A chimeric scorpion a-toxin displays de novo electrophysiological properties similar to those of a-like toxins Balkiss Bouhaouala-Zahar 1 , Rym Benkhalifa 1 , Najet Srairi 1 , Ilhem Zenouaki 1 , Caroline Ligny-Lemaire 2 , Pascal Drevet 2 , Franc¸ois Sampieri 3 , Marcel Pelhate 4 , Mohamed El Ayeb 1 , Andre ´ Me ´ nez 2 , Habib Karoui 1 and Fre ´ de ´ ric Ducancel 2 1 Laboratoire des Venins et Toxines, Institut Pasteur de Tunis, Tunisia; 2 De ´ partement d’Inge ´ nierie et d’E ´ tude des Prote ´ ines, CEA, Saclay, France; 3 UMR 6560, Universite ´ de la Me ´ diterrane ´ e, CNRS, Inge ´ nierie des Prote ´ ines, Laboratoire de Biochimie, IFR Jean-Roche, Faculte ´ de Me ´ decine Nord, Marseille, France; 4 Laboratoire de Neurophysiologie UPRES EA 2647, UFR Sciences, Angers, France BotXIV and LqhaIT are two structurally related long chain scorpion a-toxins that inhibit sodium current inactivation in excitable cells. However, while LqhaIT from Leiurus quinquestriatus hebraeus is classified as a true and strong insect a-toxin, BotXIV from Buthus occitanus tunetanus is characterized by moderate biological activities. To assess the possibility that structural differences between these two molecules could reflect the localization of particular func- tional topographies, we compared their sequences. Three structurally deviating segments located in three distinct and exposed loops were identified. They correspond to residues 8–10, 19–22, and 38–43. To evaluate their functional role, three BotXIV/LqhaIT chimeras were designed by transfer- ring the corresponding LqhaIT sequences into BotXIV. Structural and antigenic characterizations of the resulting recombinant chimera show that BotXIV can accommodate the imposed modifications, confirming the structural flexi- bility of that particular a/b fold. Interestingly, substitution of residues 8–10 yields to a new electrophysiological profile of the corresponding variant, partially comparable to that one of a-like scorpion toxins. Taken together, these results suggest that even limited structural deviations can reflect functional diversity, and also that the structure–function relationships between insect a-toxins and a-like scorpion toxins are probably more complex than expected. Keywords: chimeric scorpion toxin; insect sodium channel; sodium current kinetics; molecular modelling. Long-chain scorpion toxins isolated from Androctonus australis hector and Buthus occitanus tunetanus scorpions [1,2] are responsible for human envenomation, a public heath problem in Tunisia [3]. These small and basic polypeptides, composed of a globular core compacted by four disulfide bridges, bind and modulate sodium channels in excitable cells [4,5]. They have been divided into a- [6,7] and b-toxins [8,9] according to their mode of action and binding properties [10,11]. Whereas b-toxins interfere with the current activation stage, a-toxins inhibit sodium current inactivation in excitable cells (reviewed in [10,11]). a-Toxins have been instrumental in functional mapping of voltage gated sodium channels [12,13] and display a wide array of preferences on interaction with sodium channels of different animal phyla [10]. Scorpion a-toxins are classically divided into the follow- ing three groups: (a) mammal a-toxins that are highly active on mammals, and display very low toxicity to insects, e.g. AahII toxin from the venom of the scorpion Androct- onus australis hector; (b) insect a-toxins that are highly toxic to insect and shows weak activity in mammalian central nervous system, e.g. LqhaIT from Leiurus quinquestriatus hebraeus scorpion; (c) a-like toxins, that display similar high toxicity to both mammals and insects, e.g. BomIII and BomIV [11,14] from Buthus occitanus mardochei and LqhIII from Leiurus quinquestriatus hebraeus scorpions [15]. Classically, binding of scorpion a-toxins to the receptor site 3 on the extracellular surface of sodium channels induces prolongation of action potentials due to selective inhibition or slowing of the fast inactivation process of the sodium current in vertebrate and insect electrophysiological preparations [12,16,17]. Interestingly, and despite some differences in their primary structure, all scorpion a-toxins that compete for binding to receptor site 3 on sodium channel reveal similar effects of inhibition [11,12,14,18]. However, some comparative studies make uncertain the strict assignment of many toxins to a particular pharmaco- logical group [11,17]. Thus, scorpion a and a-like toxins share similar and competitive binding activities towards insect sodium channels, when this is not the case in rat brain synaptosomes [17]. These observations support the existence of two distinct receptor sites for a and a-like toxins on sodium channels, the latter being more or less related in mammals or insects. On the other hand, LqhaIT one of the most studied insect a-toxins, seems to share some pharma- cological properties with a-like toxins [17], suggesting that the receptor sites recognized by both families of toxins either Correspondence to B. Bouhaouala-Zahar, Laboratoire des Venins et Toxines, Institut Pasteur de Tunis, 13 Place Pasteur, Belve ´ de ` re, Tunis, 1002 Tunisia. Fax: + 216 71 791 833, Tel.: + 216 71 1843 755, E-mail: balkiss.bouhaoulala@pasteur.rns.tn Abbreviations:BotXIV,a-toxin from the venom of Buthus occitanus tunetanus;LqhaIT, a-toxin from the venom of Leiurus quinquestriatus hebraeus; TSB, tryptic soy broth; AP, action potential. (Received 26 November 2001, revised 13 March 2002, accepted 5 April 2002) Eur. J. Biochem. 