Interaction of Sesbania mosaic virus movement protein with the coat protein – implications for viral spread Soumya Roy Chowdhury and Handanahal Subbarao Savithri Department of Biochemistry, Indian Institute of Science, Bangalore, India Keywords coat protein; protein–protein interaction; recombinant movement protein; sobemovirus Correspondence H S Savithri, Department of Biochemistry, Indian Institute of Science, Bangalore 560012, India Fax: +91 8023600814 Tel: +91 8022932310 E-mail: bchss@biochem.iisc.ernet.in (Received 10 June 2010, revised 28 September 2010, accepted November 2010) Sesbania mosaic virus (SeMV) is a single-stranded positive-sense RNA plant virus belonging to the genus Sobemovirus The movement protein (MP) encoded by SeMV ORF1 showed no significant sequence similarity with MPs of other genera, but showed 32% identity with the MP of Southern bean mosaic virus within the Sobemovirus genus With a view to understanding the mechanism of cell-to-cell movement in sobemoviruses, the SeMV MP gene was cloned, over-expressed in Escherichia coli and purified Interaction of the recombinant MP with the native virus (NV) was investigated by ELISA and pull-down assays It was observed that SeMV MP interacted with NV in a concentration- and pH-dependent manner Analysis of N- and C-terminal deletion mutants of the MP showed that SeMV MP interacts with the NV through the N-terminal 49 amino acid segment Yeast two-hybrid assays confirmed the in vitro observations, and suggested that SeMV might belong to the class of viruses that require MP and NV ⁄ coat protein for cell-to-cell movement doi:10.1111/j.1742-4658.2010.07943.x Structured digital abstract l MINT-8050243: p53 (uniprotkb:P02340) physically interacts (MI:0915) with T-Ag (uniprotkb:P03070) by two hybrid (MI:0018) l MINT-8050226: MP (uniprotkb:Q9EB09) physically interacts (MI:0915) with CP (uniprotkb:Q9EB06) by two hybrid (MI:0018) Introduction Plants have an elaborate communication system that permits transport of macromolecules from one cell to another Plant viruses have evolved mechanisms to manipulate the same resident communication system and redirect it in such a way that the viral genome is transported from one cell to another, leading to spread of infection The virus-encoded movement protein (MP), in association with other viral and host factors called ancillary proteins, plays a central role in this process The MP–genome complex, or, in some cases, assembled virus particles, interacts with the components of plasmodesmata and dilates the openings to permit passage through the cell wall [1,2] Although MPs are not conserved across genera, they perform similar functions [3] In terms of the nature of the nucleoprotein complex that moves from cell to cell, plant viruses may be broadly divided into two types [4] In the first type, MPs interact with viral RNA to form a movement complex (M complex), which is transported from cell to cell, as in tobacco mosaic Abbreviations CP, coat protein; CPMV, cowpea mosaic virus; GnHCl, guanidine hydrochloride; GST–MP, recombinant MP expressed in E coli with an N-terminal glutathione sulfur transferase tag; NV, native virus; M complex, movement complex formed by MP with viral genomic RNA; MP, movement protein; rMP, recombinant MP expressed in E coli with an N-terminal histidine tag; SBMV, Southern bean mosaic virus; SeMV, Sesbania mosaic virus; TMV, tobacco mosaic virus; Y2H, yeast two-hybrid FEBS Journal 278 (2011) 257–272 ª 2010 The Authors Journal compilation ª 2010 FEBS 257 Interaction of SeMV MP with viral coat protein S R Chowdhury and H S Savithri virus (TMV) TMV has been shown to be transported as a replication complex that contains MP, viral replicase and genomic RNA [5] In the second type, intact virus particles are transported through MP-containing tubules, as observed in cowpea mosaic virus (CPMV) [6] However, MPs that are known to form an M complex can also form tubules [7], and MPs that form tubules can also bind to RNA [8,9] An extensive analysis of the function of MPs of viruses from various genera has shown that taxonomically different viruses may use the same strategy, while closely related viruses may use different strategies, and some may use more than one strategy for the spread of infection [3] It is also possible that viruses may use different strategies depending on the host they infect [10] The mechanism of virus movement is therefore diverse and complex, involving several factors [11] Sobemoviruses are plant RNA viruses that are named after their type species, Southern bean mosaic virus (SBMV) Viruses belonging to this genus are icosahedral particles of approximately 30 nm in diameter The viral capsid is made up of 180 identical coat protein (CP) subunits organized with T = icosahedral symmetry, and Encapsidates a single molecule of genomic RNA The genomic RNA is a single-stranded messenger-sense molecule, approximately 4–4.5 kb in size The 5¢ terminus of the RNA has a genome-linked protein (VPg), and the 3¢ end lacks a poly(A) tail Sobemoviruses infect plants from 15 families, including dicotyledonous and monocotyledonous species [12] The first sobemovirus, SBMV, was reported from Louisiana and California, USA, in 1943 [13] Later it was reported that sobemoviruses occur all over the world, infecting plants in countries from Scandinavia to New Zealand and throughout tropical Africa, North America and South East Asia In susceptible hosts, sobemoviruses cause severe diseases with recurrent economic losses For example, rice yellow mottle virus is responsible for the most rapidly spreading disease of rice in Africa [12] Previous studies on sobemoviruses have shown that the protein coded by ORF1 of rice yellow mottle virus [14] and Southern cowpea mosaic virus [15] is essential for cell-to-cell movement More recently, it was reported that the ORF1-encoded protein of Cocksfoot mottle virus (CfMV), designated P1, is essential for systemic spread of the virus [16] Further, the ORF1-encoded product of rice yellow mottle virus has been implicated as a RNA silencing suppressor [17,18] These results suggest that ORF1-encoded proteins function as MPs in sobemoviruses However, the molecular mechanism of cell-to-cell movement in sobemoviruses has not been investigated Other virusencoded ancillary proteins that may interact with 258 sobemoviral MPs and assist in cell-to-cell or systemic movement of the virus have not yet been identified It is not known whether sobemoviruses use TMV-type or CPMV-type movement strategies Functional characterization of sobemoviral MPs and understanding of the role of ancillary proteins ⁄ domains in cell-to-cell movement may assist in identification of genome segments that could be targeted for developing antiviral strategies for this particular virus group Sesbania mosaic virus (SeMV) belongs to the Sobemovirus genus, and was first identified from infected Sesbania grandiflora pers agathi on farms around Tirupati, Andhra Pradesh, India The 3D structure of the purified virus has been determined, and it was shown to be an icosahedral virus with a diameter of 30 nm comprising 180 identical CP subunits [19,20] The SeMV genome is 4149 nucleotides long, and encodes four potential overlapping ORFs [21] Comparison of the nucleotide and the deduced amino acid sequences of SeMV ORFs with those of other sobemoviruses revealed that SeMV is closest to the Southern bean mosaic virus Arkansas isolate (SBMV-Ark) [21] The mechanisms of SeMV assembly and polyprotein processing have been reported previously [22–25] In the present study, the ORF1 gene encoding the SeMV MP was cloned and over-expressed in Escherichia coli in fusion with a hexahistidine or a glutathione sulfur transferase (GST) tag The recombinant proteins were shown to interact with native virus (NV) using pull-down assays and ELISA Further, studies on deletion mutants of MP were performed to determine the domain responsible for the interaction of MP with CP using ELISA and yeast two-hybrid (Y2H) assays Deletion of the N-terminal 49 amino acids of the SeMV MP drastically reduced the interaction between the two proteins To our knowledge, this