture supernatant or on purified proteins For the treatment of culture supernatant, 80 lL of a deglycosylation buffer [300 mM sodium citrate, pH 5.5, 0.5% (w/v) SDS, 2% (v/v) 2-mercaptoethanol] was added to 80 lL of culture supernatant and boiled for After repartition into two equal volumes, one aliquot was added to 100 mU of Endo H (Roche) and the other was used as a control After 18 h of incubation at 37 °C, an equal volume of 2· Laemmli buffer was added and the samples were boiled for prior to electrophoresis For the treatment of purified proteins, lg of protein in 50 mM sodium acetate, pH 5.5, was used Samples were divided into two aliquots: one was used as a control and the other was treated with lL of Endo H (10 mU) For treatment of the denatured protein, Ó FEBS 2004 3638 C Carotti et al (Eur J Biochem 271) SDS and 2-mercaptoethanol were added to final concentrations of 0.02% (w/v) and 0.1 M, respectively, prior to division into two aliquots and the addition of the enzyme To test the effect of removal of N-linked chains on enzyme activity, % 20 lg of native protein was treated with 10 mU Endo H in 0.1 M sodium acetate, pH 5.5 After checking a small aliquot of the sample for the complete removal of N-linked chains, the remainder was used to assay the b(1,3)-endoglucanase activity Electrophoresis and immunoblotting procedures Total protein extracts from S cerevisiae cells were obtained as described previously [11] Aliquots of P pastoris culture supernatants, or fractions from the purification procedure, were denaturated by boiling for in SDS sample buffer [0.0625 M Tris/HCl, pH 6.8, 2.3% (w/v) SDS, 5% (v/v) 2-mercaptoethanol, 10% (v/v) glycerol and 0.01% (v/v) Bromophenol blue] Proteins were separated by SDS/ PAGE in or 8% polyacrylamide gels For analysis of the proteins under nonreducing conditions, 2-mercaptoethanol was omitted from the SDS sample buffer, and samples were processed as previously described [12] Samples were boiled for and then divided into two samples of equal volume Dithiothreitol (20 mM final concentration) was added to one sample, which was then reheated for When loaded side-by-side, all samples received 100 mM N-ethylmaleimide after cooling After electrophoresis, proteins were either stained with Coomassie Blue R-250 or using a silver nitrate kit (Amersham Pharmacia Biotech, Bucks., UK) For detection by Western blotting, proteins were transferred to nitrocellulose membranes and processed as described previously [13] Rabbit anti-Gas1p immunoglobulin, diluted : 3000, was used to detect Gas1p A monoclonal anti-(polyHistidine) immunoglobulin, diluted : 3000 (Sigma), was used to detect the · His tag Horseradish peroxidase-conjugated anti-rabbit or anti-mouse secondary immunoglobulins were used Bound antibodies were revealed using the ECL Western blotting detection reagents (Amersham Pharmacia Biotech) To check the equivalence of protein loading, primary antibodies were stripped and filters were treated with anti-phosphofructokinase (Pfk1p) immunoglobulin (kindly provided by J J Heinisch, Universitat Hohenheim, Stuttgart, Germany), diluted : 30 000 Pulse–chase experiment and immunoprecipitation A total of 2.5 · 10 logarithmically growing cells (equivalent to a value of 12 at an attenuance of 450 nm) were resuspended in mL of SC medium, incubated at 30 °C for 20 min, then pulse-labelled for with 350 lCi of [35S]methionine Pulse labelling was terminated upon the addition of 40 lL of chase solution containing 0.3% (w/v) methionine and 0.3 M (NH4)2SO4 Immediately following the addition of chase mixture, or after 10, 30 and 60 chase periods, mL of culture was withdrawn and further reactions were stopped by the addition of NaF and NaN3 to final concentrations of 10 mM Cells were rapidly collected by centrifugation in a microfuge at °C and resuspended in 50 lL of TBS/SDS buffer [(50 mM Tris/HCl, pH 7.2, 150 mM NaCl, 1% (w/v) SDS] with protease inhibitors: mM phenylmethanesulfonyl fluoride, lgỈmL)1 pepstatin, 50 lgỈmL)1 aprotinin, and 10 lgỈmL)1 leupeptin Cells were broken by vortexing with glass beads (0.45 mm diameter) for four, periods, and then lysates were denaturated for at 100 °C This treatment fully solubilized Gas1p [14] Then, 450 lL of RIPA-minus buffer [10 mM Tris/HCl, pH 7.2, 150 mM NaCl, 1% (v/v) Triton X-100, 1% (w/v) sodium deoxycholate plus protease inhibitors], was added and, in this way, the percentage of SDS was lowered to 0.1 After a 15 incubation at °C, beads and cellular debris were sedimented by a centrifugation in a microfuge, followed by a further centrifugation of the surpernatant for 15 at °C Eight microlitres of preimmune serum was added to the cleared supernatant, and the tubes were gently mixed for h at °C Fifty microlitres of a 30% (v/v) suspension of Protein A–Sepharose was added and, after incubation for h, immune complexes were sedimented at low speed at °C The supernatant was transferred to a new Eppendorf tube and lL of anti-Gas1p IgG were added Incubation was continued overnight at °C Then, 50 lL of the Protein A–Sepharose suspension was added, incubation continued for h and, after sedimentation, the Protein A–Sepharose immune complexes were washed five times with mL of RIPA buffer [the same composition of RIPA-minus buffer but containing 0.1% (v/v) SDS], containing protease inhibitors Immunoprecipitated Gas1p was then solubilized by heating the pellet in 50 lL of SDS sample buffer (2·), and Protein A–Sepharose beads were removed by centrifugation Supernatants were analysed by SDS/PAGE and gels were stained with Coomassie Brilliant blue, fluorographed with Amplify (Amersham) and exposed to X-ray films Enzyme assays To test for b(1,3)-glucanosyltransferase activity, the purified proteins were incubated at concentrations of 0.09–0.32 mgỈmL)1 with mM reduced laminarioligosaccharide G13 in 50 mM sodium acetate buffer, pH 5.5, at 37 °C Aliquots of 2.5 lL were withdrawn at different timepoints, supplemented with 45 lL of 50 mM NaOH and then analysed by high-performance anion-exchange chromatography (HPAEC) though a CarboPAC-PA1 column (Dionex 4.6 mm · 250 mm), as described by Hartland et al [4] Spectroscopical analyses CD spectra were obtained at different temperatures in the far-UV range (200–250 nm) on a Jasco J-715 spectropolarimeter (Japan Spectroscopic Co., Tokyo, Japan), as described previously [15] The protein concentration was 0.20–0.28 mgỈmL)1 in 50 mM sodium acetate buffer, pH 5.5 Mean residue mass ellipticity was calculated based on 107.98 as the average molecular mass per residue, obtained from the amino acid composition, and expressed in terms of [h]MWR (degree · cm2 · dmol)1) Thermal unfolding of sGas1523-H was monitored by recording the ellipticity at 220 nm while heating from 20 °C to 80 °C and cooling again at °CỈmin)1 using a computer-controlled circulation waterbath Fluorescence emission spectra were obtained on an SLM Aminco 8000 spectrofluorimeter at Ó FEBS 2004 Production and characterization of Gas1p (Eur J Biochem 271) 3639 25 °C and in 0.2-cm optical path-cells, using nm slits for both excitation and emission beams The sample concentration was 0.20 mgỈmL)1 in 50 mM sodium acetate buffer, pH 5.5 Quantification of disulphide bonds and free sulphydryl groups The disulphide bonds were quantified using 5,5¢-dithiobis(2-nitrobenzoate) (DTNB), as described previously [16] Purified sGas1 protein was dialyzed overnight against 50 mM phosphate buffer, pH 8.0 When the quantification was performed using an Endo H-treated protein, a second round of affinity purification was carried out in order to remove Endo H The reaction with DTNB was carried out in phosphate buffer, pH 8.0, at 25 °C using a lM protein solution The final volume of the reaction was mL The formation of the product was monitored at 412 nm using E ¼ 13 113 M)1Ỉcm)1 In order to expose thiol groups, which may be buried in the interior of the protein, the sample was denaturated by boiling for before reaction with DTNB To analyze disulphide thiols, freshly prepared 100 mM 1,4-dithioerythritol solution was added to the denaturated sample and the reduction was carried out for h at 25 °C Excess dithioerythritol was removed by gel filtration on PD10 before incubation with DTNB Results and discussion Production of recombinant soluble forms of Gas1p in P pastoris Gas1 is a plasma membrane GPI-anchored glycoprotein of % 125–130 kDa It contains a large N-terminal catalytic domain of about 310 residues (D23–P332), known as the b-(1,3)-glucan transferase domain (GluTD), a cystine-rich region containing a motif of eight cysteines (C370–C462) and a serine-rich region in which 28 serines are clustered in a region between residues S485 and S525 (Fig 1A) The serine-rich region is a target for O-glycosylation and is dispensable for activity [2,13] A secretory signal peptide (M1–A22) and a signal sequence for GPI attachment are present at the N- and C-terminal ends, respectively In order to undertake a biochemical characterization of Gas1p, we attempted to express it in P pastoris DNA sequences, encoding different soluble forms of Gas1p, were subcloned in the pHIL-S1 expression vector in-frame with the DNA sequence encoding the P pastoris Pho1p signal sequence The expression of the proteins was driven by the methanolinducible AOX1 promoter Constructs encoding forms of Gas1p lacking the GPI-attachment signal (sGas1523) or the GPI-attachment signal and the serine-rich region (sGas482) and their His-tagged (H) versions are shown in Fig 1B Fig Scheme of the mutant Gas1 proteins (A) Modular organization of Gas1p (B) Soluble recombinant proteins expressed in Pichia pastoris The different constructs were placed under the control of the AOX1 methanol-inducible promoter and expressed in strain GS115 (C) Glycosylphosphatidylinositol (GPI)-anchored proteins expressed in Saccharomyces cerevisiae Constructs were placed under the control of the natural GAS1 promoter and cloned in the centromeric YCpLac plasmid Recombinant plasmids were used for transformation of gas1 null mutant cells The position of the cysteine replacement is shown Ó FEBS 2004 3640 C Carotti et al (Eur J Biochem 271) A major band of % 110 kDa was detected in the medium of cells transformed with the construct encoding sGas1523 after 24 h of induction Forty-eight hours after induction (Fig 2A, lanes 4–6), levels reached a concentration equivalent to 10 lgỈmL)1, determined using an ovalbumin standard (data not shown) At 72 h the protein level was equivalent to that observed at 48 h, and no degradation products were detected, indicating that the secreted protein was stable (data not shown) The 110 kDa protein was identified as Gas1p because it was absent in the medium obtained from cells transformed with the vector alone (Fig 2A,B, lanes 1–3) and was recognized by anti-Gas1p immunoglobulin (Fig 2B, lanes and 6) Removal of the serine-rich region gave origin to a protein of % 90 kDa (sGas1482), which was produced at levels equivalent to sGas1523 (Fig 2A, lanes 7–9) The presence of the His-tag (sGas1-H) did not appreciably modify the expression level of sGas1523 and sGas1482, suggesting no deleterious effects of the additional amino acids on Gas1p expression and secretion (Fig 2A, lanes 10–12 and 13–15) Where the tag was present the proteins were also recognized by a PolyHis monoclonal antibody (data not shown) The difference in molecular mass between sGas1523 and sGas1482 is % 20 kDa and exceeds the kDa predicted by the length of the segment removed This is consistent with previous evidence that the serine-rich region is a highly O-glycosylated segment in the Gas1 protein [13] The glycosylation profile of the proteins was examined Aliquots of medium containing the recombinant proteins were treated with Endo H and analysed by Western blotting using anti-Gas1p immunoglobulin (Fig 2C) The apparent molecular mass of both sGas1523-H and sGas1482-H decreased by % 18–20 kDa, indicating that the proteins are N-glycosylated in P pastoris Interestingly, the contribution of the N-linked glycans was % 10 kDa lower than in sGas1p expressed in S cerevisiae (data not shown) This is in agreement with the evidence that N-linked oligosaccharide chains are shorter in P pastoris than in S cerevisiae [17] Spectroscopical characterization of Gas1p Fig Analysis of culture supernatants from Pichia pastoris-transformed cells (A) Coomassie Blue staining of 100 lL of culture supernatant at 24 and 48 h from the shift (time zero) of cells containing the pHIL-S1 vector (lanes 1–3), the cassette expressing sGas1523 (lanes 4–6), sGas1482 (lanes 7–9), sGas1523-H (lanes 10–12) and sGas1482-H (lanes 13–15) (B) Immunoblot analysis of culture supernatants at 0, 24 and 48 h time-points from induction A 40 lL sample was analysed by SDS/PAGE and blotted proteins were incubated with anti-Gas1p IgG As representative samples, culture supernatants from cells containing the pHIL-S1 vector (lanes 1–3), or the cassette expressing sGas1523 (lanes 4–6), are shown (C) Endo-b-N-acetylglucosaminidase H (Endo H) treatment of culture supernatants containing the indicated recombinant proteins A 40 lL sample of culture supernatant obtained 48 h after induction was incubated with (+) or without (–) Endo H and analysed by SDS/PAGE Proteins were detected by immunoblot using anti-Gas1p immunoglobulin Because no direct structural information of Family GH72 proteins are available, we determined the signature spectra of recombinant Gas1p Gas1p was purified by affinity chromatography on Ni-NTA agarose (Fig 5B below) The CD spectrum of sGas1523-H in the far-UV range (peptide bond region) that provides information about its secondary structure, is shown in Fig 3A Deconvolution of the spectrum of the protein at 20 °C by the convex-constraint analysis method [18] gave the following composition: 15% a-helix, 29% b-sheet, 28% b-turn and 28% nonregular conformation Thermal unfolding of the protein was followed by CD analysis in order to study the stability of sGas1523-H Changes in ellipticity were recorded at 220 nm upon heating from 20 °C to 80 °C The unfolding transition of sGas1523-H was monophasic, with a melting point at 56.5 °C, and also highly cooperative (Fig 3B) As shown in the CD spectrum of Fig 3A, the structural changes upon heating to 80 °C resulted in a decrease of regular secondary structure content (8% a-helix and 17% b-sheet) Interestingly, these structural changes were totally reversible because sGas1523-H recovered the initial structure at 20 °C after cooling from 80 °C (Fig 3A) Figure 3C shows the fluorescence emission spectrum obtained for sGas1523-H (spectrum 1) The emission of the protein was dominated by the tryptophan contribution (spectrum 2, excitation at 295 nm) with a maximum at 320 nm and a shoulder at 332 nm The intrinsic tryptophan fluorescence of a protein is a sensitive indicator of the local environment of its tryptophan residues The mature Gas1 protein contains five tryptophan residues The fact that the tryptophan emission in sGas1523-H was shifted to a lower wavelength than expected for solvent-exposed tryptophans strongly suggests that these residues are located in a hydrophobic environment in the protein The low tyrosine contribution, Ó FEBS 2004 Production and characterization of Gas1p (Eur J Biochem 271) 3641 Fig Spectroscopical characterization of Gas1p (A) Far-UV (200–250 nm) CD spectra of purified sGas1523-H at 20 °C (j), after heating at 80 °C (d) and cooling again at 20 °C (s) [h]MRW, mean residue mass ellipticity (B) Thermal unfolding of sGas1523-H in 50 mM sodium acetate buffer, pH 5.5; changes in ellipticity at 220 nm were continuously monitored upon heating from 20 °C to 80 °C (C) Fluorescence emission spectra of sGas1523-H Spectrum was obtained for excitation at 275 nm Spectrum (tryptophan contribution) was obtained for excitation at 295 nm and normalized at wavelengths above 380 nm Spectrum (tyrosine contribution) was calculated as the difference spectrum (spectrum minus spectrum 2) Fluorescence is expressed in arbitrary units All the spectra were recorded at 25 °C and pH 5.5 30 residues in Gas1p, is also displayed in this figure (spectrum 3) All these results support the notion that sGas1523-H produced in P pastoris assumes a stable conformation consisting of a structure that contains both a-helices and b-sheets, and that the latter ones predominate Quantification of disulphides and free sulphydryl groups present in Gas1p Proteins of Family GH72 are rich in cysteines but no determination of disulfide bonds has yet been reported The yeast Gas1 protein contains 14 cysteines We used DTNB to quantify the number of disulphides plus free sulphydryl groups in Gas1p The recombinant protein lacking the O-glycosylated region, which is dispensable for activity and is devoid of cysteines, was analysed As shown in Table 1, sGas1482-H contains four thiols – one of which is readily accessible to the reagent in native conditions – and five disulphide bridges The same results were obtained after treatment with Endo H (Table 1), which completely removes the N-linked chains (data not shown) This indicates that accessibility to the reagent is not influenced Table Quantification of disulphides and suphydryl groups in Gas1p The number of DTNB molecules per protein molecule as a mean of three different determinations (SD < 10%) are shown in parenthesis Endo H, endo-b-N-acetylglucosaminidase H Protein and condition Number of cysteines 482 sGas1 -H Native conditions After denaturation After denaturation and reduction Endo H-treated sGas1482-H Native conditions After denaturation After denaturation and reduction (0.72) (4.30) 14 (13.6) (0.71) (3.92) 14 (14.4) by the N-linked chains Equivalent results were obtained for sGas1523-H In order to determine whether the disulphide bridges were intra- or intermolecular, the electrophoretic mobility of Gas1p was analysed under reducing and nonreducing conditions When samples are denaturated in the absence of a reducing agent a decrease in electrophoretic mobility of the nonreduced sample, with respect to the corresponding reduced sample, indicates the presence of interchain disulphide bridges, whereas an increase in mobility is related to the presence of intrachain bonds As shown in Fig 4, nonreduced Gas1p has a higher mobility than reduced Gas1p, indicating that the disulphide bonds are intrachain Both the GPI-anchored form of Gas1p present in the yeast cellular extract, and the purified sGas1523-H and sGas1482-H proteins, gave similar results (Fig 4A,B) In conclusion, Gas1p has five intrachain disulphide bonds Conserved features of the catalytic domain of Family GH72 and identification of the catalytic residues in Gas1p The sequences spanning the catalytic domain (GluTD) of 40 proteins have been aligned Two glutamic acid residues (shown in bold) are conserved in the A/S-G-N-E-V/I and S-E-Y/F-G-C subsequences Similarly to other protein families of the GH-A clan, to which Family GH72 belongs, it has been proposed that these residues might be important for catalysis A role of proton donor and nucleophile has been proposed for these residues [2,19] Moreover, six glycine residues (159-197-243-264-290-304), five tyrosine residues (92-113-198-231-294) and five cysteine residues (74-103-216-234-265), are strictly conserved in all GluTD sequences Clan GH-A comprises many proteins that share a low degree of conservation of the primary structure, but contain a conserved fold consisting of a (b/a)8 with the putative catalytic residues located at the end of strands b-4 and b-7 This fold has also been predicted for Gel1p [19,20] Ó FEBS 2004 3642 C Carotti et al (Eur J Biochem 271) Fig SDS/PAGE mobility of Gas1p under reducing and nonreducing conditions Non-reduced (nr) and reduced (r) samples of total extracts, corresponding to % 60 lg of protein from W303-1B cells (A) and 0.5 lg of the indicated purified recombinant proteins (B), were loaded on adjacent lanes and subjected to SDS/PAGE in a 7% polyacrylamide gel Immunoblots obtained with anti-Gas1p immunoglobulin are shown The film in (A) was deliberately overexposed The conserved glutamates correspond to residues E161 and E262 in Gas1p In order to test the involvement of E161 and E262 in the active site of Gas1p, we constructed two mutant His-tagged forms of Gas1 – sGas1E161Q-H and sGas1E262Q-H (Fig 1B) The mutant proteins were secreted in the P pastoris culture medium at the same level as sGas1523-H, suggesting that they are properly folded (Fig 5A) To confirm this, recombinant Gas1 proteins were purified and their signature CD spectra were determined (Fig 5B,C) No significant differences were detected among the spectra of sGas1523, sGas1E161Q-H or sGas1E262Q-H, demonstrating that sGas1523 and the mutant proteins assume the same folding (Fig 5C) Next, we tested whether the mutant proteins were enzymatically active Endo-b-(1,3)-glucanase activity was assayed by a reducing sugar assay [4] and b-(1,3)-glucanosyltransferase activity by an assay described in the Materials and methods No endob(1,3)-glucanase activity was observed for the two mutant proteins (data not shown) Analysis of the b(1,3)-glucanosyltransferase activity is shown in Fig Using G13 laminarioligosaccharide as a substrate, sGas1523-H produced smaller and larger oligosaccharides (Fig 6A) that corresponded to the released and transferred products, as previously characterized [4], and conrmed the following two-step enzyme activity: E ỵ G13 ! E-Gx ỵ G13x 1ị E-Gx ỵ G13 ! E þ G13þx ð2Þ Fig Expression and purification of sGas1523 and the mutant forms sGas1E161Q and sGas1E262Q from Pichia pastoris culture supernatants (A) Immunoblot with anti-Gas1p IgG of culture supernatants (48 h from induction) from P pastoris-transformed strains expressing the His-tagged forms sGas1523, sGas1E161Q and sGas1E262Q (B) Representative purification of sGas1523-H Silver staining of the different steps of the purification are shown Lane 1, culture supernatant; lane 2, dialyzed fraction; lanes 3–5, three eluted fractions (E2, E3 and E4) (C) CD spectra of His-tagged sGas1523 (d), sGas1E161Q (n) and sGas1E262Q (m) In contrast, with sGas1E161Q-H and sGas1E262Q-H, no transferase activity was observed, indicating that both glutamic acid residues are essential for the two-step activity (Fig 6B,C) In addition, the sGas1482-H protein was analyzed for activity before and after removal of the N-linked chains by Endo H The complete deglycosylation occurred using both the native and the SDS-denaturated Gas1 protein, suggesting that N-linked chains are completely accessible to Endo H The native deglycosylated Ó FEBS 2004 Production and characterization of Gas1p (Eur J Biochem 271) 3643 Fig High-performance anion-exchange chromatography (HPAEC) analysis of products from the incubation of the recombinant sGas1523p, sGas1E161Q-H and sGas1E262QH mutant proteins with reduced laminarioligosaccharides The recombinant purified proteins were incubated with mM reduced laminarioligosaccharide of size G13, and HPAEC analysis from samples taken at the indicated time-points are shown The size of some of the major products is indicated Gas1 protein was as active as the fully glycosylated form, indicating that N-linked chains are not required for activity (data not shown) Essential role of C74 in the folding and stability of the GPI-anchored Gas1p To gain insight into the putative role played by the cysteine residues in the original GPI-anchored form of Gas1p, we performed experiments based on site-directed mutagenesis We chose C74, the most N-terminal cysteine, the one next to it (C103), and C265, which is close to the E262 catalytic residue in the primary sequence Each cysteine residue was replaced with a serine A gas1D mutant strain of S cerevisiae was transformed with a centromeric plasmid harbouring the wild-type GAS1 gene or the mutant constructs (C74S, C103S and C265S, Fig 1C) We reasoned that if folded properly and localized correctly, the mutant proteins should be able to fully complement the in vivo defects typical of the mutant lacking Gas1p [21] Upon microscopic analysis, Gas1-C74S-expressing cells displayed the typical gas1D abnormal morphology, whereas gas1D cells expressing the mutant proteins (Gas1-C103S or Gas1C265S) showed partial reversal of the morphological defects, and cells expressing the wild-type GAS1 exhibited the normal morphology (data not shown) Consistently with these observations, the Gas1-C74S protein did not complement the slow growth phenotype of gas1D cells, the duplication time (Td) in SC medium at 30 °C being 3.5 h either for cells expressing Gas1-C74S or for gas1 cells Fig C74 is essential for maturation of the glycosylphosphatidylinositol (GPI)-anchored form of Gas1p in Saccharomyces cerevisiae (A) Immunoblot of total protein extracts from the gas1D strain of S cerevisiae transformed with the empty vector (YCplac33) or with the same vector carrying the GAS1 gene or its mutant forms encoding Gas1-C74S, Gas1-C103S or Gas1-C265S The filter was treated first with anti-Gas1 IgG and, after stripping of the antibodies, was treated with anti-Pfk1p immunoglobulin to verify the loading The arrow indicates the position of the a-subunit (B) Pulse-labelling and immunoprecipitation of cells harbouring the YCplac33-GAS1 or the YCplac33-GAS1-C74S plasmid Cells were labelled for with [35S]methionine and chased for the indicated times before being processed for immunoprecipitation with anti-Gas1p IgG 3644 C Carotti et al (Eur J Biochem 271) transformed with the empty vector Control gas1 cells carrying the wild-type GAS1 gene showed a Td of 1.8 h The Td of cells expressing Gas1-C103S or Gas1-265S was 2.6 h, indicating a partial complementation of the slow-growth phenotype The total inability of Gas1-C74S and the partial ability Gas1-C103S or GasC265-S proteins to rescue the gas1 phenotype could be primarily a result of alterations in expression or folding of the mutant proteins To exclude effects at the mRNA level, a Northern blot analysis was performed Cells containing either the wild-type GAS1 gene or the mutated alleles had comparable levels of GAS1 mRNA (data not shown) Therefore, the mutations not affect transcript accumulation The endoplasmic reticulum (ER) is the folding compartment for proteins, such as Gas1p, destined for the plasma membrane Failure to acquire a proper native conformation leads to recognition by the quality control machinery in the ER, provoking retention and eventually degradation [22,23] Total protein from gas1D-transformed cells was analysed by immunoblotting using anti-Gas1p immunoglobulin As shown in Fig 7A, mature Gas1p (130 kDa) was present in cells expressing the wild-type GAS1 and the mutant Gas1-C103S or Gas1-C265S forms, while no immunoreactive band corresponding to the mature protein was detected in Gas1-C74S-expressing cells However, a faint band with the typical mobility of the ER 105 kDa form was detectable in cells expressing Gas1-C74S Cells expressing Gas1-C103S or Gas1-C265S also showed an accumulation of the ER form that was not detectable in cells expressing the wild-type Gas1p These results suggest that Gas1-C74S does not fold properly and is retained in the ER, whereas the processing of the Gas1-C103S and Gas1-C265S precursors is slower than for wild-type Gas1p To test, more accurately, the effect of C74S replacement on Gas1p maturation, a pulse–chase experiment was performed Cells expressing wild-type Gas1p or the Gas1-C74S mutant were labelled for with [35S]methionine and the behaviour of the labelled forms was monitored at different time-points after the chase (Fig 7B) The ER form of Gas1p migrated at 105 kDa, and the mature form, after processing in the Golgi, migrated at 130 kDa (as determined by SDS/ PAGE), in agreement with the well-known maturation process of Gas1p [24–26] After a pulse, both the ER form of Gas1p and of the mutant (C74S) were detectable at equivalent levels During the chase, the maturation of Gas1p proceeded and the mature form was already detectable at 10 At 30 all the precursor had been converted into the mature protein No maturation of the mutant form occurred and the protein level progressively decreased for 60 when the immature form was almost undetectable This indicates that the GPI-anchored Gas1C74S is synthesized at the level of ER, but is not further processed and undergoes degradation Conclusions Proteins of Family GH72 play an active role in yeast and fungal morphogenesis but, to date, no detailed biochemical characterization has been reported Previously, Gas1p has proven to be useful for studies on protein transport along the secretory pathway in yeast In this work, Gas1p was Ó FEBS 2004 used as a model protein to undertake a first biochemical characterization of an enzyme of Family GH72 Here we have shown that P pastoris is a suitable host for the highlevel expression and secretion of Gas1p The protein yield was estimated to be about 100 times higher than for an equivalent construct expressed in S cerevisiae under the control of the natural GAS1 promoter in a multicopy vector (L Popolo & M Vai, unpublished data) The purified His-tagged sGas1 is active and could be used for future structural characterization of the protein Our results suggest that the high-level expression of secreted forms of proteins in P pastoris could constitute a valuable tool in the study of fungal and plant GPI proteins involved in cell wall biogenesis Multiple sequence alignment performed on the 40 members of Family GH72 suggested that glutamates 161 and 262 in Gas1p could play the role of catalytic residues These predictions have been supported experimentally because the replacement of these residues with glutamine abolished the activity of Gas1p, whereas no significant changes in the protein conformations were detected by CD spectroscopy analysis These results extend those obtained for Gel1p of A fumigatus, in which the replacement of E160 and E261 with a Leu and a Phe, respectively, totally abolished the in vitro glucanosyltransferase activity, and for C albicans where a glutamine substitution at position E169 or E270 yielded a Phr1 protein that was not able to complement in vivo the morphological defects of a phr1D mutant [19,27] These results could be valuable in the design of inhibitors for b(1,3)-glucanosyltransferase activity, and Gas1p could be considered a potential interesting molecular target for the development of new antifungal agents Purified sGas1p was found to be quite resistant to heat treatment The structural changes induced in the protein after heating to 80 °C were totally reversible upon cooling to 20 °C This is a structural feature typical of proteins with disulphide bridges Here we have demonstrated that 10 out of the 14 cysteines present in Gas1p are engaged in intrachain disulphide bridges The presence of disulphide bonds in Gas1p is also consistent with a study on the effects of reducing conditions on the transport of Gas1p from the ER to the Golgi, which had indirectly revealed the requirement of at least one disulphide bond for the exit of Gas1p from the ER [25] Multiple alignment indicated that five cysteines are conserved in the catalytic domain of members of Family GH72 No data are available, to date, on the role of these residues Here we have shown that C74 of the catalytic domain is crucial for the proper folding of Gas1p C74 is the most N-terminal cysteine in Gas1p and could be required for non-native disulphide bond formation during folding pathway, as has been suggested to occur for some mammalian multidomain proteins [28], or for the sequential and independent folding of the single domains – assuming a vectorial mode of folding for Gas1p In any case, the replacement of C74 with a serine could entrap the protein in a folding intermediate that is no longer processed and is degraded Frand & Kaiser reported that the ER form of Gas1p accumulates in cells treated with dithiothreitol or in cells defective in Ero1p, and is stable [25] Our finding, that the Gas1-C74S protein is unstable, is not necessarily in contrast with their results In the presence of the reducing Ó FEBS 2004 Production and characterization of Gas1p (Eur J Biochem 271) 3645 agent, or in an ero1 mutant, all disulphide bonds are affected and probably present in a reduced state Moreover, both conditions are rather harsh and could also affect the degradation pathway Given this prominent role of C74 in directing the folding of Gas1p, it is premature to assess whether it is involved in the formation of a structurally important disulphide bond, and more direct analysis, such as mapping of disulphide bridges, will be necessary to address this point Acknowledgements We wish to thank Michel Monod and Maria Antonietta Vanoni for plasmids and helpful suggestions, Carmela Gissi for the multiple alignment, Prof Gavilanes for helpful comments on spectral analysis, Serena Crotti for technical assistance, David Horner for English revision and Antonio Grippo for preparing the figures This work was partially supported by EU project No QLK3-CT-20009-01537 ÔEUROCELLWALLÕ to L.P., and FIRST 2001 and 2002 grant to L.P C Carotti was the recipient of a fellowship financed by the same EU project References Klis, F.M (1994) Review: cell wall assembly in yeast Yeast 10, 851–869 Popolo, L & Vai, M (1999) The Gas1 glycoprotein, a putative wall polymer cross-linker Biochim Biophys Acta 1426, 385–400 Mouyna, I., Fontaine, T., Vai, M., Monod, M., Fonzi, W.A., Diaquin, M., Popolo, L., Hartland, R.P & Latge, J.P (2000) Glycosylphosphatidylinositol-anchored glucanosyltransferases play an active role in the biosynthesis of the fungal cell wall J Biol Chem 275, 14882–14889 Hartland, R.P., Fontaine, T., Debeaupuis, J.P., Simenel, C., Delepierre, M & Latge, J.P (1996) A novel beta-(1-3)-glucanosyltransferase from the cell wall of Aspergillus fumigatus J Biol Chem 271, 26843–26849 Zechel, D.L & Withers, S.G (2000) Glycosidase mechanisms: anatomy of a finely tuned catalyst Acc Chem Res 33, 11–18 Chen, L., Fincher, G.B & Hoj, P.B (1993) Evolution of polysaccharide hydrolase substrate specificity Catalytic amino acids are conserved in barley 1,3–1,4- and 1,3-beta-glucanases J Biol Chem 268, 13318–13326 Varghese, J.N., Garrett, T.P., Colman, P.M., Chen, L., Hoj, P.B & Fincher, G.B (1994) Three-dimensional structures of two plant beta-glucan endohydrolases with distinct substrate specificities Proc Natl Acad Sci USA 91, 2785–2789 Davies, G.J., Mackenzie, L., Varrot, A., Dauter, M., Brzozowski, A.M., Schulein, M & Withers, S.G (1998) Snapshots along an enzymatic reaction coordinate: analysis of a retaining beta-glycoside hydrolase Biochemistry 37, 11707–11713 Vai, M., Gatti, E., Lacana, E., Popolo, L & Alberghina, L (1991) Isolation and deduced amino acid sequence of the gene encoding gp115, a yeast glycophospholipid-anchored protein containing a serine-rich region J Biol Chem 266, 12242–12248 10 Horton, R.M., Hunt, H.D., Ho, S.N., Pullen, J.K & Pease, L.R (1989) Engineering hybrid genes without the use of restriction enzymes: gene splicing by overlap extension Gene 77, 61–68 11 Valdivieso, M.H., Ferrario, L., Vai, M., Duran, A & Popolo, L (2000) Chitin synthesis in a gas1 mutant of Saccharomyces cerevisiae J Bacteriol 182, 4752–4757 12 Braakman, I., Hoover-Litty, H., Wagner, K.R & Helenius, A (1991) Folding of influenza hemagglutinin in the endoplasmic reticulum J Cell Biol 114, 401–411 13 Gatti, E., Popolo, L., Vai, M., Rota, N & Alberghina, L (1994) O-linked oligosaccharides in yeast glycosyl phosphatidylinositolanchored protein gp115 are clustered in a serine-rich region not essential for its function J Biol Chem 269, 19695–19700 14 Watanabe, R., Funato, K., Venkataraman, K., Futerman, A.H & Riezman, H (2002) Sphingolipids are required for the stable membrane association of glycosylphosphatidylinositol-anchored proteins in yeast J Biol Chem 277, 49538–49544 15 Batanero, E., Villalba, M., Ledesma, A., Puente, X.S & Rodriguez, R (1996) Ole e 3, an olive-tree allergen, belongs to a widespread family of pollen proteins Eur J Biochem 241, 772–778 16 Tedeschi, G., Oungre, E., Mortarino, M., Negri, A., Maffeo, G & Ronchi, S (2000) Purification and primary structure of a new bovine spermadhesin Eur J Biochem 267, 6175–6179 17 Trimble, R.B., Atkinson, P.H., Tschopp, J.F., Townsend, R.R & Maley, F (1991) Structure of oligosaccharides on Saccharomyces SUC2 invertase secreted by the methylotrophic yeast Pichia pastoris J Biol Chem 266, 22807–22817 18 Perczel, A., Hollosi, M., Tusnady, G & Fasman, G.D (1991) Convex constraint analysis: a natural deconvolution of circular dichroism curves of proteins Protein Eng 4, 669–679 19 Mouyna, I., Monod, M., Fontaine, T., Henrissat, B., Lechenne, B & Latge, J.P (2000) Identification of the catalytic residues of the first family of beta (1-3) glucanosyltransferases identified in fungi Biochem J 347, 741–747 20 Henrissat, B., Callebaut, I., Fabrega, S., Lehn, P., Mornon, J.P & Davies, G (1995) Conserved catalytic machinery and the prediction of a common fold for several families of glycosyl hydrolases Proc Natl Acad Sci USA 92, 7090–7094 21 Popolo, L., Vai, M., Gatti, E., Porello, S., Bonfante, P., Balestrini, R & Alberghina, L (1993) Physiological analysis of mutants indicates involvement of the Saccharomyces cerevisiae GPIanchored protein gp115 in morphogenesis and cell separation J Bacteriol 175, 1879–1885 22 Kostova, Z & Wolf, D.H (2003) New EMBO member’s review: for whom the bell tolls: protein quality control of the endoplasmic reticulum and the ubiquitin-proteasome connection EMBO J 22, 2309–2317 23 Liu, C.Y & Kaufman, J.R (2003) The unfolded protein response J Cell Sci 116, 1861–1862 24 Popolo, L., Vai, M & Alberghina, L (1986) Identification of a glycoprotein involved in cell cycle progression in yeast J Biol Chem 261, 3479–3482 25 Frand, A.R & Kaiser, C.A (1998) The ERO1 gene of yeast is required for oxidation of protein dithiols in the endoplasmic reticulum Mol Cell 1, 161–170 26 Doering, T.L & Schekman, R (1996) GPI anchor attachment is required for Gas1p transport from the endoplasmic reticulum in COP II vesicles EMBO J 15, 182–191 27 Fonzi, W.A (1999) PHR1 and PHR2 of Candida albicans encode putative glycosidases required for proper cross-linking of beta1,3- and beta-1,6-glucans J Bacteriol 181, 7070–7079 28 Jansens, A., van Duijn, E & Braakman, I (2002) Coordinated nonvectorial folding in a newly synthesized multidomain protein Science 298, 2401–2403 Supplementary material The following material is available from http://www blackwellpublishing.com/products/journals/suppmat/EJB/ EJB4297/EJB4297sm.htm Fig S1 Multiple sequence alignment among the catalytic domains of Family GH 72 members  ... influence the protonation state of the carboxyl group of their side-chain [7] The aim of the present study was to express Gas1p at high levels for biochemical and structural characterization of the protein. .. acid residues are essential for the two-step activity (Fig 6B,C) In addition, the sGas1482-H protein was analyzed for activity before and after removal of the N-linked chains by Endo H The complete... wild-type Gas1p or the Gas1- C74S mutant were labelled for with [35S]methionine and the behaviour of the labelled forms was monitored at different time-points after the chase (Fig 7B) The ER form of Gas1p