269, 2831–2841 (2002) Ó FEBS 2002 doi:10.1046/j.1432-1033.2002.02918.x partially overlap, or are closely localized on insect sodium channels. Furthermore, recent data mentioned the possibility that LqhaIT could have a weak effect on sodium channels activation, an activity classically attributed to a-like toxins even if such activity is not very significant [17]. Clearly, additional data are necessary to tentatively elucidate the structure–function relationship of a-toxins in general, and between insect a-toxins and a-like toxins in particular. Recently, we cloned and characterized a new insect a-toxin from the venom of the scorpion Buthus occitanus tunetanus called BotXIV [19]. We showed that BotXIV shows 49.25 and 52.23% identities with LqhaIT and LqqIII, respectively, and is not toxic on mice even at high concentration [up to 2.5 lg per 20 g of body weight at intracerebroventricularly (i.c.v.) route]. However, unlike other insect a-toxins, BotXIV displays a weak anti-insect activity, a moderate toxicity to cockroach and slows only the inactivation process of insect sodium channels. Also, comparison of BotXIV with BomIV, a classical member of a-like toxins [11] revealed 57% of amino-acid identity, as compared to the 73% existing identity between LqhaIT and BomIV. These data suggest that a-like toxins form a large family of structurally related compounds, displaying similar basic biological properties, but susceptible also of expressing particular activities. The aim of this paper was to tentatively explore the possibility that subtle structural deviations between BotXIV and LqhaIT, could reflect the localization of a particular functional topography. Such a relation was recently evidenced in the case of three fingered toxins from snakes [20,21]. To investigate this hypothesis, we compared in detailed the amino-acid sequences of BotXIV and LqhaIT, and searched for significant differences. Thus, we identified three different stretches of amino acid residues located in three distinct exposed areas on the surface of the toxins: the first five-residue turn, the N-terminal part of a helix and the b turn between the two last b strands. Using site-directed mutagenesis, three BotXIV variants were constructed by replacement of residues 8–10, 19–22, or 38–43 with those found in LqhaIT. These three BotXIV/LqhaIT chimeras together with the native BotXIV recombinant toxin were expressed in Escherichia coli. Their overall structural and detailed electrophysiological properties were studied and compared. Interestingly, in this paper we show that substitution of residues 8–10 is associated with de novo electrophysiological properties partially comparable with those of BomIV, an a-like scorpion toxin. Implications of that particular functional anatomy elucidation regarding the classification of a-toxins of scorpions will be discussed. MATERIALS AND METHODS Materials Enzymes were purchased from Boehringer–Mannheim and Biolabs. Oligonucleotides were synthesized by Genset. HPLC separation procedure was performed using a Merck system (L-4250 UV/Vis detector and L-6200 intelligent pump). N-Terminal sequencing was carried out using an Applied Biosystem sequencer (477A protein sequencer) on line with a phenylthiohydantoin analyser (120A analyser). Dichroic spectra were recorded at 20 °C on a Jobin–Yvon CD6 using toxin solutions which concentrations were determined by spectrometry. SDS/PAGE was performed using the Phast System from Pharmacia. Bacterial strains and plasmids The E. coli strain MV1190 was used as the host strain for transformations by M13-derived vectors. The strain CJ236 [dut – , ung – , thi1, relA1/pCJ105 (Cm r )] was used to prepare single-stranded template DNA for mutagenesis, as des- cribed by Kunkel [22]. The bacterial host used for expres- sion was E. coli HB101 [F – D(mcrC-mrr) leu supE44 ara14 galK2 lacY1 proA2 rpsL20 (Str r ) xyl-5 mtl-1 recA13 23]. Expression vector pEZZ18 was obtained from Pharmacia. Molecular biology Manipulations of DNA were performed according to published procedures [24]. Single- and double-stranded DNA sequencing procedures were performed by the dideoxynucleotide method [25] using the T7 sequencing kit from Pharmacia and [ 35 S]dATP (Amersham). Site-directed mutagenesis assays were performed according to Kunkel et al. [22] using a Bio-Rad kit. The cDNA encoding the precursor of BotXIV [19] was modified as follows: a KpnI/ BamHI fragment carrying the sequence encoding BotXIV was inserted into the corresponding restriction sites of M13mp19 to produce M13mp19-BotXIV template for mutagenesis. Phages from an individual lysis plaque were used to re-infect fresh host cells to produce high-titer phage stock. This stock was then passed through two rounds of infection of E. coli CJ236 dut – ung – host. Single-stranded phage DNA was then isolated from a large volume of phage-containing supernatant. Substitutions of BotXIV amino-acid stretches: Q 8 -P-H 10 ,I 19 -S-S-G 22 or G 38 -H-K-S- G-H 43 by the corresponding sequences in LqhaIT were performed using the following oligonucleotides: 5¢-GGTTA TATTGCCAAGAACTATAACTGTGCATAC-3¢,5¢-C ATTGTTTAAAAATCTCCTCAGGCTGCGACACTTT A-3¢,and5¢-ACGAGTGGCCACTGCGGACATAAATC TGGACACGGAAGTGCCTGCTGG-3¢, respectively. Production of recombinant chimera toxins in E. coli Bacteria E. coli HB101 transformed by the expression vectors pEZZ-M8-10, pEZZ-M19-22 or pEZZ-M38-43 were grown in a 5-L fermentor (LSL Biolafitte, Saint Germain en Lay, France) with an initial culture volume of 4-L of tryptic soy broth (TSB) medium (Difco) supple- mented with 5 gÆL )1 of glucose and 200 lgÆmL )1 ampicillin. Conditions of production were performed as previously described [19]. Hybrid recombinant proteins contained in extracted periplasmic fractions and in the culture medium were purified by affinity chromatography on an IgG- Sepharose column according to Ducancel et al. [26], then, lyophilized. The procedure followed to cleave the fusion proteins by CNBr treatment was previously described by Boyot et al. [27]. Purification of cleaved recombinant chimeras was performed as previously described [19]. Electrophysiological techniques Adult male cockroaches (Periplaneta americana)wereused. A segment (1.5–2.5 mm) of one giant axon was isolated 2832 B. Bouhaouala-Zahar et al. (Eur. J. Biochem. 269) Ó FEBS 2002 from a connective linking the fourth and fifth abdominal ganglia. The preparation was immersed in paraffin oil and an Ôartificial node of RanvierÕ was created [28]. Active membrane area of 0.01–0.02 mm 2 (node) was superfused with saline or test solutions. Membrane potentials and transmembrane currents of this small surface of axonal membrane were recorded in current-clamp or voltage-clamp using the double oil-gap single fiber technique as described in detail earlier [29,30]. Normal physiological saline had the following composition (in m M ):NaCl,200;KCl,3.1;CaCl 2 , 5.4; MgCl 2 , 5.0; Hepes buffer, 1.0; pH 7.2. Lyophilized M8- 10 and BotXIV were dissolved in the saline solution to final concentrations of 0.5 or 2.0 · 10 )6 M , in the presence of bovine serum albumin (0.25 mgÆmL )1 ) before tests. Potas- sium currents were blocked by 0.5 · 10 )3 M 3,4-diamino- pyridine (Sigma Chemical, France), and when needed sodium currents were blocked by 5 · 10 )7 M tetrodotoxin (Sigma Chemical, France). Sodium conductance (g Na ) can be calculated as a function of the membrane potential according to the equation: g Na ¼ I Na =ðE m À E Na Þ where E m and E Na are the membrane potential, and the reversal potential for Na + current, respectively. Smooth curves correspond to the best fit through the mean data points according to the Boltzmann distribution: g Na =g Na max ¼ 1=f1 þ exp½ðE 0:5 þ E m Þ=kg where E 0.5 is the potential at which 50% of the maximal sodium conductance are reached, k is the slope factor. Voltage-dependence of steady-state inactivation of Na + channels was determined using a conventional two-pulses protocol: the test pulse to )10 mV is preceded by long (40 ms) prepulses from )80 to +30 mV, and the relative amplitude of the peak Na + current during the test pulse is plotted according to the prepulse value. Smooth curves correspond to the best fit through the mean data points according to the Boltzmann distribution: I Na =I Na max ¼ 1=f1 þ exp½ðE m þ E 0:5 Þ=kg where E 0.5 is the potential at which 50% of the sodium channels are inactivated, k is the slope factor. Enzyme-linked-immuno-sorbent-assays ELISAs were used to assess cross antigenicity of each purified recombinant BotXIV mutant towards different polyclonal antibodies. Some were raised against toxic fractions BotG-50 and AahG-50 from Buthus occitanus tunetanus and Androctonus australis hector venoms, respect- ively; or against BotI and AahII purified toxins. For this purpose, optimization of the previously described proce- dures [19,31] was carried out. In vivo insect and mammal toxicities (biological assays) For LD 50 determination, groups of four female C57/B16 mice (22 ± 0.2 g) were individually i.c.v. injected under light diethyl ether anesthesia with 20 ng to 2.5 lgof recombinant proteins. Toxicity of purified BotXIV mutants were assessed on four Blatella germanica males per dose (50 mg body weight). A volume of 0.5–2 lL was injected in the abdominal segments, and the lethality was monitored after 1 h. For all injections, the solvent used was 0.15 M NaCl containing 1 mg BSA per mL. The LD 50 values were calculated according to Reed & Muench method [32]. Molecular modelling of BotXIV and m8–10 mutant Molecular modelling of both BotXIV and its 8–10 mutant were based on the experimentally determined three-dimen- sional structures of two templates: toxin II of Androctonus australis hector (AahII) solved at 1.3 A ˚ (PDB entry 1ptx [33]), and toxin V (CsV; PDB entry 1nra [34]), of Centruro- ides sculpturatus, by using the program MODELLER 3 [35], running on a silicon Graphics Indigo R3000 workstation. The first set of models was obtained from manual sequence alignment. To limit the problems with backbone dihedrals of nonGly residues, we avoided to aligning the Gly residues with nonGly residues. The 40 first models (20 in each protein) were screened with the programs PROCHECK [36], PROSA I [37] and INSIGHT II (Molecular Simulation Inc.), from which only four models for each protein were selected and then used as templates in the final subsequent series. Electrostatic properties The electrostatic potential and outside isopotential gradients on the molecule surfaces were computed with the program GRASP [38]. The ionic strength was 0.145 M and the probe radius was 1.4 A ˚ . The dielectric constant was 2 inside and 80 outside the solute molecules. Except the His residues, all acidic and basic residues were set in their ionized form. RESULTS Identification of divergent regions To tentatively clarify the structure–function relationships existing between a-like and a-insect scorpion toxins, we compared in details the primary structures of BotXIV and representative a-toxins. Thus, LqqIII, BotIT1, BomIV and Bom III display 49, 53, 54, 57 and 73% identities with LqhaIT, respectively. These data suggest that BotXIV occupies an intermediate position between strictly insectici- dal a-toxins (LqhaIT, LqqIII, and BotIT1) and typical a-like toxins (BomIV and BomIII). This confirms our previous experimental results, which established that BotXIV was inactive towards mammals and weakly toxic for Blatella cockroaches [19]. Thus, a precise comparison of BotXIV and LqhaIT primary sequences essentially revealed three divergent regions containing most of the amino acid variations noticed between these two functionally unrelated molecules. It is noteworthy, that these divergent regions mostly correspond to three exposed to solvent loops connecting conserved a helix and b sheet elements (Fig. 1). Thus, segment 8–10 is part of the b turn (8–12) following the first b strand (residues 1–5). Interestingly, the sequence found in BotXIV (Q 8 -P-H 10 ) is similar to the corresponding ones in BomIII and BomIV toxins (Q 8 -P-E 10 )twotypical a-like toxins, when totally different from those ones of true insecticidal toxins (LqhaIT, LqqIII, and BotIT1), K/Q 8 -N- Y 10 . The second main divergent region is constituted of the loop preceding the unique a helix. Classically, it displays variable length and amino acid content from one toxin to Ó FEBS 2002 Design of chimeric scorpion a-toxins (Eur. J. Biochem. 269) 2833 another. Thus, the sequence I-S-S-G(19–22) found in BotXIV is replaced by D-A-Y in LqhaIT. Finally, the third variable segment corresponds to residues 38–43, and includes three amino acids of the second LqhaIT b strand (34–39) and the following bturn. Here also, BotXIV and a-insect toxins display totally different sequences: GHKSGH(38–43) vs. QWAGKY in LqhaIT for instance. Based on these observations, we built three BotXIV/ LqhaIT chimeric molecules corresponding to the individual substitution of deviating and exposed to the solvent regions 8–10, 19–22 or 38–43 in BotXIV by the equivalent sequences found in LqhaIT (Fig. 1). The latter should be noted: BotXIVM8-10, M19-22, and M38-43. Production, purification and characterization of recombinant chimera Mutated DNA fragments surrounded by KpnI(5¢)and BamHI (3¢) restriction site sequences were excised from M13mp19-BotXIV vectors and inserted into the corres- ponding sites in the pEZZ18 expression vector [39]. The three BotXIV variants were produced as recombinant ZZ fusion proteins as previously described [19]. Briefly, fusion proteins were mainly found in the culture medium of bacterial suspensions, as expected from pEZZ-18 expression vector [39]. Affinity chromatography performed on IgG– Sepharose allowed as expected, recovery of recombinant hybrid proteins having an apparent 22-kDa molecular mass (not shown). We noticed also the presence of few low molecular weight fragments resulting probably from pro- teolytic degradation events of the toxin moiety, as previ- ously and classically observed for such compounds [19,26,40,41]. The three IgG-purified fractions revealed similar proteic profiles and overall yields were estimated between 16 and 18 mg of fusion proteins per litre of culture. Recombinant variant fused molecules were treated by cyanogen bromide as previously described [27]. The average efficiency of the CNBr cleavage was estimated to 35% (Fig. 2, lanes 3 and 4), and the products were purified by cation HPLC (data not shown). Recombinant chimera displayed an apparent 7 kDa molecular mass as showed in the case of BotXIVM8-10 variant (Fig. 2, lane 2). The three recombinant chimera comigrated with recombinant BotXIV on a 20% SDS/polyacrylamide gel, and shown the expected amino acid composition and N-terminal amino- acid sequences (data not shown). The circular dichroic spectra of the recombinant and chimeric BotXIV proteins revealed similar overall profiles (Fig. 3), associated however, Fig. 2. SDS/PAGE (20% Phast-gel) of a cleaved M8-10 variant. Lane 2 represents the cleaved and HPLC-purified recombinant M8-10 variant. Chimeric protein BotXIVM8-10 appears as a proteic band of % 7 kDa. Lanes 3 and 4 correspond to crude cleavage mixtures of HPLC-purified hybrid fractions. Lanes 1 and 5, correspond to medium and low molecular mass markers, respectively. Fig. 1. Alignment of principal scorpion a-neurotoxins amino acid sequences. The amino-acid sequences are aligned according to their cysteine residues (orange) and their three-dimensional structures (in italic for known three-dimensional structures). Disulfide bridges are indicated in dashed lines. Positively charged residues (K/R) are indicated in blue, negatively charged residues (D/E) in red, and aromatic residues in green. Consensus numbering is displayed under the sequences. The secondary structures are indicated in the top line. Deletions are indicated by (–). The three main divergent regions involved in the building of BotXIV/LqhaIT chimeric molecules are in boxes. LqhaIT, Leiurus quinquestriatus hebraeus a-insect toxin; LqqIII, Leiurus quinquestriatus quinquestriatus toxin III; BotI, IT1, and XIV, Buthus occitanus tunetanus toxin I, insect toxin I, and XIV, respectively; BomIII and BomIV, Buthus occitanus mardochei toxins III and IV. 2834 B. Bouhaouala-Zahar et al. (Eur. J. Biochem. 269) Ó FEBS 2002 to a weak increase in the positive 190-nm band coupled to a more significant one in the negative 205-nm band of the CD spectra. Finally, about 1 mg of each recombinant BotXIV variants was obtained from 20 mg of initial fusion protein. Cross antigenicity and biological toxicity of purified recombinant BotXIV mutants To establish the antigenic profiles of the three HPLC- purified BotXIV mutants, we performed ELISA using various scorpion antitoxins sera [42]. Thus, BotXIVM8-10, BotXIVM19-22 and BotXIVM38-43 variants, were simi- larly recognized by the polyclonal antibodies raised against BotG-50 (a partially purified mixture of Buthus occitanus tunetanus venom) or BotI toxin. On the contrary, very low cross antigenicity was observed with anti-AahII toxin or AahG-50 toxic fraction (data not shown). A similar result was initially observed for recombinant BotXIV [19]. Together, these data indicate that the three substitutions introduced within BotXIV did not modify significantly its overall antigenic profile [19]. Furthermore, they indicate that these three BotXIV mutants as BotXIV all belong to the same antigenic group related to Buthus occitanus tunetanus (Bot) scorpion a-toxins, which is different from those of Androctonus australis hector [42]. I.c.v. injections in C57/Black 6 mice of purified Bot- XIVM8-10, M19-22, or M38-43 variant ranging from 2 ng to 2.5 lg did not cause any toxic effect. These results clearly established that the three BotXIV/LqhaIT chimeric mole- cules are devoided of any toxicity towards mammal, because aweaklytoxicLD 50 value in mammals corresponds on an average to 100 ng. This result was not surprising, because the starting toxin BotXIV was already inactive towards mammals [19], and the three chimeras were obtained by limited substitution of equivalent regions between BotXIV (as starting molecule) and LqhaIT (as donor molecule), which is classically reported as a potent anti-insect toxin [14,15,43]. Unexpectedly however, injection to Blatella of 1 lg of each of the three recombinant chimera did not induce any additional insect lethality, when in the particular case of BotXIVM8-10 variant, a contractive effect of injected Blatella was noticed. Thus, when substitution of 19–22 and 38–43 regions completely affected the initial insect toxicity of BotXIV, BotXIVM8-10 variant is charac- terized by an intermediate biological mode of action towards insects. Electrophysiological results To compare the effects of native and mutated BotXIV molecules on the insect channels, we carried out standard current- and voltage-clamp experiments on cockroach axonal preparations, as described in Materials and methods. As previously reported, BotXIV has typical a-toxins effects as it was shown to slow down the sodium current inactivation [19]. First of all, both BotXIVM19-22 and M38-43 did not show any effect neither on action potential or sodium current decay as compared to BotXIV (data not shown). These data confirm the absence of insect toxicity noticed previously. On the other hand, in the case of BotXIVM8-10 variant, modifications of the initial electro- physiological properties of BotXIV were observed in current- and voltage-clamp conditions. Current-clamp conditions. When BotXIV (1.4 · 10 )6 M ) was devoid of any effect on the action potential (AP) amplitude, or on the membrane resting potential value, BotXIVM8-10 was applied at the same concentration; BotXIVM8-10 caused an unusual and slight membrane depolarization of about 5–8 mV (Fig. 4A,B). Furthermore, BotXIV and BotXIVM8-10 both increase the action potential duration and lead to a progressive prolongation of the evoked AP with a more drastic effect in the case of the native toxin. In fact, for the same toxin application time (14 min) BotXIV induced a plateau potential lasting for 110 ms followed by a long lasting and a very slowly decayed depolarization. In the case of the BotXIVM8-10, the evoked ÔplateauÕ is only 3–6 ms duration with a normal repolariza- tion phase (Fig. 4B). In addition, an artificial re-polarization by-passing a constant hyperpolarizing current, did restore neither the PA amplitude nor its initial duration. Voltage-clamp conditions. Membrane sodium currents were measured under voltage-clamp conditions in response to a step depolarization from a holding potential (E h ) ¼ )60 mV to a membrane potential (E m ) ¼ )10 mV, after suppression of the potassium current with 3.4-DAP 0.5 · 10 )3 M . In normal conditions, and as shown in Fig. 4C,D less than 3 ms were necessary to obtain a complete I Na inactivation. Application of BotXIVM8-10 induced a progressive and dose-dependent development of a maintained sodium current which was about 6% of the peak at 0.7 · 10 )6 M (Fig. 4D), and reached 12% at 1.4 · 10 )6 M . Besides, this mutant slightly decreased the initial peak amplitude of the inward sodium current by about 20–24%. At the end of the voltage pulse, the maintained current returned to 0 with a slightly slowed deactivation. Finally, a 10-l M tetrodotoxin post-application generated a constant but slight inward current of about )20 to )26 nA at the holding potential (Fig. 4D). In another series of experiments, and after selective suppression of I Na Fig. 3. UV circular dichroism spectra of BotXIV toxin and its three chimeric variants. The cell path length is 0.05 cm and the recording temperature is 20 °C. The different CD spectra are shown as following: native BotXIV toxin (––), M8-10 (ÆÆÆÆ), M19-22 (- - -), and M38-43 (- Æ - Æ -) BotXIV/LqhaIT chimera. Ó FEBS 2002 Design of chimeric scorpion a-toxins (Eur. J. Biochem. 269) 2835 with 10 )6 M of tetrodotoxin, it was demonstrated that BotXIVM8-10 (1.4 · 10 )6 M ) did not modify potassium conductance (data not shown). Effects on sodium activation and inactivation voltage dependence. Sodium peak current measurements during voltage pulses from )80 to 10 mV allowed us to calculate sodium conductance (g Na ) as a function of the membrane potential as indicated in Materials and methods. Figure 5B shows that, BotXIVM8-10 shifted the relative sodium conductance by about 5 to 10 mV towards negative potentials, whereas BotXIV had no effect on activation (Fig. 5A). Figure 5 illustrates also the voltage dependence of steady-state inactivation of Na + channels. Under normal conditions, the sodium current inactivation was complete at 0to)10 mV, whereas with BotXIVM8-10 the inactivation was almost complete but the curve is shifted by about 10– 20 mV towards negative potentials (Fig. 5B). On the other hand, under BotXIV application the sodium current inactivation remained partial and the curve was shifted by about 10 mV towards more positive potentials (Fig. 5A). It is important to notice that when using BotXIVM8-10, the voltage dependence was decreased both during the activation and inactivation mechanisms, in presence of BotXIV the sodium current voltage dependence was decreased only in the case of the inactivation process. These data imply that the mutated toxin opens Na + channels at very negative potential values, suggesting that sodium current is activated and inactivated earlier than in normal conditions. To summarize, BotXIVM8-10 variant affects in the same time the sodium current activation and inactiva- tion mechanisms, when BotXIV only affects the inactivation process. Together, our results clearly show that the substi- tution of segment 8–10 in BotXIV by its equivalent in LqhaIT, yields to the acquisition by BotXIVM8-10 variant of original electrophysiological properties. Molecular mode- ling and electrostatic potential studies were then carried out to tentatively explain the biological properties displayed by BotXIVM8-10 variant. Molecular modeling of native BotXIV and BotXIVM8-10 variant Figure 6 illustrates the best a-carbon BotXIV and M8-10 models we obtained. They are similarly oriented (face A view) as the published experimental structures of CsEV3 [34] and AahII [44]. Clearly, the selected models predict three-dimensional structures similar to the related a-toxins. The main differences affect the C-terminal region especially Fig. 5. Effects on sodium activation and inactivation voltage dependence. Sodium peak current measurements during voltage pulses from )80 to 10 mV allowed us to calculate sodium conductance (g Na ) as a function of the membrane potential (see Method paragraph). Control meas- urements are represented by open symbols. (A) 10 min after BotXIV application, the sodium current steady state inactivation curve (d)is slowed and is shifted to more positive potentials while the sodium current activation curve (m) remains unchanged. (B) Ten minutes after M8-10 application, both sodium inactivation and activation curves (d,m) are shifted to more negative potentials. Fig. 4. Effects of native and M8-10 chimeric BotXIV proteins on the action potential and the sodium current of isolated cockroach axons. (A,B) Current-clamp experiments: superimposed records of action potentials evoked by a short (0.5 ms) depolarizing current pulse of 18 to 20 nA, at initial time: control (C), after BotXIV (A) and M8-10 (B) application. Note the progressive evolution of the action potential durations under BotXIV (A) and the axonal membrane depolarization under M8-10 associated to a slight prolongation of AP duration and a AP amplitude decrease. An artificial repolarization (AR) does not restitute the initial AP (B). (C,D) Voltage-clamp experiments: cock- roach axonal sodium current recordings are evoked by voltage pulses of )10 mV from a holding potential E h ¼ )60 mV. In normal con- ditions, I Na completely inactivates in less than 3 ms (C). BotXIV application induces a maintained inward sodium current without affecting the inward peak sodium current (C). M8-10 application induces a decrease of the peak sodium current amplitude associated with a maintained inward sodium current (D). Tetrodotoxin applica- tion reveals a slight holding inward sodium current (D). 2836 B. Bouhaouala-Zahar et al. (Eur. J. Biochem. 269) Ó FEBS 2002 for BotXIV, the latter being predicted larger in the case of BotXIVM8-10 variant. It is noteworthy, that in the 40 BotXIV and M8-10 variant models, the C-terminus extremity displayed the homogenous organization shown on Fig. 6. Electrostatic properties of the models The existence onto the surface of scorpion a-neurotoxins of an electrostatic potential is suspected to contribute to the recognition of the receptor site [45]. By resolving the Boltzman–Poisson equation, the program GRASP is capable of calculating the electrostatic potential at any point of a grid in the space surrounding a protein molecule [38]. Applied to BotXIV and BotXIVM8-10 mutant, the program allowed the visualization of several charged amino acid residues susceptible to form an electrostatic potential gradient on the surface of the molecule in the solvent space (Fig. 7). The positively and negatively charged residues are in blue and red, respectively, whereas the neutral side-chains are indicated in white. Figure 7A shows the face A (hydrophobic face) of BotXIV and BotXIVM8-10, com- paratively to the published RMN structure of LqhaIT [46]. On the contrary of the clear dipolar charge repartition of LqhaIT (with positive charges localized in C-terminal region: R3, K42, K62 R65 and negative charges: D4, D20, D54), BotXIV and BotXIVM8-10 display a different and less homogenous repartition of charges. However, the global charge (+1) of the face A of these three molecules remains unchanged. BotXIVM8-10 and BotXIV display a conserved charge distribution except for the C-terminal region, the orientation of which was modified upon substi- tution of segment 8–10, as predicted from modeling. Finally, analysis of the B faces (Fig. 7B) revealed that the main differences between LqhaIT, BotXIV and BotXIVM8-10 molecules, rely upon the substitutions K28/E29 in BotXIV and BotXIVM8-10, together with K9/Q8 in the particular case of BotXIVM8-10 (Fig. 7B). DISCUSSION The aim of this paper was to explore the possibility that subtle structural deviations between BotXIV and LqhaIT, could reflect the localization of a particular functional topography. Based on sequence analysis and the identifica- tion of three divergent regions between these two a-toxins, we explored the biological implications of these segments by building corresponding chimeric molecules. From a general point of view and as compared to rBotXIV, the substitu- tions performed did not modify the yield of production of the three recombinant chimera. This suggests that the variants display a structural stability and a proteolytic sensitiveness similar to those of the starting recombinant molecule. This is partially corroborated by the CD spectra of the three purified recombinant variants that reveal similar, but not identical, profiles as compared to rBotXIV. This observation suggests that the three recombinant BotXIV variants probably adopt a similar overall spatial arrangement as the unmodified compound, characterized by a similar overall secondary structure content; however, the local structural features may be different. Furthermore, each chimeric molecule shares an identical antigenic profile and cross-reactivity pattern with BotXIV. Together, these results strongly suggest that the transfer of residues 8–10, 19–22 or 38–43 has a limited effect on the overall three- dimensional structure adopted by the three recombinant molecules generated and tested in the present study. This further illustrates the stability and the structural flexibility of the a/b scorpion motif [47]. When the three segments were substituted to form the BotXIV variants, M8-10, M19-22 and M38-43 form a homogenous area largely overlapping the putative toxic Fig. 6. Homology molecular modeling of BotXIV and M8-10 mutant. Ribbon representations of experimentally determined structures of AahII (cyan), CsV (red), and best models of BotXIV (orange) and its M8-10 variant (pink). Ó FEBS 2002 Design of chimeric scorpion a-toxins (Eur. J. Biochem. 269) 2837 surface of scorpion a-neurotoxins affecting sodium channel gating [45]. Unexpectedly, however, when the three substi- tutions were performed independently in BotXIV, the weak lethality initially observed after abdominal injection to Blatella cockroaches was totally abolished. More surpris- ingly, when BotXIVM19-22 and M38-43 mutants are characterized by an absolute lack of electrophysiological effects on cockroach giant axons, M8-10 variant shows controversies effects. Assuming the absence of major structural change as discussed above, the loss of toxicity suggests that subtle structural deviations might have affected the structural integrity of the Ôminimal toxicÕ surface characterizing BotXIV. Numerous studies are consistent with a multipoint receptor recognition site onto the surface of scorpion a-neurotoxins including residues at positions: 8, 10, 17, 18, 58, 59, 62, and 64 in interaction with the receptor [45,48–50]. In addition, the spatial arrangement of the toxin polypeptide chain together with the formation of an electrostatic potential are also predicted to participate to the capacity of these compounds to interact specifically and with high affinity with voltage-sensitive sodium channels. In this respect, our results are not surprising, because the substitutions we performed are only partial, and thus too limited to yield to the design of a LqhaIT-like toxic site Fig. 7. Electrostatic gradient potential obtained with GRASP program. The gradient potential surfaces were computed from the modeled structures of BotXIV (top left), M8-10 mutant (top right), comparatively to that experimentally determined of recombinant LqhaIT (bottom). Faces A and B of thetoxinsareshownin(A)and(B),respectively. 2838 B. Bouhaouala-Zahar et al. (Eur. J. Biochem. 269) Ó FEBS 2002 respecting the structural integrity of the transferred region. Recently, we have shown the importance of such a structural respect in the case of the successful design of a recombinant fasciculin-like molecule obtained by transfer- ring the structural-deviating segments that exist between fasciculins and short-chain neurotoxins from snakes [20,21]. Clearly, substitution of residues QPH(8–10) in BotXIV by the segment KNY (LqhaIT), which was recently reported as playing a major role in the biological activity of LqhaIT [45], results in de novo electrophysiological properties of BotXIVM8-10 variant as compared to BotXIV. Indeed, and as classically observed with scorpion a-toxins, BotXIVM8-10 variant induces a prolongation of the action potential duration on cockroach giant axons. Furthermore under voltage-clamp conditions, the voltage dependence is decreased both during the activation and inactivation mechanisms when in the same conditions BotXIV toxin only slows the sodium current inactivation process. Thus, the sodium current activation and the inactivation mechanisms, are both and uniquely modified in presence of BotXIVM8-10. Such results were sometimes observed after LqhaIT application, but in a much less significant manner [51]. Sodium current activation is also affected in the case of a-like toxins. Thus, it was recently shown that BomIV tested on the same insect preparations inhibits the sodium current inactivation process with additional effects on the sodium current activation [17]. In the presence of BotXIVM8-10 mutant, as with BomIV, we observed a resting depolarization due to the induced constant holding current, which is also responsible of the shift of the sodium current voltage dependence to negative potentials. Furthermore, this shift induces an ÔearlyÕ inacti- vating sodium current, which has not been seen until now with a and a-like neurotoxins. Thus, a part of the affected sodium channels might be unable to participate in the fast transient current. This hypothesis could explain, at least partially, the decrease of the peak sodium current. For the first time, a shift of inactivation curve towards negative potentials can be unambiguously attributed to the substitution of residues 8–10 within the first b turn of a scorpion a-neurotoxin. That result provides a second example of how a structural deviation can be associated to a particular functional topography. It also emphasizes the unique analytical power of a ÔpositiveÕ functional mapping strategy based on the identification of a particular biological property absent in the host scaffold, i.e. BotXIV. However, the reasons for the dual effect observed upon transfer of the segment 8–10 from LqhaIT to BotXIV (i.e., the loss of insect toxicity and the de novo acquisition of particular electrophysiological properties) remains unclear. Interest- ingly, it was recently proposed that the pharmacological versatility displayed by scorpions a-neurotoxins might be related to the structural configuration of the C-terminal tail [50]. Indeed, based on structure comparisons and bioactive surface identifications, it was hypothesized that the highly variable and dynamic C-terminal tail together with the spatially vicinal residues, form the interacting areas onto the surface of scorpion a-neurotoxins. Thus, the C-termini of scorpion a-neurotoxins in general, and of LqhaIT in particular, is positioned between the five-residue turn (8–12) and the b turn formed by residues 40–43. If the first one is identical between BotXIVM8-10 and LqhaIT, the second turn displays several differences; AGK(40–43) vs. KSG(40–43) in LqhaIT and BotXIVM8-10, respectively. Furthermore, Lys58, which is conserved within scorpion a-neurotoxins and predicted to form a network stabilizing the C-terminus, is replaced by an isoleucine in BotXIVM8- 10. Finally, the length and amino-acid composition of the C-termini of LqhaIT and BotXIVM8-10 are signifi- cantly different; RVPGKCR(58–66) for LqhaIT vs. IVHGEKCHR(59–67) in BotXIVM8-10. Thus, the com- position and length differences between native BotXIV and M8-10 variant vs. LqhaIT C-terminal tails, together with its peculiar environment in BotXIVM8-10 vs. BotXIV, could be related to the biological properties expressed by these different molecules. Finally, the fact that a limited modification can directly or indirectly be responsible for a new biological property shared between a-insect and a-like neurotoxins, suggests that BotXIV probably occupies an intermediate position within the evolutionary scheme of these molecules. It also supports the hypothesis that the acquisition of such electrophysiological properties might constitute an early biological event on the way of the molecular design of potent sodium channel gated ligands. ACKNOWLEDGEMENTS We wish to thank S. Pinkasfield and Dr F. Bouet for technical assistance and N-terminal sequencing, Drs D. Gordon, S. Zinn-Justin for fruitful discussions, and Dr P. Mansuelle for his help in preparation of Figs 6 and 7. This work was supported in part by an IFS grant (International Foundation for Science). REFERENCES 1. Miranda, F., Kopeyan, C., Rochat, H. & Lissitzky, S. (1970) Purification of animal neurotoxin. Isolation and characterization of eleven neurotoxins from the venoms of the scorpions Androc- tonus australis hector, Buthus occitanus tunetanus and Leiurus quinquestriatus quinquestriatus. Eur. J. Biochem. 16, 514–523. 2. Gregoire,J.&Rochat,H.(1983)CovalentstructureoftoxinsI and II from the scorpion Buthus occitanus tunetanus. Toxicon 21, 153–162. 3. Krifi, M.N., El Ayeb, M. & Dellagi, K. (1996) New procedures and parameters for better evaluation of Androctonus australis garzonii (Aag) and Buthus occitanus tunetanus (Bot.) scorpion envenomations and specific serotherapy treatment. Toxicon 34, 257–266. 4. Catterall, W.A. (1986) Molecular properties of voltage-sensitive sodium channels. Annu. Rev. Biochem. 55, 953–985. 5. Hille, B. (1992) Ionic Channels of Excitable Membranes.Sinauer Associates, Sunderland MA. 6. Rochat, H., Bernard, P. & Couraud, F. (1979) Scorpion toxins: chemistry and mode of action. Adv. Cytopharmacol. 3, 325–330. 7. Catterall, W.A. (1984) The molecular basis of neuronal excitabil- ity. Science 223, 653–661. 8. Jover, E., Couraud, F. & Rochat, H. (1980) Two types of scorpion neurotoxin characterized by their binding to two separate receptor sites on rat synaptosomes. Biochem. Biophys. Res. Commun. 95, 1607–1614. 9. Couraud,F.,Jover,E.,Dubois,J.M.&Rochat,H.(1982)Two types of scorpion toxins receptors sites, one related to the activa- tion of the action potential sodium channel. Toxicon 20, 9–16. 10. Martin-Eauclaire, M.F. & Couraud, F. (1995) Scorpion neurotoxins: effects and mechanisms. In Handle Neurotoxi- cology (Chang, L.W. & Dyer, R.S eds) p. 683 Marcel Dekker, New York. Ó FEBS 2002 Design of chimeric scorpion a-toxins (Eur. J. Biochem. 269) 2839 11. Gordon, D., Savarin, P., Gurevitz, M. & Zinn-Justin, S. (1998) Functional anatomy of scorpion toxins affecting sodium channels. J. Toxicol. Toxin Rev. 17, 131–159. 12. Catterall, W.A. (1992) Cellular and molecular biology of voltage- gated sodium channels. Physiol. Rev. 72, 15–48. 13. Gordon, D. (1997) A new approach to insect-pest control-com- bination of neurotoxins interacting with voltage sensitive sodium channels to increase selectivity and specificity. Invert. Neurosci. 3, 103–116. 14. Gordon, D., Martin-Eauclaire, M.F., Cestele, S., Kopeyan, C., Carlier, E., Ben Khalifa, R., Pelhate, M. & Rochat, H. (1996) Scorpion toxins affecting sodium current inactivation bind to distinct homologous receptor sites on rat brain and insect sodium channels. J. Biol. Chem. 271, 8034–8045. 15. Sautie ` re, P., Ceste ` le, S., Kopeyan, C., Martinage, A., Drobecq, H., Doljansky, Y. & Gordon, D. (1998) New toxins acting on sodium channels from the scorpion Leiurus quinquestriatus hebraeus sug- gest a clue to mammalian versus insect selectivity. Toxicon 36, 1141–1154. 16. Gordon, D. & Zlotkin, E. (1993) Binding of scorpion toxin to insect sodium channels is not dependent on membrane potential. FEBS Lett. 315, 125–128. 17. Ceste ` le, S., Stankiewicz, M., Mansuelle, P., De Waard, M., Dar- gent, B., Gilles, N., Pelhate, M., Rochat, H., Martin-Eauclaire, M.F. & Gordon, D. (1999) Scorpion alpha-like toxins, toxic to both mammals and insects, differentially interact with receptor site 3 on voltage-gated sodium channels in mammals and insects. Eur. J. Neurosci. 11, 975–985. 18. Krimm, I., Gilles, N., Sautiere, P., Stankiewicz, M., Pelhate, M., Gordon, D. & Lancelin, J.M. (1999) NMR structures and activity of a novel alpha-like toxin from the scorpion Leiurus quinques- triatus hebraeus. J. Mol. Biol. 285, 1749–1763. 19. Bouhaouala-Zahar, B., Ducancel, F., Zenouaki, I., Ben Kha- lifa, R., Borchani, L., Pelhate, M., Boulain, J.C., El Ayeb, M., Menez, A. & Karoui, H. (1996) A recombinant insect- specific alpha-toxin of Buthus occitanus tunetanus scorpion confers protection against homologous mammal toxins. Eur. J. Biochem. 238, 653–660. 20. Ricciardi, A., Du Le, M.H., Khayati, M., Dajas, F., Boulain, J.C., Me ´ nez, A. & Ducancel, F. (2000) Do structural deviations between toxins adopting the same fold reflect functional differ- ences? J. Biol. Chem. 275, 18302–18310. 21. Le Du, M.H., Ricciardi, A., Khayati, M., Menez, R., Boulain, J.C., Menez, A. & Ducancel, F. (2000) Stability of a structural scaffold upon activity transfer: X-ray structure of a three fingers chimeric protein. J. Mol. Biol. 296, 1017–1026. 22. Kunkel, T.A. (1985) The mutational specificity of DNA poly- merases alpha and gamma during in vitro DNA synthesis. J. Biol. