Drosophila proteins involved in metabolism of uracil-DNA possess different types of nuclear localization signals ´ ´ ´ ´ ´ Gabor Merenyi1, Emese Konya1 and Beata G Vertessy1,2 Institute of Enzymology, Biological Research Center, Hungarian Academy of Sciences, Budapest, Hungary Department of Applied Biotechnology, Budapest University of Technology and Economics, Budapest, Hungary Keywords cellular trafficking; Drosophila melanogaster; dUTPase; nuclear localization signal; uracil-DNA degrading factor Correspondence ´ B.G Vertessy, Institute of Enzymology, Biological Research Center, Hungarian ´ Academy of Sciences, Karolina ut 29, H-1113 Budapest, Hungary Fax: +36 466 5465 Tel: +36 279 3116 E-mail: vertessy@enzim.hu (Received August 2009, revised 23 February 2010, accepted March 2010) doi:10.1111/j.1742-4658.2010.07630.x Adequate transport of large proteins that function in the nucleus is indispensable for cognate molecular events within this organelle Selective protein import into the nucleus requires nuclear localization signals (NLS) that are recognized by importin receptors in the cytoplasm Here we investigated the sequence requirements for nuclear targeting of Drosophila proteins involved in the metabolism of uracil-substituted DNA: the recently identified uracil-DNA degrading factor, dUTPase, and the two uracil-DNA glycosylases present in Drosophila For the uracil-DNA degrading factor, NLS prediction identified two putative NLS sequences [PEKRKQE(320– 326) and PKRKKKR(347–353)] Truncation and site-directed mutagenesis using YFP reporter constructs showed that only one of these basic stretches is critically required for efficient nuclear localization in insect cells This segment corresponds to the well-known prototypic NLS of SV40 T-antigen An almost identical NLS segment is also present in the Drosophila thymine-DNA glycosylase, but no NLS elements were predicted in the single-strand-specific monofunctional uracil-DNA glycosylase homolog protein This latter protein has a molecular mass of 31 kDa, which may allow NLS-independent transport For Drosophila dUTPase, two isoforms with distinct features regarding molecular mass and subcellular distribution were recently described In this study, we characterized the basic PAAKKMKID(10–18) segment of dUTPase, which has been predicted to be a putative NLS by in silico analysis Deletion studies, using YFP reporter constructs expressed in insect cells, revealed the importance of the PAA(10–12) tripeptide and the ID(17–18) dipeptide, as well as the role of the PAAK(10–13) segment in nuclear localization of dUTPase We constructed a structural model that shows the molecular basis of such recognition in three dimensions Introduction In eukaryotic organisms, proteins with cognate nuclear function must penetrate the nuclear envelope after translation in the cytoplasm Nuclear import and export of proteins can proceed by active or passive transport, or as a member of protein complex actively targeted into the nucleus [1–3] For this latter mechanism, which is the major one for proteins larger than 30–35 kDa, specific and direct nuclear targeting requires the presence of a nuclear localization signal (NLS), which is the relevant sequence information in Abbreviations NLS, nuclear localization signal; LD-DUT, long isoform of dUTPase; NTT-DUT, N-terminally truncated short isoform of dUTPase; SMUG1, single-strand-specific monofunctional uracil-DNA glycosylase 1; T-ag, T-antigen; TDG, thymine-DNA glycosylase; UDE, uracil-DNA degrading factor 2142 FEBS Journal 277 (2010) 2142–2156 ª 2010 The Authors Journal compilation ª 2010 FEBS ´ G Merenyi et al the primary structure of proteins Several NLS sequence motifs have been identified to date, and there is no unique well-defined consensus amino acid sequence for all NLS [4,5] However, major common characteristics of these sequences are (i) a high content of basic amino acid residues such as lysine (K) and arginine (R), and (ii) the presence of conserved proline(s) (P) potentially involved in breaking secondary structural elements within the NLS One group of simple NLS includes monopartite motifs, generally defined as a short amino acid region consisting of 4–6 basic residues in a row, like the classic NLS of SV40 large T-antigen (SV40 T-ag) [6] Another type of NLS, such as the NLS of nucleoplasmin in Xenopus laevis, comprises bipartite motifs, which contain two distinct stretches of positively charged clusters separated by a mutation-tolerant linker region [7] In addition, sequences containing several neutral or even negatively charged conserved residues may also act as functional monopartite NLS, with the negatively charged aspartate ⁄ glutamate (D ⁄ E) also contributing to NLS function [8] Interestingly, the NLS of human RanBP3 [9] is an unusual signal with close homology to the NLS of c-Myc [10] Nuclear proteins containing NLS motifs could enter into the nucleus via the nuclear pore, utilizing a strictly organized mechanism maintained by karyopherin molecules and the nuclear pore complex [11] The nuclear pore complex is a large protein complex consisting of multiple subunits and located in the nuclear membrane It is also the main possibility for exchange of small particles, e.g ions, nucleotides, etc., between the nuclear and cytosolic compartments Importin b, a type of karyopherin molecule, is a nuclear transport receptor, which can bind its molecular cargo either directly or indirectly through adaptor proteins such as importin a Importin b is unable to bind directly to classical nuclear targeting motifs such as the NLS of SV40 T-ag or the NLS of nucleoplasmin, but could mediate nuclear import indirectly in association with importin a Importin a possesses two major domains for its adaptor function, the importin b binding (IBB) domain in its N-terminus and the C-terminal NLSbinding domain In the absence of importin b, an auto-inhibiting part of the IBB domain forms an intramolecular interaction with the NLS-binding domain, preventing the association with NLS on the cargo protein Thus, the presence or absence of importin b regulates the NLS binding ability of importin a The relatively large NLS-binding domain of importin a consists of ten armadillo repeats, each constituting three a-helices In association with each other, the armadillo repeats form a large concave superhelical Characterization of NLS segments molecular surface The NLS peptide of the cargo binds in extended conformation to the binding pockets of the superhelical surface of importin a These binding pockets contain several conserved residues (e.g asparagine, tryptophan and negatively charged residues) involved in hydrophobic and electrostatic interactions with the positively charged residues of the NLS (see [1] for recent review) Here, we wished to identify and characterize NLS for Drosophila melanogaster proteins involved in uracil-DNA metabolism Four such major proteins have been described to date: (i) the newly identified uracil-DNA degrading factor (UDE) [12,13], (ii) dUTPase, which is responsible for prevention of uracil incorporation into DNA [14], and (iii) two DNA glycosylases, thymine-DNA glycosylase (TDG) [15] and the single-strand-specific monofunctional uracil-DNA glycosylase (SMUG1) homolog protein The UDE protein, encoded by the CG18410 gene in the D melanogaster genome, was recently identified in a pull-down screen on uracil-DNA from larval extracts [12] In vitro studies have shown that this protein specifically degrades uracil-containing DNA, but lacks any appreciable homology to previously described uracil-DNA-recognizing proteins CG18410 gene expression may be under developmental control, and the protein has been suggested to play a role in metamorphosis in Drosophila The subcellular localization of this protein had not been characterized dUTPase catalyzes the cleavage of dUTP into dUMP to control cellular dUTP ⁄ dTTP ratios, and is an essential enzyme in both prokaryotes and eukaryotes [16,17] Lack of dUTPase leads to uracil-substituted DNA that perturbs base excision repair, resulting in DNA fragmentation and thymine-less cell death [14] Most dUTPases are homotrimers with native molecular masses of approximately 50–65 kDa [18–24] Both human and D melanogaster cells contain a nuclear isoform of dUTPase, and the NLS segment of the human enzyme has been investigated in detail [25] In D melanogaster dUTPase, a similar N-terminal segment was recently proposed as the NLS region [26] In D melanogaster, two physiological isoforms of the enzyme were identified, with apparent molecular masses of 69 and 63 kDa for the native homotrimers (termed long isoform, LD-DUT, and the N-terminally truncated short isoform, NTT-DUT, respectively) [27] Only LD-DUT contains the complete putative NLS sequence [PAAKKMKID(10–18)], while NTT-DUT lacks 14 residues at the N-terminus This segment shows a high degree of flexibility and cannot be located in the 3D structure of the protein determined by X-ray crystallography (PDB ID 3ECY) [21]) FEBS Journal 277 (2010) 2142–2156 ª 2010 The Authors Journal compilation ª 2010 FEBS 2143 ´ G Merenyi et al Characterization of NLS segments Uracil-DNA glycosylases are the key repair enzymes that remove uracil from DNA by catalyzing cleavage of the N-glycosidic bond [28] To perform this function in eukaryotic cells, these enzymes must reside in the nuclear or mitochondrial compartments ([29] There are four or five major families of uracil-DNA glycosylases, but only two of these are encoded in the D melanogaster genome [30] The molecular mass of these two glycosylases, based on reported sequences [15], are 191 kDa for TDG and 31 kDa for the SMUG1 homolog No quantitative data are available indicating potential oligomerization for the monomeric species, and the family member uracil-DNA glycosylase is a monomer [31] In the present study, we aimed to (i) determine the subcellular distribution of UDE, (ii) identify sequence determinants essential for nuclear translocation in proteins involved in uracil-DNA metabolism in Drosophila, and (iii) functionally characterize these NLS Based on in silico prediction, we fused various sequence segments from the ORF of UDE and dUTPase to the yellow fluorescent protein (YFP) and generated chimeric reporter constructs In addition, to characterize the essential and sufficient amino acids of the NLS, we performed deletion studies and site-directed mutagenesis on the putative NLS regions For transient transfection studies, we used the Sf9 homogeneous insect cell line, which has superior characteristics for subcellular sorting analysis compared with the Drosophila Schneider cell line, including convenient generation time, and its morphology allows straightforward microscopic detection of cellular compartments Results and Discussion Subcellular targeting of UDE Nuclear targeting of UDE may be critical for performance of the suggested degradation function on genomic DNA containing uracil [12] In silico prediction (using PSORTII [32]; http://psort.ims.u-tokyo.ac.jp/) suggested two individual clusters of residues as a putative NLS region, separated by 21 amino acids, in the C-terminus of the protein (Fig 1A, and Tables and 2) The first cluster (NLS1), PEKRKQE(320–326), consists of both positively and negatively charged residues The second stretch (NLS2), PKRKKKR(347– 353)E, is located at the very end of the C-terminus and has a high proportion of positively charged amino acids Underlined residues are predicted to be part of the NLS Each sequence starts with the neutral amino acid proline and ends its context with glutamic acid We fused the full-length UDE, containing these two 2144 predicted sequences, to the N-terminus of YFP After Sf9 cell transfection using the chimera construct, fluorescence was observed on samples of fixed cells The 22.2 kDa YFP alone, used as a control, could penetrate non-selectively through the nuclear pore, most probably because its smaller molecular mass allows passive diffusion Fluorescence microscopy analysis showed that the YFP-tagged UDE has an exclusive nuclear localization in Sf9 cells (Fig 2A and Table 3) In the control experiment, YFP alone was observed throughout the cell (Fig 2K and Table 3) These data demonstrate that the wild-type UDE is targeted specifically and exclusively into the nucleus, in agreement with its putative nuclear function in insect cells Subcellular distribution of C-terminal truncated forms of UDE To test whether the nuclear import of UDE requires any or both of the predicted signals, various C-terminally truncated UDE species were linked to the N-terminus of the YFP reporter (Fig 1) In the first construct, UDED(316)355)–YFP, a large part of the C-terminus was deleted, including both putative NLS segments In the second construct, UDED(346)355)– YFP, the last ten residues of the C-terminus were removed, including the PKRKKKR(347–353) sequence The reporter constructs were introduced into Sf9 cells and subsequently analyzed by fluorescent microscopy The results show that lack of the fulllength flexible C-terminal region, containing both of the predicted signals, totally abolished the nuclear distribution, causing significant cytoplasmic retention of UDE (Fig 2B and Table 3) When the last ten residues of the C-terminus, including only the second predicted NLS, were deleted, the pattern of subcellular distribution was also exclusively cytoplasmic (Fig 2C) These results suggest that the PEKRKQE(320–326) sequence on its own is not able to translocate the protein into the nuclear compartment In contrast, the presence of the PKRKKKR(347–353) sequence, consisting of six contiguous positively charged amino acids, is critical for exclusive nuclear localization of UDE The PKRKKKR(347–353) segment is almost identical to the NLS of SV40 T-ag, indicating a powerful capability for function as an NLS Subcellular targeting of UDE containing specific site mutations in the NLS sequence To extend our investigations, we generated separate mutations to identify amino acids responsible for the nuclear targeting function of the PKRKKKR sequence FEBS Journal 277 (2010) 2142–2156 ª 2010 The Authors Journal compilation ª 2010 FEBS ´ G Merenyi et al Characterization of NLS segments A B UDEWT-YFP UDEΔ(316–355)-YFP UDEΔ(346–355)-YFP UDE(350AA351)-YFP UDE(350AAAA353)-YFP UDEΔ(1–319)-YFP UDEΔ[1–319 (350AAAA353)]-YFP C YFP-UDE-NLS1 YFP-UDE-NLS2 YFP-UDE-NLS2Δ350–353 Fig Scheme of D melanogaster UDE constructs used in the present study (A) Position and context of putative nuclear localization sequences (underlined) within the flexible C-terminus of D melanogaster UDE are indicated (B) Schematic representation of various UDE– YFP reporter constructs The wild-type (wt), flexible C-terminally truncated [D(316)355)] and the NLS truncated [D(346)355)] coding sequences were fused in-frame to the N-terminus of YFP protein, resulting in UDEWT–YFP, UDED(316)355)–YFP and UDED(346)355)–YFP reporter constructs The UDE(350AA351)–YFP reporter construct contains the K350A and K351A mutations, and the UDE(350AAAA353)– YFP reporter construct contains the K350A, K351A, K352A and R353A mutations The truncated reporter constructs UDED(1)319)–YFP and UDED[1)319(350AAAA353)]–YFP are also indicated The relevant regions, positions and mutations of the NLS of UDE are indicated by differently shaded boxes (C) The predicted NLS sequences (NLS1 and NLS2) and the deleted variant of NLS2 were fused in-frame to the C-terminus of the YFP ORF generating the YFP–UDE-NLS1, YFP–UDE-NLS2 and YFP–UDE-NLS2D(350)353) reporter constructs Establishment of vector constructs was performed as described in Experimental procedures (Fig 1) The K350A ⁄ K351A double mutation slightly altered the pattern of subcellular distribution, indicating attenuation of the nuclear targeting effect (Fig 2D and Table 3) The K350A ⁄ K351A ⁄ K352A ⁄ R353A quadruple mutation also perturbed the exclusive nuclear targeting of UDE, resulting in significant cytoplasmic retention (Fig 2E) Based on these results, the PKRKKKR(347–353) sequence is suggested to be a strong NLS sequence with high mutation tolerance In accordance with the putative segments defined by in silico prediction (Table 1), it was found that the presence of the KPKR(346–349) segment is sufficient for partial nuclear localization of the protein Subcellular targeting potential of the predicted UDE NLS1 and NLS2 sequences To determine whether either of the two predicted NLS sequences possess strong nuclear targeting potential on their own, the PEKRKQE (NLS1) and PKRKKKR (NLS2) coding sequences were fused as a C-terminal tag to YFP protein (Fig 1) The constructs YFP–UDENLS1 and YFP–UDE-NLS2 were transiently transfected into Sf9 cells Expression and intracellular appearance of the fluorescent proteins were observed by fluorescent microscopy The results show that the NLS2 segment has selective and powerful targeting potential for accumulation of YFP in the nucleus (Fig 2F and Table 3) The pattern of subcellular distribution of YFP–UDE-NLS1 was not exclusively nuclear or cytoplasmic, although some accumulation was observed within the nuclear compartment compared to the YFP control (compare Fig 2G and K) Further, the C-terminal portion of UDE was fused to YFP and expressed in Sf9 cells This UDED(1)319)–YFP reporter construct containing both predicted NLS sequences was exclusively retained in the nucleus (Fig 2H) After introducing quadruple mutations (K350A ⁄ K351A ⁄ K352A ⁄ R353A) into this construct UDED[1)319 (350AAAA353)]–YFP, the exclusive nuclear distribution was highly perturbed, but increased nuclear accumulation was observed compared to YFP alone FEBS Journal 277 (2010) 2142–2156 ª 2010 The Authors Journal compilation ª 2010 FEBS 2145 ´ G Merenyi et al Characterization of NLS segments Table In silico predictions of putative nuclear localization signals of Drosophila dUTPase, UDE, TDG and SMUG1 homolog proteins To identify the putative nuclear localization sites, the full length open-reading frame sequences of the proteins were obtained from the UniProt database (http://www.uniprot.org) and analyzed using PSORTII (http://psort.ims.u-tokyo.ac.jp/) Putative signal sequences, defined as potential NLS regions, are shown, with the number in parentheses indicating the number of the first residue Protein Uniprot ID of protein (UniProtKB ⁄ TrEMBL) ORF length (amino acids UDE Q961C 355 dUTPase TDG SMUG1 homolog Q9V3I1 Q9V4D8 Q9VEM1 188 1738 280 Sequences defined as putative NLS segments KPKR (346) PKRK (347) KRKK (348) RKKK (349) KKKR (350) PEKRKQE (320) PKRKKKR (347) PAAKKMK (10) PKKR (711) RKKK (716) RKKH (760) KKKR (1088) RPKK (1093) PKKK (1141) KKKR (1142) RPKK (1147) PNNRKRQ (114) PMPKKRG (709) PKKRGRK (711) PKERKKH (757) PLEKKKR (1085) PKKIKGQ (1094) PKKKRGR (1141) PKKLKPA (1148) None (Fig 2I,K) The last examined reporter construct YFP– UDE-NLS2D(350)353), which possesses only three basic residues [KPKR(346–349)] from the NLS2 segment fused to YFP, also showed localization in the nucleus and the cytoplasm, with some accumulation within the nucleus (Fig 2J) These observations indicate that the NLS2 segment is a strong monopartite NLS, and that the contribution of the predicted NLS1 to nuclear localization is negligible Within the NLS2 segment, both the KPKR and the KKKR tetrapeptides contribute to nuclear localization Prediction of NLS signals in Drosophila uracil-DNA glycosylases Table lists the predicted NLS signals for the TDG protein Several clusters of putative localization 2146 Table Comparison of UDE, dUTPase and TDG NLS segments with NLS sequences of various proteins The monopartite sequences listed show close similarity to either the SV40 T-ag NLS or the c-Myc NLS segments The NLS sequences of UDE and TDG show close homology to the SV40 T-ag NLS, but the D melanogaster dUTPase NLS belongs to the c-Myc group Interestingly, the NLS segment of human dUTPase is more similar to the first group of sequences For comparison, the classic bipartite NLS sequence of X laevis nucleoplasmin is shown, which possesses an additional short cluster of basic residues separated by 10 amino acids from the basic stretch, which has close homology with the NLS of SV40 T-ag SV40 T-ag, simian virus 40 large T-antigen [6]; v-Jun, sarcoma virus 17 oncogene homolog [39]; H2B, histone 2B [40]; UDE, uracilDNA degrading factor; human dUTPase [25]; c-Myc, myelocytomatosis cellular oncogene [10]; RanBP3, Ran binding protein [9] Protein Monopartite SV40 T-ag UDE of D melanogaster TDG of D melanogaster v-Jun of Homo sapiens dUTPase of Homo sapiens H2B of Saccharomyces cerevisiae c-Myc of Homo sapiens dUTPase of D melanogaster c-Myc of Xenopus laevis RanBP3 of Homo sapiens Bipartite Nucleoplasmin NLS sequence PKKKRKV PKRKKKR PKKRGRKKK SKSRKRKL PSKRARP GKKRSKV PAAKRVKLD PAAKKMKID VSSKRAKLE PPVKRERTS KRPAATKKAGQAKKKKLDK signals were observed Among these, the PKKRG RKKK(711–719) sequence is almost identical to the NLS of the SV40 T-ag and also to the UDE NLS segment As the SV40 T-ag has been extensively characterized [33] and we also found in our present experiments that such a sequence has very strong nuclear localization potential, we propose that this sequence also acts as an NLS in the TDG protein For the SMUG1 homolog protein, no nuclear localization signal was predicted by the PSORTII program (Table 1) Lack of predicted signals cannot be taken as evidence for the actual absence of NLS segments, as prediction performs well only for classical NLS It is also worthwhile noting that the molecular size of SMUG1 may allow passive translocation to the nucleus Subcellular distribution of the D melanogaster dUTPase isoforms For D melanogaster dUTPase, prediction identified the underlined segment within PAAKKMK(10–16)ID as a conventional NLS comprising a short cluster of non-polar and basic residues (Fig 3, and Tables and 2) To determine the subcellular distribution of D melanogaster dUTPase isoforms in the Sf9 cell line, FEBS Journal 277 (2010) 2142–2156 ª 2010 The Authors Journal compilation ª 2010 FEBS ´ G Merenyi et al Characterization of NLS segments A H E I J YFP-UDENLS2Δ(350–353) D UDEΔ(1–319)-YFP C UDEΔ[1–319 (350AAAA353)] -YFP UDEΔ(316–355)-YFP G UDE(350AAAA353) -YFP UDE(350AA351)-YFP B UDEΔ(346–355)-YFP F K Fig Subcellular localization of D melanogaster UDE protein and its various sequence derivatives Fluorescence microscopy observations show the subcellular distribution of chimeric UDE constructs (A) Wild-type UDE (UDEWT–YFP) was targeted exclusively to the nucleus (B,C) Deletion studies showed that removal of the entire flexible C-terminus or the last ten residues of the C-terminus of the UDE ORF results