is the first report demonstrating the interaction between MP and CP of a sobemovirus, suggesting that SeMV might belong to the class of viruses that require both MP and CP for cell-to-cell movement Results In silico analysis of MPs In order to examine the similarity among the MPs of sobemoviruses and other plant viruses, in silico analysis was performed The gene sequences were obtained from the National Center for Biotechnology Information and GenBank, and multiple sequence alignment was performed using Clustal W2 (http://www.ebi.ac.uk/Tools/ clustalw2/index.html) The results obtained are shown FEBS Journal 278 (2011) 257–272 ª 2010 The Authors Journal compilation ª 2010 FEBS S R Chowdhury and H S Savithri Interaction of SeMV MP with viral coat protein in Table The SeMV MP showed no significant sequence similarity with MPs of viruses from other genera Within sobemoviruses, the sequence of the SeMV MP was closest to that of the SBMV-Ark MP (32% sequence identity), and the identity with MPs of other sobemoviruses was not significant The secondary structure of SeMV MP was predicted using the PredictProtein server (http://www.predictprotein.org/) [26] As shown in Fig 1, the SeMV MP was predicted to be a primarily a-helical protein The predicted percentages of a helix, b sheet and coil were 49%, 25% and 26%, respectively The potential involvement of post-translational modification of viral MPs in regulation of their transport mechanism was first suggested in view of finding that the 30 kDa MP of TMV is phosphorylated within host cells Other viral MPs, such as those of tomato mosaic virus and potato leafroll virus, were subsequently also shown to be phosphorylated during the infection process [27,28] One consequence of the phosphorylation event on MP is that it could result in the unloading of the viral genome from the M complex after it enters the neighbouring cell through plasmodesmata [29–31] However, other reasons for phosphorylation of MPs could also exist that have yet to be identified Nevertheless, the fact remains that MPs are sometimes post-translationally modified by phosphorylation Therefore, a search for the presence of potential phosphorylation sites in the SeMV MP was performed using the netphos 2.0 server (http://www.cbs.dtu.dk/ services/NetPhos/) RNA binding sites and other motifs were searched using the Block search program (http:// Table Sequence comparison of SeMV MP with other MPs from various genera Genus Virus species Sobemovirus Sesbania mosaic virus Southern bean mosaic virus Southern cowpea mosaic virus Lucerne transient streak virus Rice yellow mottle virus Cocksfoot mottle virus Tobacco mosaic virus Cowpea chlorotic mottle virus Alfalfa mosaic virus Cucumber mosaic virus Cowpea mosaic virus Brome mosaic virus Tobamovirus Alfamovirus Cucumovirus Comovirus Bromovirus Percentage identity with SeMV Percentage similarity with SeMV 100 32.4 100 50 17.8 27.5 17.1 32.6 9.1 11 11.5 12.3 15.1 19.9 19.3 9.8 4.7 2.7 14.7 17.6 6.9 6.1 Fig Prediction of the secondary structure of the SeMV MP S, sequence; P, secondary structure predicted using the PredictProtein server (http://www.predictprotein.org/) The grey boxes represents the RNA binding motif The red boxes indicate cysteine residues and the yellow box indicates a high-propensity phosphorylation site predicted by the NetPhos 2.0 server (http://www cbs.dtu.dk/services/NetPhos/) blocks.fhcrc.org/blocks/blocks_search.html) The results suggested the presence of a nucleic acid binding domain in the C-terminal segment of the SeMV MP (Fig 1, grey box) and a high density of predicted phosphorylation sites at the C-terminus of the protein (Fig 1, yellow box) However, no conserved motif was found when the SeMV MP sequence was compared with other well characterized MPs Over-expression of the SeMV MP in E coli and purification under denaturing conditions The SeMV MP gene was amplified and cloned into the pRSET C vector (Invitrogen, Carlsbad, CA, USA) and over-expressed in E coli as described in Experimental procedures The recombinant histidine-tagged MP was designated rMP The 20 kDa rMP, although expressed in at a high level (Fig 2A), was mostly present in the insoluble fraction (Fig 2B) The rMP was therefore purified from the insoluble fraction under denaturing conditions using m guanidine hydrochloride (GnHCl), and refolded by stepwise dialysis as described in Experimental procedures The purity of the protein was determined by 12% SDS ⁄ PAGE (Fig 2C) The refolded rMP was soluble and was used for further characterization FEBS Journal 278 (2011) 257–272 ª 2010 The Authors Journal compilation ª 2010 FEBS 259 Interaction of SeMV MP with viral coat protein A S R Chowdhury and H S Savithri B C Fig Expression, solubility analysis and purification of rMP (A) The pRSET C-MP clone was transformed into E coli BL21 (DE3) cells The total lysate after isopropyl-b-D-thiogalactopyranoside induction was analysed by 12% SDS ⁄ PAGE Lanes U and I correspond to uninduced and induced total lysate, respectively The arrow indicates the position of the rMP band in the induced sample (lane I) (B) SDS ⁄ PAGE (12%) of soluble (S) and pellet (P) fractions of rMP-expressing cells The arrow indicates the position of the rMP band (C) SDS ⁄ PAGE (12%) showing rMP purified by Ni-NTA affinity chromatography under denaturing conditions using M GnHCl (lanes and 2) The arrow indicates the position of purified protein Lane M, protein molecular mass markers The gels were stained with Coomassie brilliant blue R250 Circular dichroism (CD) spectroscopy MP–NV interaction The far-UV CD spectrum of the purified and refolded rMP showed minima at 210 and 222 nm, suggesting that the protein was folded and adopted a largely a-helical conformation (Fig 3A) Analysis of the CD spectrum using K2D2 software (http://www.ogic.ca/ projects/k2d2/) showed that rMP comprises more than 84% a-helical structure, compared to the predicted helix content of 49% The thermal stability of the rMP was monitored by measuring the molar ellipticity at 210 nm as a function of temperature The rMP had a Tm of 65 °C (Fig 3A, inset) NV or the CP is an important ancillary protein for the movement of many viruses within the host To determine whether SeMV MP and NV interact with each other, pull-down assays were performed as described in Experimental procedures A distinct band corresponding to CP was seen together with rMP in the eluted fraction (data not shown) To confirm the interaction of MP with NV, a modified ELISA was performed as described in Experimental procedures ELISA plates were coated with NV, blocked, and rMP was added The interaction between the two proteins was monitored by using antibodies against rMP (Fig 4A) In a reverse experiment, rMP was immobilized on ELISA platea and NV was used as the probe protein (Fig 4B) In both the experiments, BSA was used as a control Cross-reaction of the primary antibody to the immobilized protein was also tested by ELISA in the absence of the interacting proteins rMP interacted with NV in both the experiments (Fig 4A,B) Fluorescence spectroscopic analysis The intrinsic fluorescence spectrum of rMP showed maximum emission at 345 nm upon excitation at 280 nm, typical of a folded protein (Fig 3B) The emission maximum showed a red shift to 365 nm upon addition of m urea due to exposure of the aromatic residues to the solvent as the protein unfolded [30] Another broad peak between 305 and 315 nm was also observed upon urea denaturation (Fig 3B) Generally, the fluorescence emission induced in proteins by 280 nm excitation is dominated by tryptophan fluorescence and the tyrosine emission is nearly undetectable The tyrosine emission (305–315 nm) is observed only when the protein is in the denatured state [32] 260 Nature of the MP–NV interaction To determine the concentration dependence and nature of the interaction between MP and NV, the same ELISA-based approach was used ELISA plates were coated with NV (5 lg), and, after blocking, increasing FEBS Journal 278 (2011) 257–272 ª 2010 The Authors Journal compilation ª 2010 FEBS S R Chowdhury and H S Savithri A Interaction of SeMV MP with viral coat protein A B B Fig Biophysical characterization of refolded rMP (A) Far-UV CD spectrum of rMP The molar ellipticity of rMP (0.5 mgỈmL)1) was recorded from 190 to 300 nm in a 0.2 cm path-length cuvette with a band width of nm and response time of s The thermal stability of rMP was monitored by measuring the molar ellipticity at 210 nm at various temperatures (inset) (B) Intrinsic fluorescence spectra of rMP The intrinsic fluorescence spectrum of rMP was measured by exciting the sample at 280 nm and observing the fluorescence emission from 300 to 400 nm in the absence (solid line) and presence of M urea (dotted line) The emission maximum showed a red shift to 365 nm upon addition of M urea, and a broad peak between 305 and 315 nm was also observed due to emission by tyrosine residues that are exposed in the protein in the denatured state concentrations of rMP were added, and the ELISA was performed The absorbance at 450 nm was plotted as a function of rMP concentration (Fig 5A) The results show that the interaction between NV and rMP is concentration-dependent Next, we wished to investigate the effect of pH on MP–NV interaction Previously, it was shown that SeMV particles are stable over a pH range of 3–10.4 Fig Interaction of rMP with NV (A) ELISA of rMP and NV interaction ELISA plates coated with NV (5 lg) (P1) were blocked with 10% skimmed milk in 1% NaCl ⁄ Pi (block) followed by addition of lg of rMP (P2) The ELISA was performed using an anti-MP polyclonal antibody (pAb to P2) and developed using anti-rabbit IgG conjugated to horseradish peroxidise and DMB H2O2 (sAb + Sub) The steps involved and the controls used are indicated on the figure BSA was used as a negative control (B) Reverse experiment in which ELISA plates were coated with rMP (P1) and probed with NV (P2) Primary polyclonal antibodies against NV (pAb to P2) were used in this reaction, with controls similar to those used in (A) [33] Similar studies with rMP showed that the protein was stable over a broad pH range and precipitated at pH values > [34] Therefore, to determine the optimal pH for interaction between the two proteins, rMP was dissolved in buffers at various pH values (Fig 5B), and incubated with NV-bound plates for h Then the unbound rMP was removed and an ELISA was performed The reactions were performed in triplicate After the reaction, absorbance values obtained at 450 nm were plotted as a function of the pH of the FEBS Journal 278 (2011) 257–272 ª 2010 The Authors Journal compilation ª 2010 FEBS 261 Interaction of SeMV MP with viral coat protein A B C S R Chowdhury and H S Savithri Fig Analysis of the biochemical nature of the interaction between rMP and NV (A) Effect of rMP concentration on the NV–MP interaction NV-coated ELISA plates were incubated with increasing concentrations of rMP after a blocking step The absorbance values obtained at 450 nm by ELISA with anti-MP polyclonal antibody were plotted as a function of rMP concentration (B) Effect of pH on the NV–MP interaction ELISA plates coated with NV (P1) were incubated with rMP (P2) in 50 mM buffers at various pH as indicated in the figure After incubation, the wells were washed, ELISA was performed using anti-MP polyclonal antibody (pAb to P2), and absorbance values at 450 nm were plotted as a function of pH rMP in NaCl ⁄ Pi (pH 7.4) was used as a positive control The other controls used are indicated in the figure (C) Effect of NaCl on the NV–MP interaction ELISA plates coated with NV (P1) were blocked with 10% skimmed milk in PBS and incubated with rMP (P2) dissolved in 50 mM Tris ⁄ HCl buffer (pH 7.4) containing various concentrations of NaCl as shown in the figure and incubated for h After extensive washing of the wells, ELISA was performed as described in Experimental procedures using anti-MP polyclonal antibody (pAb to P2) The absorbance values obtained at 450 nm were plotted as a function of NaCl concentration buffer in which rMP was dissolved The optimal pH for interaction between the two proteins was between pH 6.5 and 7.5, with a sharp decrease in both the acidic and alkaline ranges These observations suggest that the interaction between the two proteins is optimal near physiological pH To monitor the effect of NaCl on the interaction of the two proteins, ELISA was performed as before, except that the rMP was dissolved with various concentrations of NaCl and added to NV-bound ELISA plates Incubation of the SeMV MP or the NV with m NaCl did not affect solubility or stability The absorbance at 450 nm was plotted as a function of NaCl concentration (Fig 5C) An increase in NaCl concentration did not affect the interaction of NV with rMP, suggesting that the interaction between the two proteins is strong Expression of GST–MP The experiments described so far were performed using refolded rMP The MP-encoding gene was also cloned and over-expressed with an N-terminal GST tag as described in Experimental procedures The GST–MP fusion protein expressed in E coli BL21 (DE3) was soluble and of the expected size (45.4 kDa) The protein was purified using glutathione affinity chromatography, and was found to be homogeneous (Fig 6A, lanes E) Protein–protein interaction between NV and GST–MP To determine whether the soluble GST–MP interacts with NV in a manner similar to that of refolded rMP, 262 FEBS Journal 278 (2011) 257–272 ª 2010 The Authors Journal compilation ª 2010 FEBS S R Chowdhury and H S Savithri A Interaction of SeMV MP with viral coat protein was no significant difference in the binding of GST– MP to NV in the presence or the absence of GST, suggesting that the interaction is indeed between MP and NV and not between GST and NV Generation of deletion mutants of GST–MP B The results presented so far clearly demonstrated that MP interacts with NV It was of interest to map the region of MP that is responsible for this interaction For this purpose, a number of deletion mutant clones were constructed As described earlier, SeMV MP is primarily an a-helical protein The three predicted N-terminal three helices (Fig 1) were systematically deleted to generate ND16, ND35 and ND49 deletion mutant clones In addition, three C-terminal deletion mutant clones were also constructed: CD3, in which a high-propensity phosphorylation site was removed, CD19 in which the predicted RNA binding domain was removed, and CD38, in which three cysteines and the nucleic acid binding domain were deleted (Fig 1) The GST–MP deletion mutants were over-expressed in E coli BL21(DE3)pLysS as described for the full length GST–MP All the mutant proteins were soluble and of the expected size The proteins were purified using glutathione affinity chromatography (Fig 7A) Mapping of the SeMV MP domain necessary for interaction with NV Fig Purification of GST–MP, and determination of the interaction between GST–MP and NV by ELISA (A) Coomassie brilliant blue-stained 12% SDS ⁄ PAGE gel showing GST–MP and GST purified by glutathione affinity chromatography Lanes are marked as unbound protein (U), washed samples (W), eluted GST–MP (E) and purified GST (G) Lane M, protein molecular mass markers Arrows indicate the position of purified proteins (B) Protein–protein interaction between NV and GST–MP An ELISA to measure the protein interaction between NV (P1) and GST–MP (P2) was performed as described in the legend to Fig 4B using anti-MP polyclonal antibody (pAb to P2) Experimental steps and controls are indicated in the figure An additional GST blocking step (GST) was included to rule out the possibility of GST–NV interaction ELISA and GST pull-down experiments were performed as described previously GST–MP was found to interact with NV both in ELISA (Fig 6B) and pulldown assays (data not shown) To rule out the possibility that the interaction between GST–MP and NV is due to interaction between GST and NV, a GST blocking step was introduced in the ELISA-based interaction assay (Fig 6B, last two columns) There To determine which domains are involved in the interaction of MP with NV, ELISA was performed as described previously ELISA plates were coated with NV (5 lg) and blocked with 10% milk in NaCl ⁄ Pi, followed by addition of various mutants as probe proteins The ELISA was performed using anti-rMP as the primary antibody In parallel, subsequent wells were incubated with GST and probed using polyclonal antibodies against GST to rule out the possibility of GST–NV interaction Determination of the absorbance at 450 nm clearly showed that the N-terminal deletions have a pronounced effect on MP–NV interaction Successive deletion of one, two and three predicted helices from the N-terminus of MP reduced the interaction with NV by 51.5%, 66.4% and 80.1%, respectively, compared with the interaction between GST–MP and NV However, the interaction was not affected when C-terminal amino acids were deleted It may therefore be concluded that MP interacts with NV via the N-terminal domains Similar observations were also made in pull-down experiments (data not shown) FEBS Journal 278 (2011) 257–272 ª 2010 The Authors Journal compilation ª 2010 FEBS 263 Interaction of SeMV MP with viral coat protein S R Chowdhury and H S Savithri A B Fig Mapping of the SeMV MP domain responsible for interaction of MP with NV (A) Purification of GST–MP deletion mutants GST–MP deletion mutants were over-expressed in E coli BL21 (DE3) and purified using glutathione affinity chromatography The Coomassie brilliant blue-stained gel after 12% SDS ⁄ PAGE of purified GST–MP deletion mutant proteins is shown (B) ELISA-based protein–protein interaction assay between NV and GST–MP deletion mutants ELISA plates coated with NV (P1) and blocked with 10% skimmed milk in PBS and were incubated with GST–MP deletion mutants (P2) The remaining stages of the reaction were performed as described in the experimental procedure section using anti-MP polyclonal antibody (pAb to P2) (hatched bars) Subsequent NV-coated wells were incubated with GST and probed using anti-GST polyclonal antibody to rule out the possibility of GST–NV interaction (white bars) Experimental steps and controls are indicated in the figure The absorbance at 450 nm for each of the conditions is shown The percentage decrease in absorbance for the mutants as compared to GST–MP and NV interaction is indicated above the bars Y2H assays All the results obtained so far were from in vitro experiments To confirm these results, a Y2H assay was 264 performed using the Matchmaker system pGAD T7 (CP) and pGBK T7 (MP and deletion mutants) clones were obtained as described in Experimental procedures The pGAD T7 and pGBK T7 clones were transformed into the Saccharomyces cerevisiae AH109 strain in pairs as indicated in Fig pGBKT7-P53 (murine p53 fused to GAL4 DNA BD) and pGADT7-T Ag (the SV40 large T-antigen fused to GAL4 DNA AD) that have been previously reported to interact in a Y2H assay [35] were used as a positive control in these experiments After transformation, growth was monitored on synthetic drop-out (SD) –Leu ⁄ –Trp plates to confirm that both the plasmids were transformed into AH109 cells Subsequently, the transformed colonies were replicaplated on –Leu ⁄ –Trp ⁄ –His (medium stringency), –Leu ⁄ –Trp ⁄ –His ⁄ –Ade (high stringency), –Leu ⁄ –Trp ⁄ –His ⁄ + a-X-Gal (medium stringency with a-galactosidase) and –Leu ⁄ –Trp ⁄ –His ⁄ –Ade ⁄ +a-X-Gal (high stringency with a-galactosidase) SD plates to determine the quality and strength of interaction between the SeMV MP or the deletion mutants and CP (Fig 8A,B) AH109 cells co-transformed with pGBK T7 MP and pGAD T7 CP grew on all nutritional selection medium up to the final level of selection (–Leu ⁄ –Trp ⁄ –His ⁄ –Ade ⁄ +a-X-Gal), similar to the positive control comprising p53 and T-Ag (first two rows from the top in Fig 8A,B), suggesting that MP and CP also interact with each other under the ex vivo conditions of Y2H system However, the AH109 strain transformed with either the pGAD T7 MP clone or the pGBK T7 CP clone alone did not form colonies, ruling out the possibility of de novo activation of the reporter gene in the presence of the expressed proteins Similarly, untransformed AH109 S cerevisiae alone did not form any colonies (data not shown) To identify the domain in MP that is involved in interaction with CP, MP mutant gene products obtained by PCR were cloned into the pGBK T7 vector, and the mutants were tested for their interaction with CP expressed from the pGAD T7 vector Fig shows that all the mutants exhibited positive Y2H interaction with CP The interaction between ND16 and CP (third row from top, Fig 8) was observed for growth under medium stringency conditions (–Leu ⁄ – Trp ⁄ –His ⁄ +a-X-Gal), but no interaction was observed under high stringency conditions (–Leu ⁄ –Trp ⁄ –His ⁄ – Ade) For ND35 (fourth row from top in Fig 8A,B), the level of interaction was comparable to that between MP ND16 and CP pGAD T7 CP and pGBK T7 ND49 clones co-transformed into AH109 cells only formed white colonies in –Leu ⁄ –Trp ⁄ – His ⁄ +a-X-Gal plates (fifth row, column 4, in Fig 8A,B) These results show that the interaction of FEBS Journal 278 (2011) 257–272 ª 2010 The Authors Journal compilation ª 2010 FEBS S R Chowdhury and H S Savithri A Interaction of SeMV MP with viral coat protein B Fig Y2H interaction between MP and CP (A) pGBK T7 (MP, MP deletion mutants and p53) and pGAD T7 (CP and T Ag) clones were transformed in pairs into the AH109 strain, plated onto –Leu ⁄ –Trp SD transformant selection plates, and incubated for 96 h Colonies that grew were marked, and replica-plated onto various nutritional marker SD plates with various stringencies for reporter gene expression To assess a-galactosidase activity, colonies were plated onto SD plates containing a-X-Gal (B) Schematic representation of the results in (A) MP with CP is greatly reduced by deletion of 49 amino acids from the N-terminus C-terminal deletions of MP (CD3, CD19 and CD38) (last three rows in Fig 8) had a minimal effect on the interaction between MP and CP However, none of the deletion mutants grew on –Leu ⁄ –Trp ⁄ –His ⁄ –Ade plates, indicating that there was some loss of interaction (rows 3–8, column 5, in Fig 8A,B) b-galactosidase assay with ortho-nitrophenyl-bgalactopyranoside as substrate Transformed colonies that showed a positive Y2H interaction were grown in liquid culture (–Leu ⁄ –Trp ⁄ – His medium), and were assayed for b-galactosidase activity to validate and quantify the results of the twohybrid interactions A single colony was picked from each of the SD plates, and the b-galactosidase assay was performed as described in Experimental procedures The results are presented as a percentage of arbitrary units of b-galactosidase activity (values indicated on the top of each bar) relative to that obtained with transformants expressing p53 and T-antigen (100%) Values are the means of at least three separate experiments (Fig 9A) There was no difference in the b-galactosidase activity between transformants expressing CP with MP, ND16, CD3, CD19 or CD38 However, an appreciable decrease in activity was seen in transformants expressing CP with ND35 or ND49 Interaction between the SeMV MP and CP resulted in 71% activity compared with the interaction between p53 and the T-antigen (100%) The interaction between the DN49 mutant MP and CP resulted in 27% activity This corresponds to a reduction in activity of 60% compared with interaction of the wild-type SeMV MP and CP This reduction in interaction could also be due to a difference in the level of expression of the interacting proteins To rule out this possibility, the levels of all the bait and prey proteins were quantified by ELISA The CP expressed from pGADT7 vector has a haemagglutinin tag fused to its N-terminus, and the MP and the mutants expressed from pGBK T7 have cMyc epitope tags The co-transformed colonies were grown overnight in mL of appropriate selection medium, and cells were lysed to release the proteins ELISA was performed with the total lysate using haemagglutinin polyclonal antibody or cMyc monoclonal antibody at : 10 000 dilution (Fig 9B) All the proteins were expressed at comparable levels Thus the drastic reduction in interaction of ND35 and FEBS Journal 278 (2011) 257–272 ª 2010 The Authors Journal compilation ª 2010 FEBS 265 Interaction of SeMV MP with viral coat protein S R Chowdhury and H S Savithri A B Fig Quantification of the MP–CP Y2H interaction by b-galactosidase assay and estimation of the level of protein expression (A) A b-galactosidase assay of transformed colonies that showed positive Y2H interaction was performed as described in Experimental procedures The results are presented as a percentage of arbitrary units of b-galactosidase activity (values are indicated on the top of each bar) relative to the interaction between p53 and T-antigen (100%) Values are means of at least three separate experiments (B) Direct antigen-coating ELISA for estimation of the interaction between CP and MP or its deletion mutants Total protein isolated from AH109 cells transformed with pGBK T7 MP or MP deletion clones and pGAD T7 CP was coated on to ELISA plates The amount of MP and the deletion mutants was quantified using cMyc monoclonal antibody (open bars) The amount of CP was estimated using haemagglutinin polyclonal antibody (closed bars) ND49 with CP is because of deletion of the interacting domain Discussion MPs are a diverse group of non-structural proteins of plant viruses that are involved in the spread of infection 266 from cell to cell and systemically within the host plant [11] The present study comprised biochemical characterization of the MP encoded by ORF1 of SeMV, a member of the genus Sobemovirus Analysis of the deduced amino acid sequence of the SeMV MP showed that it is predominantly an a-helical protein It has a C-terminal nucleic acid binding domain and a predicted phosphorylation site as expected of a protein involved in viral movement (Fig 1) The interaction between MPs and virus- or hostencoded ancillary proteins is important for transport of the viral genome from one cell to another The results presented here clearly show that the purified SeMV MP interacts with NV and CP, suggesting that SeMV might belong to the class of viruses that require MP and NV ⁄ CP for cell-to-cell movement An inherent characteristic of MPs is their ability to interact with plasmodesmata and components of the cellular vasculature Hence, they tend to form inclusion bodies when expressed in vitro [36–38] The rMP overexpressed in E coli was also present in the insoluble fraction and was purified under denaturing conditions (Fig 2), but could be successfully refolded Upon denaturation with m urea, in addition to the shift of the fluorescence emission maxima from 345 to 365 nm due to exposure of tryptophan residues, an additional broad peak at 305–315 nm was observed There is a single tryptophan (position 84) and eight tyrosines in the SeMV MP It is possible that the fluorescence emission of these tyrosines is quenched by energy transfer to tryptophan or charged amino groups or protonated carboxylates in their vicinity in the refolded protein However, upon denaturation, fluorescence due to tyrosine is observed as a broad peak at 305–315 nm [32,39] rMP eluted in the void volume when analysed by size-exclusion chromatography, suggesting that the refolded MP formed large oligomers (data not shown) Most MPs form soluble aggregates, probably because of their inherent ability to form M complexes or tubules for transport across plasmodesmata In vitro, some MPs are known to form heteromeric complexes with various cytoskeletal elements and host factors such as the major nucleolar protein fibrillarin [40] Together with the MP, the CP plays a pivotal role in cell-to-cell movement of certain viruses [3] In order to examine interactions between the CP and the MP, in vitro and ex vivo studies were performed The interaction of rMP with NV was dependent on the concentration of rMP (Fig 5A) However, the stoichiometry of interaction could not be estimated as the refolded rMP formed soluble aggregates Also, as the NV was immobilized on ELISA plates, not all the sites would FEBS Journal 278 (2011) 257–272 ª 2010 The Authors Journal compilation ª 2010 FEBS S R Chowdhury and H S Savithri be available for interaction with MP However, the ELISA results unambiguously demonstrated that rMP and NV interact with each other An insight into the nature of interaction between the rMP and NV was obtained by monitoring the effect of pH and NaCl concentration (Fig 5B,C) The formation of salt bridges and hydrogen bonds crucial for protein–protein interactions is dependent on pH Variation in pH may also lead to conformational changes that may hinder interactions The interaction between rMP and NV was optimal near physiological pH, suggesting that these interactions might be relevant for in vivo functions of MP It is likely that the interaction between the two proteins is largely ionic, as rMP and CP have opposite computed net charges ()4.8 and +13.3, respectively) High ionic strength can reduce such interactions due to shielding of ionizable groups However, the interaction between the proteins was unaffected when rMP was allowed to bind to immobilized NV in the presence of m NaCl, suggesting that the interaction between the two proteins is quite strong and is probably not dominated by ionic interactions The SeMV MP was soluble when expressed with a GST tag The purified GST–MP also interacted with NV in a manner similar to rMP (Fig 6) In order to map the domains of MP that interacted with NV, various deletion mutants of GST–MP (ND16, ND35, ND49, CD3, CD19 and CD38) were generated The purified GST–MP and the deletion mutant MPs showed similar CD spectra (data not shown), suggesting that there were no gross conformational changes due to the mutations Analysis of the ELISA data obtained with the deletion mutants showed that the C-terminal deletions did not affect interaction between the two proteins However, N-terminal deletions resulted in decreased interactions, and the ND49 mutant showed 80% loss of interaction with NV These observations suggest that there is a major interacting domain within the N-terminal 49 amino acids of the SeMV MP This is in contrast to observations on CPMV MP, in which the C-terminal domain was shown to be involved in NV recognition and binding [41,42] To substantiate the in vitro results, Y2H assays were performed Similar studies have been performed with Bhendi yellow vein mosaic virus [43] Interaction between SeMV MP and CP was also observed in the Y2H assays However, the interaction was not as strong as that observed between p53 and T-antigen The MP–CP interaction resulted in 71.3% b-galactosidase activity compared to that observed for the p53–Tantigen interaction (Figs 8A and 9A) This could have important implications for the plant virus lifecycle The interaction between MP and CP must be transient Interaction of SeMV MP with viral coat protein The M complex must disassemble once the genome is translocated to an adjacent cell so that further steps in the lifecycle, i.e replication of the viral genome, may proceed Dissociation of viral genome from the complex has been attributed to phosphorylation of MP [44] Similar to the in vitro results, deletion of amino acids from the N-terminus resulted in a decreased interaction between MP and CP in Y2H assays Deletion of the N-terminal 16 amino acids or the C-terminal 3, 19 and 38 amino acids had a marginal effect However, deletion of 35 amino acids from the N-terminus (first two helices) reduced the interaction by 50%, and deletion of 49 amino acids (first three helices) reduced the interaction by 60% as monitored by measuring the b-galactosidase activity (Fig 9A), suggesting that the location of the interacting domain is between residues 17 and 49 Further, it should be noted that there was no a-galactosidase activity on SD plates (Fig 8A, total absence of blue colonies in – Leu ⁄ –Trp ⁄ –His ⁄ +a-X-Gal plates) for the interaction between CP and the deletion mutant DN49 However, the colonies grew in –Leu ⁄ –Trp ⁄ –His plates, demonstrating that a degree of interaction between the proteins remains It is possible that another site of interaction beyond the N-terminal 49 residues may contribute to these weak interactions In conclusion, the results presented here clearly demonstrate that the recombinant SeMV MP interacts with NV ⁄ CP via the N-terminal domain To our knowledge, this is the first report identifying CP as an interacting partner for any sobemoviral MP SeMV may require CP and MP for cell-to-cell movement within the host However, at this stage, it is not possible to classify SeMV as a type II virus (where the CP acts as an ancillary protein to the MP) or a type III virus (where the complete virion moves across the plasmodesmata) with respect to movement Further studies on the nature and composition of the nucleoprotein complex translocated from cell to cell via the plasmodesmata are required to clarify the mechanism of viral movement in sobemoviruses Experimental procedures Construction of rMP and GST–MP clones The ORF1 gene of SeMV was amplified using high-fidelity fusion polymerase (New England Biolabs, Ipswich, MA, USA) using sense and antisense primers (MP sense and MP anti, Table 2) corresponding to the N- and C-termini of the MP, respectively, and a full-length SeMV cDNA clone (AY004291) as the template The PCR product was cloned FEBS Journal 278 (2011) 257–272 ª 2010 The Authors Journal compilation ª 2010 FEBS 267 Interaction of SeMV MP with viral coat protein S R Chowdhury and H S Savithri Table Oligonucleotide primers used in the study Name Sequence (5¢ fi 3¢) Description MP sense MP anti E.CP sense E.CP anti E.MP.N35 sense CCGGCTAGCGAATTCATGATGGTAATGCAAGCTCAGCATACT G G CCGGAATTCGGAGGAGGACATAGCCCT CCGCATATGGAATTCATGATGGCGAAAAGGCTTTCG G CCGCATATGGAATTCGTTGTTCAGGGCTGAGGC G CCGCATATGGAATTCATGATGGTATGTGAAGTGGAATTTGAT G E.MP.N16 sense CCGCATATGGAATTCATGATGGTATTCATTGGTTTTGAGGAC G E.MP.N49 sense CCGCATATGGAATTCATGATGGTAGTGAGAGCCCACAACCAA G E.MP.C3 anti CCGCATATGGAATTCCATAGCCCTTGCAGCTCG G E.MP.C 19 anti CCGAAGCTTGAATTCCGGACACGAATAGAAGTATTC A E.MP C38 anti CCGAAGCTTGAATTCCGGCCCGTTTTCACAAGGAGC A Primers for amplification of the MP gene The EcoRI site is indicated in bold and the NheI site is underlined Primers for amplification of the CP gene The EcoRI site is indicated in bold and the NdeI site is underlined Primer for amplification of the MP ND35 gene The EcoRI site is indicated in bold and the NdeI site is underlined Primer for amplification of the MP ND16 gene The EcoRI site is indicated in bold and the NdeI site is underlined Primer for amplification of the MP ND49 gene The EcoRI site is indicated in bold and the NdeI site is underlined Primer for amplification of the MP CD3 gene The EcoRI site is indicated in bold and the NdeI site is underlined Primer for amplification of the MP CD19 gene The HindIII site is indicated in bold and the EcoRI site is underlined Primer for amplification of the MP CD38 gene The HindIII site is indicated in bold and the EcoRI site is underlined into the PvuII site of the pRSET C vector (Invitrogen, Carlsbad, CA, USA) The additional nucleotides (87 bp) derived from the vector backbone as a result of the cloning strategy employed were removed by NheI digestion followed by re-ligation The recombinant clone was designated pRSET C-MP Expression of SeMV MP from the pRSET C-MP clone resulted in a protein with additional 16 amino acids at the N-terminus, including the hexahistidine tag, due to the cloning strategy used In order to express MP as an N-terminally GST-tagged protein, the PCR product was cloned into the EcoRI site of the pGEX 4T1 vector (GE Healthcare, Uppsala, Sweden) The identity of both clones was confirmed by PCR using T7 sense and MP antisense primers (Table 1) and DNA sequencing Construction of GST–MP deletion mutant clones MP deletion mutant genes were amplified separately using high-fidelity fusion polymerase, with sense and antisense primers (marked with the prefix E, Table 2) corresponding to the N- and C-termini for each deletion mutant protein and the pGEX 4T1 MP clone as the template The PCR products were cloned into the EcoRI site of the pGEX 4T1 vector The identity of all clones was confirmed by PCR using T7 sense and mutant specific antisense primers (Table 2) and DNA sequencing Expression and purification of the recombinant proteins under normal and denaturing conditions The pRSET C-MP clone and the pGEX 4T1-MP clone were transformed separately into E coli BL21(DE3) pLysS cells (Novagen, Darmstadt, Germany) A single colony was inoculated into 20 mL of Luria–Bertani medium containing 268 50 lgỈmL)1 ampicillin, and allowed to grow overnight at 37 °C The overnight culture was inoculated into 500 mL of Terrific broth containing 50 lgỈmL)1 ampicillin and allowed to grow at 37 °C till the attenuance at 600 nm reached 0.6 The expression of MP was induced using 0.3 mm isopropylb-d-thiogalactopyranoside (Sigma-Aldrich, St Louis, MO, USA), and grown for 10 h at 15 °C The cells were harvested by centrifugation at 10 000 g for 10 and resuspended in 30 mL of lysis buffer (100 mm Tris ⁄ HCl, 200 mm NaCl, 10 mm b-mercaptoethanol, pH 8) Resuspended cells were sonicated for 15 at an amplitude of 30 in a Vibra-Cell sonicator (Sonics & Materials Inc., Newtown, CT, USA), and the lysate was centrifuged at 10 000 g for 10 at °C The solubility of the expressed protein was checked using SDS ⁄ PAGE [45] The protein bands were visualized by staining with Coomassie brilliant blue (Sigma-Aldrich) The rMP was purified from the insoluble fraction by Ni-NTA chromatography in the presence of m GnHCl The cell pellet was resuspended in 50 mL of lysis buffer containing m GnHCl and sonicated Ni-NTA agarose beads pre-equilibrated with lysis buffer containing m GnHCl were added to the supernatant obtained after centrifugation at 10 000 g for 10 min, and the protein was allowed to bind to the beads for h at °C The beads were then packed in a column and washed with 50 mL and 20 mL each of washing buffers A (lysis buffer containing 10 mm imidazole and m GnHCl) and B (lysis buffer containing 50 mm imidazole and 6M GnHCl), respectively, for 30 each The protein was then eluted in elution buffer (lysis buffer containing 300 mm imidazole and m GnHCl) The denatured purified protein was refolded by stepwise dialysis against lysis buffer (not containing imidazole) with decreasing concentrations of GnHCl (6, 4, 2, and m), and stored at °C The refolded rMP was used to raise antibodies in rabbit as described previously [22] FEBS Journal 278 (2011) 257–272 ª 2010 The Authors Journal compilation ª 2010 FEBS S R Chowdhury and H S Savithri For purification of soluble GST–MP, GST binding resin was added to the soluble fraction of the cell lysate obtained as described above and incubated for h at °C The resin was packed in a column and washed thoroughly with wash buffer (20 mm Tris ⁄ HCl pH 7.5 containing 200 mm NaCl, 10 mm imidazole, 0.1% Nonidet-P40 ((Sigma-Aldrich, St Louis, MO, USA) and 10 mm b-mercaptoethanol) The bound protein was eluted using 20 mm reduced glutathione in wash buffer The purified proteins were extensively dialysed against storage buffer (50 mm Tris ⁄ HCl, pH 8, containing 100 mm NaCl, 10 mm b-mercaptoethanol and 10% glycerol0 to remove the reduced glutathione, and stored at )20 °C The same procedure was used for the purification of GST–MP deletion mutants CD spectroscopy CD spectra were recorded using a Jasco-815 spectropolarimeter (Jasco Analytical Instruments, Easton, MD, USA) The molar ellipticity was monitored from 190 to 250 nm using 0.5 mgỈmL)1 protein in a 0.2 cm path-length cuvette with a bandwidth of nm and response time of s All spectra were corrected using respective buffer controls The stability of the protein was monitored by CD spectroscopy in a PTC-423S Peltier thermal control system (Jasco), by observing the change in the molar ellipticity at 210 nm due to loss of secondary structure with increase in temperature The temperature was increased at a rate of °CỈmin)1, and the ellipticity was monitored from 20–100 °C The melting temperature (Tm, the temperature at which 50% of the protein is denatured) of the protein was calculated from the curve obtained Fluorescence spectroscopy Fluorescence experiments were performed using a PerkinElmer LS5S luminescence spectrometer (Perkin-Elmer, Waltham, MA, USA) The intrinsic fluorescence spectrum was monitored from 300 to 400 nm upon excitation at 280 nm in a cm path-length cuvette Fluorescence of the protein (0.2–0.4 mgỈmL)1) in 20 mm Tris ⁄ HCl buffer, pH 8.0, was determined in the absence and presence of m urea Purification of NV SeMV was purified from infected Sesbania grandiflora (21 days post-infection) as described previously [21] Pull-down assay and ELISA for monitoring protein–protein interactions rMP was dialysed against assay buffer (20 mm Tris ⁄ HCl, pH 8) The stability of the protein in the assay buffer was checked by storing the protein overnight at °C There was Interaction of SeMV MP with viral coat protein no visible precipitation The sample was centrifuged at 100 g and the supernatant was used for the pull-down assay rMP and NV were mixed in a microcentrifuge tube (100 lg each in 100 lL) and vortexed at low speed in an end-to-end rotor at °C After h incubation, 20 lL of Ni-NTA resin (Novagen) was added, and the mixture was incubated at °C for h with intermittent mixing The mixture was subsequently centrifuged at 100 g for 60 s to pellet the bound protein with the resin The supernatant was discarded The pellet fraction was washed five times for each using mL each of buffer W1 (20 mm Tris ⁄ HCl, 100 mm NaCl, mm imidazole, pH 8), buffer W2 (20 mm Tris ⁄ HCl, 200 mm NaCl, 10 mm imidazole, pH 8) and buffer W3 (20 mm Tris ⁄ HCl, 200 mm NaCl, 15 mm imidazole, pH 8) Finally, the bound proteins were eluted using elution buffer (20 mm Tris ⁄ HCl, 200 mm NaCl, 250 mm imidazole, pH 8) The eluate, together with 50 lL aliquots of unbound and wash fractions, were separated by SDS ⁄ PAGE followed by silver staining to check for the presence of proteins The interaction between MP, MP mutants and NV was also tested by ELISA as described previously with minor modifications [46–49] The wells of the ELISA plate (F8 Nunc Maxisorp loose, Nunc, Roskilde, Denmark) were coated with 5.0 lg of first protein (100 lL per well) at 37 °C for h The protein was diluted with 1· NaCl ⁄ Pi (pH 7.4) The unadsorbed protein was removed, and the wells were blocked with 10% skimmed milk in 1· NaCl ⁄ Pi for h at 37 °C The plates were then incubated with the second protein for h at 37 °C BSA was used as a control The wells were washed three times for each with 1· NaCl ⁄ Pi containing 0.05% Triton X-100, and then three times with 1· NaCl ⁄ Pi for three The bound second protein was detected using polyclonal antibodies specific to it by incubating the wells with the antibodies (1 : 5000 dilution) for h at room temperature Washes were repeated as before, and the wells were further incubated with goat antirabbit IgG conjugated to horseradish peroxidase (1 : 10 000) in 5% skimmed milk in 1· NaCl ⁄ Pi (100 lL per well) for 45 min, followed by washing for 15 min, as described above, and addition of 1· substrate 3,3¢,5,5¢-tetramethylbenzidine (TMB) ⁄ H2O2 (diluted from 20· stock solution in distilled water) The reaction was stopped by the addition of N H2SO4 (50 lL per well) Interactions were quantified by determining the absorbance at 450 nm using a SpectraMax 340PC384 absorbance microplate reader (Molecular Devices Inc Sunnyvale, CA, USA) All experiments were performed in triplicate, and standard deviations were calculated Yeast two-hybrid interaction The yeast strain AH109 and plasmids pGBKT7 and pGADT7 were from Matchmaker Two-Hybrid System (Clontech Laboratories Inc., Mountain View, CA, USA), FEBS Journal 278 (2011) 257–272 ª 2010 The Authors Journal compilation ª 2010 FEBS 269 Interaction of SeMV MP with viral coat protein S R Chowdhury and H S Savithri conferring HIS3, ADE2, MEL1 and lacZ reporters and allowing high-stringency assays For bait and prey construction, the oligodeoxynucleotide primers shown in Table (marked with prefix E) were used for PCR amplification of MP, MP deletion mutant and CP genes Amplicons were sub-cloned into the EcoRI site of pGBKT7 (MP, ND16, ND35, ND49, CD3, CD19 and CD38) and pGADT7 (CP) vectors The yeast strains were transformed with the constructs, and colonies were grown according to the Clontech Yeast Protocols Handbook (Protocol No PT3024-1 Version No PR973283, Clontech www.clontech.com/images/pt/ PT3024-1.pdf) Plasmid selection within yeast cells were maintained by growing cells in minimal medium (0.67% yeast nitrogen base, 2% glucose) with appropriate omission of amino acids (–Leu and –Trp for yeast transformed with both bait and prey plasmids) Replica plating was performed under conditions of increasing stringency according to the manufacturer’s suggestions, whereby interacting proteins were sequentially analysed for growth on nutritional selection plates containing –Leu ⁄ –His ⁄ –Trp or –Ade ⁄ – Leu ⁄ –His ⁄ –Trp, with or without 5-bromo-4-chloro-3-indolyl-a-d-galactopyranoside (a-X-Gal) to monitor MEL1 reporter construct expression directly Images were captured after 4–6 days of growth at 30 °C AH109 yeast cells transformed with pGBKT7-P53 (murine p53 fused to GAL4 DNA BD) and pGADT7-T Ag (SV40 large T-antigen fused to GAL4 DNA AD) that had previously been reported to interact in a yeast two-hybrid assay [35] were used as a positive control in these experiments To determine the strength of protein–protein interactions, b-galactosidase solution assays were performed using orthonitrophenyl-b-galactopyranoside as the substrate (SigmaAldrich) b-galactosidase activity was quantified using the following formula: 1000 · [D420 ) (1.75)] ⁄ (T · V · D600), where the attenuance at 420 nm (D420) is due to product formation, D600 is the cell density of the culture, T is the reaction time (min) and V is the volume (mL) All b-galactosidase assays were performed in triplicate using constructs in both the GAL4 activating and DNA binding domain fusion proteins Expression of the interacting proteins was measured by direct antigen-coating ELISA The cells from co-transformed colonies grown in mL –Leu ⁄ – Trp ⁄ –His SD liquid medium were lysed, and the lysate was coated on to ELISA plates, blocked and washed as before Haemagglutinin polyclonal antibodies were used to check expression of CP from the pGAD T7 vector, and cMyC monoclonal antibody was used to monitor the expression of MP and the deletion mutant proteins Acknowledgements We thank Professor N Appaji Rao and Professor M.R.N Murthy (Molecular biophysics unit, Indian Institute of Science) for valuable discussions We thank the Department of Biotechnology and the Department 270 of Science and Technology, New Delhi, India, and the Indian Institute of Science, Bangalore, India, for financial support S.R.C thanks the University Grant Commission, New Delhi, India, for the senior research fellowship References Waigmann E, Lucas WJ, Citovsky V & Zambryski P (1994) Direct functional assay for tobacco mosaic virus cell-to-cell movement protein and identification of a domain involved in increasing plasmodesmal permeability Proc Natl Acad Sci USA 91, 1433–1437 Lazarowitz SG (1999) Probing plant cell structure and function with viral movement proteins Curr Opin Plant Biol 2, 332–338 Scholthof HB (2005) Plant virus transport: motions of functional equivalence Trends Plant Sci 10, 376–382 Carrington JC, Kasschau KD, Mahajan SK & Schaad MC (1996) Cell-to-cell and long-distance transport of viruses in plants Plant Cell 8, 1669–1681 Kawakami S, Watanabe Y & Beachy RN (2004) Tobacco mosaic virus infection spreads cell to cell as intact replication complexes Proc Natl Acad Sci USA 101, 6291–6296 Kasteel D, Wellink J, Verver J, van Lent J, Goldbach R & van Kammen A (1993) The involvement of cowpea mosaic virus M RNA-encoded proteins in tubule formation J Gen Virol 74, 1721–1724 Canto T & Palukaitis P (1999) The hypersensitive response to cucumber mosaic virus in Chenopodium amaranticolor requires virus movement outside the initially infected cell Virology 265, 74–82 Citovsky V, Knorr D & Zambryski P (1991) Gene I, a potential cell-to-cell movement locus of cauliflower mosaic virus, encodes an RNA-binding protein Proc Natl Acad Sci USA 88, 2476–2480 Carvalho CM, Pouwels J, van Lent JW, Bisseling T, Goldbach RW & Wellink J (2004) The movement protein of cowpea mosaic virus binds GTP and singlestranded nucleic acid in vitro J Virol 78, 1591–1594 10 Nurkiyanova KM, Ryabov EV, Kalinina NO, Fan Y, Andreev I, Fitzgerald AG, Palukaitis P & Taliansky M (2001) Umbravirus-encoded movement protein induces tubule formation on the surface of protoplasts and binds RNA incompletely and non-cooperatively J Gen Virol 82, 2579–2588 11 Lucas WJ (2006) Plant viral movement proteins: agents for cell-to-cell trafficking of viral genomes Virology 344, 169–184 12 Tamm T & Truve E (2000) Sobemoviruses J Virol 74, 6231–6241 13 Zaumeyer WJ & Harter LL (1943) Inheritance of symptom expression of bean mosaic virus J Agric Res 67, 295–300 FEBS Journal 278 (2011) 257–272 ª 2010 The Authors Journal compilation ª 2010 FEBS S R Chowdhury and H S Savithri 14 Bonneau C, Brugidou C, Chen L, Beachy RN & Fauquet C (1998) Expression of the rice yellow mottle virus P1 protein in vitro and in vivo and its involvement in virus spread Virology 244, 79–86 15 Sivakumaran K, Fowler BC & Hacker DL (1998) Identification of viral genes required for cell-to-cell movement of southern bean mosaic virus Virology 252, 376–386 16 Meier M, Paves H, Olspert A, Tamm T & Truve E (2006) P1 protein of Cocksfoot mottle virus is indispensable for the systemic spread of the virus Virus Genes 32, 321–326 17 Voinnet O, Pinto YM & Baulcombe DC (1999) Suppression of gene silencing: a general strategy used by diverse DNA and RNA viruses of plants Proc Natl Acad Sci USA 96, 14147–14152 18 Sarmiento C, Gomez E, Meier M, Kavanagh TA & Truve E (2007) Cocksfoot mottle virus P1 suppresses RNA silencing in Nicotiana benthamiana and Nicotiana tabacum Virus Res 123, 95–99 19 Bhuvaneshwari M, Subramanya HS, Gopinath K, Savithri HS, Nayudu MV & Murthy MR (1995) Struc˚ ture of sesbania mosaic virus at A resolution Structure 3, 1021–1030 20 Subramanya HS, Gopinath K, Nayudu MV, Savithri HS & Murthy MR (1993) Structure of Sesbania ˚ mosaic virus at 4.7 A resolution and partial sequence of the coat protein J Mol Biol 229, 20–25 21 Lokesh GL, Gopinath K, Satheshkumar PS & Savithri HS (2001) Complete nucleotide sequence of Sesbania mosaic virus: a new virus species of the genus Sobemovirus Arch Virol 146, 209–223 22 Satheshkumar PS, Lokesh GL, Sangita V, Saravanan V, Vijay CS, Murthy MR & Savithri HS (2004) Role of metal ion-mediated interactions in the assembly and stability of Sesbania mosaic virus T = and T = capsids J Mol Biol 342, 1001–1014 23 Satheshkumar PS, Lokesh GL, Murthy MR & Savithri HS (2005) The role of arginine-rich motif and b-annulus in the assembly and stability of Sesbania mosaic virus capsids J Mol Biol 353, 447– 458 24 Nair S & Savithri HS (2009) Processing of SeMV polyproteins revisited Virology 396, 106–117 25 Savithri HS & Murthy MRN (2010) Structure and assembly of Sesbania mosaic virus Curr Sci 98, 346– 351 26 Rost B, Yachdav G & Liu J (2004) The PredictProtein server Nucleic Acids Res 32, W321–W326 27 Kawakami S, Padgett HS, Hosokawa D, Okada Y, Beachy RN & Watanabe Y (1999) Phosphorylation and ⁄ or presence of serine 37 in the movement protein of tomato mosaic tobamovirus is essential for intracellular localization and stability in vivo J Virol 73, 6831– 6840 Interaction of SeMV MP with viral coat protein 28 Sokolova M, Prufer D, Tacke E & Rohde W (1997) The potato leafroll virus 17K movement protein is phosphorylated by a membrane-associated protein kinase from potato with biochemical features of protein kinase C FEBS Lett 400, 201–205 29 Rhee Y, Tzfira T, Chen MH, Waigmann E & Citovsky V (2000) Cell-to-cell movement of tobacco mosaic virus: enigmas and explanations Mol Plant Pathol 1, 33–39 30 Matsushita Y, Hanazawa K, Yoshioka K, Oguchi T, Kawakami S, Watanabe Y, Nishiguchi M & Nyunoya H (2000) In vitro phosphorylation of the movement protein of tomato mosaic tobamovirus by a cellular kinase J Gen Virol 81, 2095–2102 31 Waigmann E, Chen MH, Bachmaier R, Ghoshroy S & Citovsky V (2000) Regulation of plasmodesmal transport by phosphorylation of tobacco mosaic virus cell-to-cell movement protein EMBO J 19, 4875–4884 32 Ruan K, Li J, Liang R, Xu C, Yu Y, Lange R & Balny C (2002) A rare protein fluorescence behavior where the emission is dominated by tyrosine: case of the 33-kDa protein from spinach photosystem II Biochem Biophys Res Commun 293, 593–597 33 Lokesh GL (2002) Molecular insight into the genome organization and assembly of Sesbania mosaic virus PhD thesis, Indian Institute of Science, Bangalore, India 34 Chowdhury SR (2010) Molecular characterization of movement protein encoded by ORF of Sesbania mosaic virus PhD thesis, Indian Institute of Science, Bangalore, India 35 Li B & Fields S (1993) Identification of mutations in p53 that affect its binding to SV40 large T antigen by using the yeast two-hybrid system FASEB J 7, 957– 963 36 Rojas MR, Noueiry AO, Lucas WJ & Gilbertson RL (1998) Bean dwarf mosaic geminivirus movement proteins recognize DNA in a form- and size-specific manner Cell 95, 105–113 37 Brill LM, Dechongkit S, DeLaBarre B, Stroebel J, Beachy RN & Yeager M (2004) Dimerization of recombinant tobacco mosaic virus movement protein J Virol 78, 3372–3377 38 Brill LM, Nunn RS, Kahn TW, Yeager M & Beachy RN (2000) Recombinant tobacco mosaic virus movement protein is an RNA-binding, a-helical membrane protein Proc Natl Acad Sci USA 97, 7112– 7117 39 Lakowicz J (1999) Principles of Fluorescence Spectroscopy Kluwer Academic ⁄ Plenum Publishers, New York 40 Canetta E, Kim SH, Kalinina NO, Shaw J, Adya AK, Gillespie T, Brown JW & Taliansky M (2008) A plant virus movement protein forms ringlike complexes with the major nucleolar protein, fibrillarin, in vitro J Mol Biol 376, 932–937 FEBS Journal 278 (2011) 257–272 ª 2010 The Authors Journal compilation ª 2010 FEBS 271 Interaction of SeMV MP with viral coat protein S R Chowdhury and H S Savithri 41 Lekkerkerker A, Wellink J, Yuan P, van Lent J, Goldbach R & van Kammen AB (1996) Distinct functional domains in the cowpea mosaic virus movement protein J Virol 70, 5658–5661 42 van Lent J, Storms M, van der Meer F, Wellink J & Goldbach R (1991) Tubular structures involved in movement of cowpea mosaic virus are also formed in infected cowpea protoplasts J Gen Virol 72, 2615–2623 43 Kumar PP, Usha R, Zrachya A, Levy Y, Spanov H & Gafni Y (2006) Protein–protein interactions and nuclear trafficking of coat protein and bC1 protein associated with Bhendi yellow vein mosaic disease Virus Res 122, 127–136 44 Lee JY & Lucas WJ (2001) Phosphorylation of viral movement proteins – regulation of cell-to-cell trafficking Trends Microbiol 9, 5–8 45 Laemmli UK (1970) Cleavage of structural proteins during the assembly of the head of bacteriophage T4 Nature 227, 680–685 272 46 Carvalho CM, Wellink J, Ribeiro SG, Goldbach RW & Van Lent JW (2003) The C-terminal region of the movement protein of Cowpea mosaic virus is involved in binding to the large but not to the small coat protein J Gen Virol 84, 2271–2277 47 Goodfellow I, Chaudhry Y, Gioldasi I, Gerondopoulos A, Natoni A, Labrie L, Laliberte JF & Roberts L (2005) Calicivirus translation initiation requires an interaction between VPg and eIF4E EMBO Rep 6, 968–972 48 Kaiser WJ, Chaudhry Y, Sosnovtsev SV & Goodfellow IG (2006) Analysis of protein–protein interactions in the feline calicivirus replication complex J Gen Virol 87, 363–368 49 Leonard S, Plante D, Wittmann S, Daigneault N, Fortin MG & Laliberte JF (2000) Complex formation between potyvirus VPg and translation eukaryotic initiation factor 4E correlates with virus infectivity J Virol 74, 7730–7737 FEBS Journal 278 (2011) 257–272 ª 2010 The Authors Journal compilation ª 2010 FEBS ... similarity with MPs of viruses from other genera Within sobemoviruses, the sequence of the SeMV MP was closest to that of the SBMV-Ark MP (32% sequence identity), and the identity with MPs of other... Alfalfa mosaic virus Cucumber mosaic virus Cowpea mosaic virus Brome mosaic virus Tobamovirus Alfamovirus Cucumovirus Comovirus Bromovirus Percentage identity with SeMV Percentage similarity with. .. function of the pH of the FEBS Journal 278 (2011) 25 7–2 72 ª 2010 The Authors Journal compilation ª 2010 FEBS 261 Interaction of SeMV MP with viral coat protein A B C S R Chowdhury and H S Savithri