in exclusive cytoplasmic localization of chimeric constructs UDED(316)355)–YFP and UDED(346)355)–YFP, respectively (D) The reporter construct UDE(350AA351)–YFP, which contains a double K ⁄ A mutation, is predominantly located in the nucleus and slightly in the cytoplasm (E) Quadruple mutations in the reporter construct [UDE(350AAAA353)–YFP] have an attenuating effect on nuclear localization, with most of the construct accumulating within the nucleus, although cytoplasmic localization was also observed (F) The YFP–UDE-NLS2 reporter localized almost exclusively in the nucleus (G) The YFP–UDE-NLS1 construct was seen in both the nuclear compartment and the cytoplasm (H) The UDED(1)319)–YFP reporter, which contains both predicted NLS sequences, was exclusively retained in the nucleus (I) The UDED[1)319(350AAAA353)]–YFP construct was seen in both the nucleus and the cytoplasm, but seemed to accumulate in the nucleus (J) The reporter construct YFP–UDE-NLS2D(350)353), which possesses only three basic residues from the NLS segment, did not show any selective compartmentalization, and was distributed almost equally in the nucleus and the cytoplasm (K) YFP alone was used as a negative control The cellular distribution of YFP was approximately the same within the nuclear and cytoplasmic compartments reporter constructs were created by N-terminal fusion to YFP (Fig 3B and Table 3) Cellular targeting of both isoforms was subsequently determined via cell transfection experiments followed by fluorescent microscopic detection The results show that the long isoform of dUTPase (LD-DUT) is specifically targeted into the nucleus, but the short one (NTT-DUT) was not able to enter into the nuclear compartment and remained exclusively in the cytoplasm (Fig 4A,B) This is in agreement with studies performed in Drosophila Schneider S2 cells [26] These results indicated that the presence of the predicted complete targeting sequence is necessary and sufficient for exclusive nuclear targeting of the long FEBS Journal 277 (2010) 2142–2156 ª 2010 The Authors Journal compilation ª 2010 FEBS 2147 ´ G Merenyi et al Characterization of NLS segments Table Summary of results for the subcellular distributions of reporter constructs Details of the reporter constructs for dUTPase and UDE are shown in the first three columns The observed subcellular localizations of reporter constructs are indicated by plus and minus signs Two plus signs indicate distribution between the nuclear and cytoplasmic compartments; one plus sign indicates exclusion from either the nucleus or the cytoplasm Localization Protein Name of reporter construct NLS sequence present in reporter construct Nucleus Cytoplasm UDE UDEWT–YFP UDED(316)355)–YFP UDED(346)355)–YFP UDE(350AA351)–YFP UDE(350AAAA353)–YFP UDED(1)319)–YFP UDED[1)319(350AAAA353)]–YFP YFP–UDE-NLS1 YFP–UDE-NLS2 YFP–UDE-NLS2D(350)353) YFP LD-DUTWT–YFP NTT-DUTWT–YFP DUT-NLS–YFP DUT-NLSD(10)12)–YFP DUT-NLSD(10)13)–YFP DUT-NLSD(17)18)–YFP DUT-NLSD(10)12,17)18)–YFP DUT-NLSD(10)13,17)18)–YFP PEKRKQE; KPKRKKKR None PEKRKQE PEKRKQE; KPKRAAKR PEKRKQE; KPKRAAAA PEKRKQE; KPKRKKKR PEKRKQE; KPKRAAAA PEKRKQE KPKRKKKR KPKR None PAAKKMKID MKID PAAKKMKID KKMKID KMKID PAAKKMK KKMK KMK + ) ) + + + + + + + + + ) + + + + + + ) + + + + ) + + ) + + ) + ) + + + + + YFP dUTPase A B C DUT-NLS-YFP DUT-NLSΔ(10–12)-YFP DUT-NLSΔ(10–13)-YFP DUT-NLSΔ(17–18)-YFP DUT-NLSΔ(10–12,17–18)-YFP DUT-NLSΔ(10–13,17–18)-YFP Fig Scheme of D melanogaster dUTPase constructs used in the present study (A) The position and context of putative nuclear localization signals (underlined) are indicated in the N-terminus of the long isoform of D melanogaster dUTPase (B) The long (LD-DUTWT) and short (NTT-DUTWT) isoforms of the D melanogaster dUTPase coding sequences were fused in-frame to the N-terminus of the YFP ORF to generate the LD-DUT–YFP and NTT-DUT–YFP chimeric constructs, respectively The relevant motifs, regions and positions of the NLS of dUTPase are indicated by differently shaded boxes (C) The NLS sequence (PAAKKMKID) and its truncated sequence variants (KKMKID and KMKID) were fused in-frame to the N-terminus of the YFP ORF generating the DUT-NLS–YFP, DUT-NLSD(10)12)–YFP and the DUT-NLSD(10)13)– YFP reporter constructs Further reporter constructs, DUT-NLSD(17)18)–YFP, DUT-NLSD(10)12,17)18)–YFP and DUT-NLSD(10)13,17)18)– YFP, are also indicated, which were generated in the way, but all lack the ID(17–18) dipeptide Establishment of vector constructs was performed by the general cloning method described in Experimental procedures 2148 FEBS Journal 277 (2010) 2142–2156 ª 2010 The Authors Journal compilation ª 2010 FEBS ´ G Merenyi et al B NTT-DUTWT-YFP G H D E NLSΔ(10–13)-YFP C DUT-NLSΔ(10–13,17–18) DUT-NLSΔ(10–12,17–18) DUT-NLSΔ(17–18) -YFP -YFP -YFP LD-DUTWT-YFP F NLSΔ(10–12)-YFP A NLS-YFP Characterization of NLS segments I Fig Subcellular localization of the isoforms of D melanogaster dUTPase and its various NLS sequence derivatives Fluorescence microscopy observations reveal the subcellular distribution of chimeric constructs (A,B) The long isoform of dUTPase (LD-DUTWT–YFP) was localized to the nucleus exclusively, and the short isoform (NTT-DUTWT–YFP) was present exclusively in the cytoplasm (C) NLS sequence studies show that, in the presence of the complete nuclear localization signal, the reporter construct DUT-NLS–YFP is located in the nucleus (D) Deletion of the first three residues (PAA), producing construct DUT-NLSD(10)12)–YFP) slightly perturbed exclusive nuclear localization, with some cytoplasmic localization observed (E) Deletion of the first four residues (PAAK), producing the reporter construct DUTNLSD(10)13)–YFP, resulted in localization to the nucleus and the cytoplasm in an approximately equal ratio (F) The subcellular localization of the reporter construct DUT-NLSD(17)18)–YFP, lacking the ID(17–18) dipeptide, was nuclear, with some infiltration into the cytoplasm (G) The DUT-NLSD(10)12,17)18)–YFP construct, which lacks the tripeptide PAA and the ID(17–18) dipeptide, shows an almost equal distribution in the nucleus and the cytoplasm (H) The subcellular targeting of the DUT-NLSD(10)13,17)18)–YFP reporter was also not selective, showing close to equal distribution in the nucleus and the cytoplasm (I) YFP alone was used as a negative control The cellular distribution of YFP was approximately the same within the nuclear and cytoplasmic compartments isoform (LD-DUT) The partial segment MKID(15–18), present on the short isoform, cannot drive nuclear import In the case of the short isoform (NTT-DUT), absence of the first 14 residues of the N-terminus, including the PAAKK(10–14) segment, dramatically alters the translocation pattern of dUTPase Nuclear targeting potential of the dUTPase NLS sequence and its truncated derivatives To confirm that the complete putative NLS sequence has nuclear targeting potential of its own, the PAAKKMKID coding sequence was fused as an N-terminal tag to YFP protein (Fig 3) The construct (DUT-NLS–YFP) was transiently transfected into Sf9 cells After cell fixation, the expression and intracellular localization of the fluorescent protein were observed by fluorescent microscopy The results show that this putative NLS sequence was able to confer nuclear localization to the YFP protein (Fig 4C and Table 3) DUT-NLS–YFP is found predominantly in the nuclear compartment, demonstrating that this sequence, which possesses a cluster of basic amino acids flanked by non-polar and acidic residues, is a powerful NLS In order to identify amino acid residues that are essential for NLS function, we constructed truncated derivatives of the NLS sequence linked to the FEBS Journal 277 (2010) 2142–2156 ª 2010 The Authors Journal compilation ª 2010 FEBS 2149 ´ G Merenyi et al Characterization of NLS segments N-terminus of the YFP reporter In the first construct, DUT-NLSD10)12–YFP, the neutral PAA tripeptide was removed and the remaining part of the sequence, KKMKID, was fused to the YFP reporter In the second construct, the PAAK residues were deleted and the KMKID stretch was fused to the reporter, resulting in the chimeric fluorescent construct DUTNLSD(10)13)–YFP After transfection and subsequent fixation of Sf9 cells, the NLS potential of the individual truncated derivatives was monitored by fluorescent microscope Observations show that deletion of the PAA tripeptide slightly perturbs nuclear localization, as cytoplasmic fluorescence was also observed (Fig 4D) Although the PAA neutral tripeptide alone may not define subcellular compartmentalization for proteins, its position upstream of the short cluster of basic residues may be essential to relax the secondary structure of polypeptide chain, facilitating the molecular interaction with importins Removal of these three non-basic residues of the dUTPase NLS resulted in moderate perturbation of nuclear import and accumulation In the truncated construct lacking the PAAK segment, we observed greatly increased cytoplasmic localization of the fluorescent reporter construct (Fig 4E) This observation indicates that removal of only one positively charged residue in addition to the PAA tripeptide strongly alters recognition characteristics within the nuclear import machinery Furthermore, we established and examined three additional NLS–reporter constructs lacking the ID(17– 18) dipeptide of the putative NLS sequence The subcellular distribution of the DUT-NLSD(17)18)–YFP construct was nuclear, with some infiltration in the cytoplasm (Fig 4F) The DUT-NLSD(10)12,17)18)–YFP construct, which lacks the first PAA tripeptide, shows an almost equal distribution within the nucleus and the cytoplasm (Fig 4G) The subcellular targeting of the third reporter construct, DUT–NLSD(10)13,17)18)– YFP, which lacks the PAAK residues, was also close to equal distribution between the nucleus and the cytoplasm (Fig 4H) These results indicate that the lack of ID(17–18) might slightly decrease the exclusive nuclear localization potential of the predicted NLS sequence Additional oligopeptide deletions (PAA and PAAK) have a further negative effect on the nuclear targeting potential of the NLS sequence examined Structural model of the Drosophila dUTPase NLS segment in complex with importin a protein Binding of the NLS segment to importin a has been characterized by in-depth structural studies that allow molecular insight into the specific interactions Based on 2150 the published 3D structure of yeast importin a in complex with the c-Myc NLS segment peptide (PDB ID 1EE4) [34], and the close similarity between the NLS segments of c-Myc and Drosophila dUTPase (Table 2), we modeled this latter peptide onto the c-Myc peptide in the NLS peptide–yeast importin a structure Figure 5A shows the alignment of the yeast and Drosophila importin a protein sequences, which show 69% similarity and 54% identity within the ten armadillo domains responsible for NLS recognition Figure 5A also shows the aligned sequence of a mammalian importin a (mouse importin a, which is 94% identical to the human sequence) (PDB ID 1IAL) [35] For mammalian importins, 3D structures of complexes with other types of NLS peptides have been reported [36–38] The alignments in Fig 5A show the high degree of conservation of helical structure and residues interacting with NLS peptides Figure 5B shows the structural models of the two NLS peptides in complex with yeast importin a (c-Myc NLS peptide in turquoise, Drosophila dUTPase NLS peptide in green), indicating very close superposition of the two NLS segments The close overlap is indicated by the observation that the two colors (green and turquoise) overlap considerably, and it is mostly the green color that is seen as the dUTPase NLS peptide was selected to be the ‘upper’ one in pymol Consequently, most of the molecular interactions are equally present in both NLS peptides Importantly, all impor˚ tin a amino acids that contain atoms within A of the NLS peptides (displayed in orange in Fig 5A,B) are conserved between the yeast and Drosophila importin a proteins, strengthening the assumption that the modeled recognition does take place in the physiological complex There are two noteworthy differences between the NLS peptides of c-Myc and D melanogaster dUTPase: lysine at position 14 in the dUTPase NLS is an arginine in c-Myc, while methionine at position 15 in the dUTPase NLS is a valine in c-Myc With regard to the important role of the PAAK(10–13) segment in the NLS peptide, it is noteworthy that the e-NH2 group of the lysine residue at position 13 makes numerous contacts: it is within H-bonding distance to three oxygen atoms of conserved amino acids within importin a (the main-chain oxygen of glycine at position 168, the sidechain hydroxyl oxygen of threonine at position 173, and the side-chain carboxylate oxygen of aspartate at position 210; the numbering of the Drosophila sequence is used) However, the subsequent lysine residue at position 14 (arginine in c-Myc) cannot establish polar interactions with the carboxylate oxygen of aspartate at position 237 (the electrostatic bonding partner of the arginine residue in the c-Myc peptide) due to its shorter side chain The methinone residue at position 15, FEBS Journal 277 (2010) 2142–2156 ª 2010 The Authors Journal compilation ª 2010 FEBS ´ G Merenyi et al Characterization of NLS segments A Fig Modeling the interactions between the D melanogaster dUTPase NLS segment and importin a protein (A) Sequence alignment for armadillo domains of Mus musculus (M mus.), D melanogaster (D mel.) and yeast importin a Residues within the a-helices constituting the armadillo domains are shown on a pink background; residues ˚ that contain atoms within A of the NLS peptides of c-Myc or D melanogaster dUTPase (see Fig 5B) are on an orange background Asterisks indicate identical residues, semicolons and dots show highly conserved or conserved replacements, respectively Ten armadillo domains (ARM) are shown (B) Three-dimensional structural model of the NLS peptide–importin a complex The protein surface is shown for the first five armadillo domains in either pink (for the a-helices) or brown (for other protein parts) The NLS peptides of c-Myc or D melanogaster dUTPase and importin a residues that ˚ contain atoms within A of the peptides are shown as stick models with atomic coloring (red, oxygen; blue, nitrogen; yellow, sulfur; orange, green or turquoise, carbon atoms of importin a, dUTPase NLS and c-Myc NLS, respectively) For orientation, most residues of the dUTPase NLS are labeled, together with four residues of importin a (see text for details) Note that the dUTPase NLS peptide can adopt a docking conformation equivalent to that of the c-Myc peptide on the importin protein surface B FEBS Journal 277 (2010) 2142–2156 ª 2010 The Authors Journal compilation ª 2010 FEBS 2151 ´ G Merenyi et al Characterization of NLS segments although larger than the valine in the c-Myc peptide, can be accommodated without any steric constraints Conclusions Adequate cellular sorting of proteins is a vital step in maintenance of the normal homeostatic function of cells We identified and characterized two types of monopartite nuclear localization sequences of D melanogaster proteins involved in uracil-DNA metabolism (Tables and 3) The C-terminus of UDE possesses two predicted NLS segments, but experimental analysis showed that one of these is sufficient for exclusive nuclear localization Several point mutations in the major critical NLS sequence (which is almost identical to the SV40 T-ag NLS) altered the subcellular distribution patterns only moderately, suggesting that this NLS sequence has very high nuclear targeting potential based on the high number of positively charged amino acids in a row Enzyme activity measurements performed on a truncated UDE derivative (UDE Q310X) showed that the protein function is not perturbed by removal of the C-terminal NLS segments (Fig 6) This result suggests that folding is not much perturbed by the C-terminal truncation, in agreement with a recent study showing a high degree of disorder in the C-terminus [13] A very different short cluster of nonpolar and basic residues (PAAKKMKID), present on the long isoform of D melanogaster dUTPase, was found to perovide highly efficient NLS function in the dUTPase protein This segment is localized in a very flexible part of the protein that is not visible in the crystal structure of D melanogaster dUTPase [21,24] Deletion studies showed the importance of the presence of the PAA tripeptide and the ID dipeptide, and the role of the PAAK segment in nuclear targeting These studies also explained why the N-terminally truncated dUTPase isoform is excluded from the nucleus A structural model of the Drosophila 0′ 15′ 30′ 60′ 90′ M Fig Uracil-DNA-degrading activity of the Q310X C-terminally truncated mutant UDE protein Digestion times are given at the top Samples were denatured at 65 °C for 15 2152 dUTPase NLS segment in complex with importin a protein indicates an important role for the lysine of the PAAK segment by revealing its multiple interactions with importin a Comparing the dUTPase NLS and the ‘classical’ sequence of UDE NLS, we conclude that mutation tolerance may depend on the predominance of basic residues within the wild-type NLS segment Importantly, however, neutral and proline residues also contribute to the targeting potential Experimental procedures Materials Restriction enzymes, T4 DNA ligase and DNA polymerases were from Fermentas (Ontario, Canada), New England Biolabs (Ipswich, MA, USA) and Finnzyme (Espoo, Finland), respectively The pIZ ⁄ V5-His (pIZ) plasmid was purchased from Invitrogen (Carlsbad, CA, USA) Oligos were synthesized by Eurofin MWG Synthesis GmbH (Ebersberg, Germany) Other materials were obtained from Sigma-Aldrich and Calbiochem (Merck KGaA, Darmstadt, Germany) Cell line and culture The Sf9 cell line (derived from Spodoptera frugiperda) was purchased from Gibco (Invitrogen, Carlsbad, CA, USA) Cells were cultured at the temperature 26 °C in SFM medium (serum- and protein-free insect medium from Life Technologies Inc., Carlsbad, CA, USA) supplemented with 10% FBS (Gibco), mm l-glutamine and mLỈL)1 penicillin ⁄ streptomycin Generation of UDE reporter constructs udeWT-yfp-pIZ, udeD(346)355)-yfp-pIZ and udeD(316)355)-yfp-pIZ, pIZ-yfp vector constructs To generate the various reporter constructs for UDE, fulllength (UDEWT) and truncated derivatives [UDED(316)355) and UDED(346)355)] of the UDE coding sequence were amplified by PCR using the ude-pET19b plasmid [12] as the template, and the following primer pairs: ude-For (5¢-CTA GCTAGCATGCCGTCGAGTTGGAGACGGCTAC-3¢) with ude-Rev (5¢-GTTTAGCGGCCGCTGCTCCTCC CTCTTCTTCTTCC-3¢), ude-For with udeD(346)355)-Rev (5¢-GTTTAGCGGCCGCGCATCCTCGCCATCGGAATCC TG-3¢), and ude-For with udeD(316)355)-Rev (5¢-GTTTAGC GGCCGCCTCGAGATGGCCAGCTTTTCGATGTACT GC-3¢), respectively After DNA digestion with NheI and NotI restriction enzymes (recognition sites underlined), amplicons were cloned in-frame to N-terminus of the coding sequence of YFP into the yfp-pRM vector [26] The resulting vector constructs [udewt-yfp-, udeD(346)355)-yfp- and FEBS Journal 277 (2010) 2142–2156 ª 2010 The Authors Journal compilation ª 2010 FEBS ´ G Merenyi et al udeD(316)355)–yfp-pRM] were used as template in PCR reactions with the cloning primers ude-yfp-For (5¢-AACTT AAGCTTACCACCATGGCGTCGAGTTGGAGACGGCT ACGC-3¢) and yfp-Rev (5¢-GCTCTGCTCTAGACTCGAG TCACGCTTGTACAGCTCGTCCATGC-3¢) Each PCR product [udewt-yfp, udeD(346)355)-yfp and udeD(316)355)yfp] and the empty pIZ vector were digested using HindIII (restriction site underlined) and XbaI enzymes After digestion, amplicons were cloned into linearized pIZ vector In addition, a pIZ-yfp vector construct was also generated by PCR using the pRM-yfp vector as the DNA template, and the yfp-For and yfp-Rev cloning primers containing HindIII and XbaI restriction sites, respectively, followed by the general cloning method Characterization of NLS segments Rev (5¢-CGGCATGGACGAGCTGTACAAGAAGCCCA AAAGGAAGAAGAAGAGGGAGGAGGCGGCGTGAT TCTAGACAGAGC-3¢), UDE346–349-YFP-Rev (5-CGGC ATGGACGAGCTGTACAAGGCAAAGCCCAAAAGGA AGGCGGCGTGATTCTAGACAGAGC-3¢) and yfp-For (5¢-CTAGCAAGCTTACCACCATGGTGAGCAAGGGC GAGGAG-3¢) as the primers, and pIZ-yfp as the template Cloning processes were performed by digestion with HindIII (forward primers) and XbaI (reverse primers) cloning method The generated constructs possess a Kozak sequence to enhance the translation efficiency of fusion proteins Generation of dUTPase reporter constructs ld-dutWT-yfp-pIZ and yfp-pIZ vector constructs ude(350AA351)-yfp-pIZ vector construct The K350A and K351A site mutations were produced in the UDE ORF using a QuikChangeÒ site-directed mutagenesis kit (Stratagene, Agilent Technologies Co., La Jolla, CA, USA) according to the manufacturer’s instructions PCR reaction was performed using the udewt-yfp-pIZ plasmid as the template using primers NLS-mut2A-For (5¢-GATAA GCCCAAAAGGGCGGCGAAGAGGGAGGAG-3¢) and NLS-mut2A-Rev (5¢-CTCCTCCCTCTTCGCCGCCCTTTT GGGCTTATC-3¢), which contain the desired mutations (underlined) ude(350AAAA351)-yfp-pIZ vector construct The ude(350AAAA351)-yfp-pIZ vector construct containing the four K350A, K351A, K352A and R353A site mutations was produced by PCR reaction using ude(350AA351)-yfppIZ as the template and the cloning primers ude-yfp-For and mut4A-Rev (5¢-TTTTTGCGGCCGCTGCTCCTCCGC CGCCGCCGCCCTTTTG-3¢) The mut4A-Rev primer sequence contains the desired mutation sites (underlined) and a NotI recognition site (italic) After digestion, the amplicon was cloned in-frame into the yfp-pIZ vector using the HindIII and NotI restriction sites Further UDE reporter constructs The reporter constructs udeD(1)319)-yfp-pIZ and udeD[1)319(350AAAA353)]-yfp-pIZ were generated by PCR amplification using UDEd1-319-For (5¢-CTAGCAAGCTTA CCACCATGGCGCCCGAAAAGCGCAAGCAGGAG-3¢) and yfp-Rev as primers, and Udewt-yfp-pIZ and Ude(350AAAA351)-yfp-pIZ as templates, respectively The constructs pIZ-yfp-ude-NLS1, pIZ-yfp-ude-NLS2 and pIZyfp-ude-NLS2D(350)353) were generated by PCR amplification using UDE320–326-YFP-Rev (5¢-CGGCATGGACGA GCTGTACAAGGCACCCGAAAAGCGCAAGCAGGAG GCGTGATTCTAGACAGAGC-3¢), UDE346–353-YFP- To fuse the D melanogaster dUTPase protein to the N-terminus of YFP, the full-length coding sequence was amplified by PCR using the LDdutWT-pET22b recombinant construct as the template [24], together with the forward primer 5¢-CTAGCTAGCATGCCATCAACCGATTTCGC-3¢, and reverse primer 5¢-GTTTATGCGGCCGCGTAGCAACAG GAGCCGGAGC-3¢, containing NheI and NotI restriction recognition sites (underlined), respectively After restriction digestion of DNA, the amplicon was cloned in-frame to the coding sequence of YFP in the yfp-pRM vector [26] The resulting construct (ld-dutWT-yfp-pRM) was used as the template in a subsequent PCR reaction using primers LD-For (5¢AACTTAAGCTTACCACCATGGCATCAACCGATTTCG CCGACATTC-3¢) and yfp-Rev (5¢-GCTCTGCTCTAGA CTCGAGTCACGCTTGTACAGCTCGTCCATGC-3¢) containing HindIII and XbaI restriction sites (underlined), respectively The digested amplicon was cloned into pIZ vector linearized with the same restriction enzymes, generating the ld-dutWT-yfp-pIZ construct In addition, a yfp-pIZ vector construct was also generated by PCR using the yfppRM vector as the DNA template, and the yfp-For and yfpRev cloning primers containing HindIII and XbaI restriction sites, respectively, followed by the general cloning method ntt-dutWT-yfp-pIZ vector construct To produce the NTT-DUTWT–YFP reporter construct, NTT-DUTWT–YFP coding cDNA was amplified by PCR reaction from the ld-dutWT-yfp-pIZ plasmid using ntt-For (5¢-AACTTAAGCTTACCACCATGAAGATCGACACGT GCG-3¢) and yfp-Rev cloning primers containing HindIII and XbaI restriction sites (underlined), respectively After digestion, the amplicon was inserted into the pIZ vector dut-NLS-yfp-pIZ, dut-NLSD(10)12)-yfp-pIZ and dut-NLSD(10)13)-yfp-pIZ vector constructs To generate the series of NLS–YFP reporter constructs, individual PCR reactions were performed using yfp-pIZ FEBS Journal 277 (2010) 2142–2156 ª 2010 The Authors Journal compilation ª 2010 FEBS 2153 ´ G Merenyi et al Characterization of NLS segments plasmid as the template, with the forward primers: NLSwtFor (5¢-CTAGCAAGCTTACCACCATGGCGCCAGCTG CCAAGAAGATGAAGATCGACATGGTGAGCAAGG GCGAGGAGCTG-3¢), NLSD(10)12)-For (5¢-CTAGCAAGC TTACCACCATGGCGAAGAAGATGAAGATCGACAT GGTGAGCAAGGGCGAGGAGCTG-3¢) and NLSD(10)13)For (5¢-CTAGCAAGCTTACCACCATGGCGAAGATGA AGATCGACATGGTGAGCAAGGGCGAGGAGCTG-3¢), respectively, and the yfp-Rev primer The first part of each forward primer consists of the wild-type or truncated [dutNLSD(10)12) and dut-NLSD(10)13)] dUTPase NLS region, and the second part contains a complement segment hybridizing to the start of YFP cDNA HindIII and XbaI sites were used to clone the digested amplicons into linearized pIZ plasmid We also generated three additional reporter constructs that lack the ID(17–18) dipeptide from the NLS sequence, dut-NLSD17)18-yfp-pIZ, dut-NLSD(10)12,17)18)yfp-pIZ and dut-NLSD(10)13,17)18)-yfp-pIZ To amplify the desired coding sequences, primers NLSwt-For* (5¢-CT AGCAAGCTTACCACCATGGCGCCAGCTGCCAAGA AGATGAAGATGGTGAGCAAGGGCGAGGAGCTG-3¢), NLSD(10)12)-For* (5¢-CTAGCAAGCTTACCACCATGGC GAAGAAGATGAAGATGGTGAGCAAGGGCGAGGA GCTG-3¢) and NLSD10)13-For* (5¢-CTAGCAAGCTTACCA CCATGGCGAAGATGAAGATGGTGAGCAAGGGCGA GGAGCTG’-3), respectively, were used as the forward primers, with yfp-Rev as the reverse primer and pIZ-yfp vector as the template Cloning processes were performed using HindIII and XbaI digestion according to the general method described above All constructs except ld-dutWTyfp-pIZ possess a Kozak sequence to enhance the translation efficiency of the fusion proteins For these NLS-containing fusion proteins, the molecular mass is only slightly altered (YFP alone is 22.2 kDa, and fused to the NLS sequences its molecular mass is less than 23.2 kDa) Therefore, NLS-containing YFP constructs are still capable of passive entry into the nucleus, and the NLS potential of these constructs is reflected in the extent of nuclear accumulation of the constructs (as compared to equal distribution resulting from passive diffusion) Transfection procedure, fixation and DAPI staining For transient transfection of the Sf9 cell line, cells were plated on circular slides in 24-well plates After h attachment, cells were transfected using LipofectamineÔ 2000 (Invitrogen) reagent according to the manufacturer’s protocol One day after transfection, the transfected cells were washed (2 · min) with 1· NaCl ⁄ Pi and fixed in 3% paraformaldehyde ⁄ NaCl ⁄ Pi for 15 After washing (2 · min) with 1· NaCl ⁄ Pi, cells were permeabilized with 0.1% Triton X-100 ⁄ -NaCl ⁄ Pi for To stain the nuclei, the cells were incubated for at room temperature in lgỈmL)1 DAPI (4¢6¢-diamidino-2-phenylindole) stain solution Finally, cells were rinsed three times with 1· 2154 NaCl ⁄ Pi, and once with water Circular slides were then mounted on microscope slides using FluoroSave reagent (Calbiochem, Merck KGaA, Darmstadt, Germany) Fluorescence microscopy Fluorescent microscopic images were obtained using a Leica DMLS fluorescence microscope (Leica Microsystems Inc., Bannockburn, IL, USA) The samples were visualized using excitation and emission wavelengths of 485 and 530 nm, respectively, for YFP, and DAPI fluorescence was visualized by excitation with UV light (355 nm) and detected at 450 nm The samples were observed using a 60· oil immersion objective Construction of the Q310X C-terminally truncated UDE mutant fragment (containing an N_terminal 6· His tag) We performed this truncation using a QuikChangeÒ sitedirected mutagenesis kit (Stratagene) PCR was performed using pET19b-UDE as a template [12] with the primers 5¢CCGCAGCCGGACAAGCTGAAGTAGTACATCGAAA GGC-3¢ (forward) and 5¢-CGAAAAGCTACATGATGAA GTCGAACAGGCCGACGCC-3¢ (reverse) The DNA sequence was confirmed by sequencing Expression and purification of Q310X UDE Expression and purification of Q310X UDE used in the plasmid DNA processing assay were performed by Ni-NTA affinity chromatography as described previously [12] Plasmid DNA processing assays Twenty micrograms per mililiter linearized uracil containing plasmid DNA or control plasmid DNA (prepared as described previously [12]) and 10 lgỈmL)1 Q310X truncated UDE protein were incubated in assay buffer (25 mm TrisHCl, pH 7.5, mm MgCl2, 0.1 mgỈmL)1 albumin) for 0, 15, 30, 60, 90 minutes at 37 °C After the appropriate reaction time, samples were incubated at 65 °C for 15 Products were detected by standard ethidium bromide staining after agarose gel electrophoresis on 0.75% w ⁄ w agarose gels [12] Structural modeling swiss-pdb viewer and modeler software (http://spdbv vital-it.ch/) were used to generate the model structure of D melanogaster dUTPase NLS peptide based on the c-Myc peptide–importin a complex structure (PDB ID 1EE4) [34] Residues that are altered between the two NLS segments were mutated in silico, and the optimization module of the FEBS Journal 277 (2010) 2142–2156 ª 2010 The Authors Journal compilation ª 2010 FEBS ´ G Merenyi et al Modeler software was used to find a suitable conformation for these residues Figure 5B was prepared using pymol (www.pymol.org) Acknowledgements This work was supported by grants from the Hungarian Scientific Research Fund (OTKA K68229 and CK-78646), the Howard Hughes Medical Institute (55005628 and 55000342), the Alexander von Humboldt Foundation, the National Office for Research and ´ Technology, Hungary (JAP_TSZ_071128_TB_INTER), and the European Union (FP6 SPINE2c LSHG-CT2006-031220 and TEACH-SG LSSG-CT-2007-037198) to B.G.V References Cook A, Bono F, Jinek M & Conti E (2007) Structural biology of nucleocytoplasmic transport Annu Rev Biochem 76, 647–671 Hoshino A, Hirst JA & Fujii H (2007) Regulation of cell proliferation by interleukin-3-induced nuclear translocation of pyruvate kinase J Biol Chem 282, 17706– 17711 Vertessy BG, Bankfalvi D, Kovacs J, Low P, Lehotzky A & Ovadi J (1999) Pyruvate kinase as a microtubule destabilizing factor in vitro Biochem Biophys Res Commun 254, 430–435 Christophe D, Christophe-Hobertus C & Pichon B (2000) Nuclear targeting of proteins: how many different signals? Cell Signal 12, 337–341 Fries T, Betz C, Sohn K, Caesar S, Schlenstedt G & Bailer SM (2007) A novel conserved nuclear localization signal is recognized by a group of yeast importins J Biol Chem 282, 19292–19301 Kalderon D & Smith AE (1984) In vitro mutagenesis of a putative DNA binding domain of SV40 large-T Virology 139, 109–137 Robbins J, Dilworth SM, Laskey RA & Dingwall C (1991) Two interdependent basic domains in nucleoplasmin nuclear targeting sequence: identification of a class of bipartite nuclear targeting sequence Cell 64, 615–623 Makkerh JP, Dingwall C & Laskey RA (1996) Comparative mutagenesis of nuclear localization signals reveals the importance of neutral and acidic amino acids Curr Biol 6, 1025–1027 Welch K, Franke J, Kohler M & Macara IG (1999) RanBP3 contains an unusual nuclear localization signal that is imported preferentially by importin-a3 Mol Cell Biol 19, 8400–8411 10 Dang CV & Lee WM (1988) Identification of the human c-myc protein nuclear translocation signal Mol Cell Biol 8, 4048–4054 Characterization of NLS segments 11 Madrid AS & Weis K (2006) Nuclear transport is becoming crystal clear Chromosoma 115, 98–109 12 Bekesi A, Pukancsik M, Muha V, Zagyva I, Leveles I, Hunyadi-Gulyas E, Klement E, Medzihradszky KF, Kele Z, Erdei A et al (2007) A novel fruitfly protein under developmental control degrades uracil-DNA Biochem Biophys Res Commun 355, 643–648 13 Pukancsik M, Bekesi A, Klement E, Hunyadi-Gulyas E, Medzihradszky KF, Kosinski J, Bujnicki JM, Alfonso C, Rivas G & Vertessy BG (2010) Physiological truncation and domain organization of a novel uracil-DNAdegrading factor FEBS J 277, 1245–1259 14 Vertessy BG & Toth J (2009) Keeping uracil out of DNA: physiological role, structure and catalytic mechanism of dUTPases Acc Chem Res 42, 97–106 15 Hardeland U, Bentele M, Jiricny J & Schar P (2003) The versatile thymine DNA-glycosylase: a comparative characterization of the human, Drosophila and fission yeast orthologs Nucleic Acids Res 31, 2261–2271 16 el-Hajj HH, Zhang H & Weiss B (1988) Lethality of a dut (deoxyuridine triphosphatase) mutation in Escherichia coli J Bacteriol 170, 1069–1075 17 Gadsden MH, McIntosh EM, Game JC, Wilson PJ & Haynes RH (1993) dUtp pyrophosphatase is an essential enzyme in Saccharomyces cerevisiae EMBO J 12, 4425–4431 18 Vertessy BG, Persson R, Rosengren AM, Zeppezauer M & Nyman PO (1996) Specific derivatization of the active site tyrosine in dUTPase perturbs ligand binding to the active site Biochem Biophys Res Commun 219, 294–300 19 Nemeth-Pongracz V, Barabas O, Fuxreiter M, Simon I, Pichova I, Rumlova M, Zabranska H, Svergun D, Petoukhov M, Harmat V et al (2007) Flexible segments modulate co-folding of dUTPase and nucleocapsid proteins Nucleic Acids Res 35, 495–505 20 Whittingham JL, Leal I, Nguyen C, Kasinathan G, Bell E, Jones AF, Berry C, Benito A, Turkenburg JP, Dodson EJ et al (2005) dUTPase as a platform for antimalarial drug design: structural basis for the selectivity of a class of nucleoside inhibitors Structure 13, 329–338 21 Takacs E, Barabas O, Petoukhov MV, Svergun DI & Vertessy BG (2009) Molecular shape and prominent role of b-strand swapping in organization of dUTPase oligomers FEBS Lett 583, 865–871 22 Varga B, Barabas O, Takacs E, Nagy N, Nagy P & Vertessy BG (2008) Active site of mycobacterial dUTPase: structural characteristics and a built-in sensor Biochem Biophys Res Commun 373, 8–13 23 Varga B, Barabas O, Kovari J, Toth J, Hunyadi-Gulyas E, Klement E, Medzihradszky KF, Tolgyesi F, Fidy J & Vertessy BG (2007) Active site closure facilitates juxtaposition of reactant atoms for initiation of FEBS Journal 277 (2010) 2142–2156 ª 2010 The Authors Journal compilation ª 2010 FEBS 2155 ´ G Merenyi et al Characterization of NLS segments 24 25 26 27 28 29 30 31 catalysis by human dUTPase FEBS Lett 581, 4783– 4788 Kovari J, Barabas O, Takacs E, Bekesi A, Dubrovay Z, Pongracz V, Zagyva I, Imre T, Szabo P & Vertessy BG (2004) Altered active site flexibility and a structural metal-binding site in eukaryotic dUTPase: kinetic characterization, folding, and crystallographic studies of the homotrimeric Drosophila enzyme J Biol Chem 279, 17932–17944 Tinkelenberg BA, Fazzone W, Lynch FJ & Ladner RD (2003) Identification of sequence determinants of human nuclear dUTPase isoform localization Exp Cell Res 287, 39–46 Muha V, Zagyva I, Venkei Z, Szabad J & Vertessy BG (2009) Nuclear localization signal-dependent and -independent movements of Drosophila melanogaster dUTPase isoforms during nuclear cleavage Biochem Biophys Res Commun 381, 271–275 Bekesi A, Zagyva I, Hunyadi-Gulyas E, Pongracz V, Kovari J, Nagy AO, Erdei A, Medzihradszky KF & Vertessy BG (2004) Developmental regulation of dUTPase in Drosophila melanogaster J Biol Chem 279, 22362–22370 Pearl LH (2000) Structure and function in the uracilDNA glycosylase superfamily Mutat Res 460, 165–181 Muller-Weeks S, Mastran B & Caradonna S (1998) The nuclear isoform of the highly conserved human uracilDNA glycosylase is an Mr 36,000 phosphoprotein J Biol Chem 273, 21909–21917 Aravind L & Koonin EV (2000) The alpha ⁄ beta fold uracil DNA glycosylases: a common origin with diverse fates Genome Biol 1, RESEARCH0007 Mol CD, Arvai AS, Sanderson RJ, Slupphaug G, Kavli B, Krokan HE, Mosbaugh DW & Tainer JA (1995) 2156 32 33 34 35 36 37 38 39 Crystal structure of human uracil-DNA glycosylase in complex with a protein inhibitor: protein mimicry of DNA Cell 82, 701–708 Nakai K & Horton P (1999) PSORT: a program for detecting sorting signals in proteins and predicting their subcellular localization Trends Biochem Sci 24, 34–36 Conti E, Uy M, Leighton L, Blobel G & Kuriyan J (1998) Crystallographic analysis of the recognition of a nuclear localization signal by the nuclear import factor karyopherin a Cell 94, 193–204 Conti E & Kuriyan J (2000) Crystallographic analysis of the specific yet versatile recognition of distinct nuclear localization signals by karyopherin a Structure 8, 329–338 Kobe B (1999) Autoinhibition by an internal nuclear localization signal revealed by the crystal structure of mammalian importin a Nat Struct Biol 6, 388– 397 Fontes MR, Teh T, Jans D, Brinkworth RI & Kobe B (2003) Structural basis for the specificity of bipartite nuclear localization sequence binding by importin-a J Biol Chem 278, 27981–27987 Chen M-H, Ben-Efraim I, Mitrousis G, Walker-Kopp N, Sims PJ & Cingolani G (2005) Phospholipid scramblase contains a nonclassical nuclear localization signal with unique binding site in importin a J Biol Chem 280, 10599–10606 Chida K & Vogt PK (1992) Nuclear translocation of viral Jun but not of cellular Jun is cell cycle dependent Proc Natl Acad Sci USA 89, 4290–4294 Moreland RB, Langevin GL, Singer RH, Garcea RL & Hereford LM (1987) Amino acid sequences that determine the nuclear localization of yeast histone 2B Mol Cell Biol 7, 4048–4057 FEBS Journal 277 (2010) 2142–2156 ª 2010 The Authors Journal compilation ª 2010 FEBS ... domains for its adaptor function, the importin b binding (IBB) domain in its N-terminus and the C-terminal NLSbinding domain In the absence of importin b, an auto-inhibiting part of the IBB domain... in maintenance of the normal homeostatic function of cells We identified and characterized two types of monopartite nuclear localization sequences of D melanogaster proteins involved in uracil-DNA. .. the nuclear targeting potential of the NLS sequence examined Structural model of the Drosophila dUTPase NLS segment in complex with importin a protein Binding of the NLS segment to importin a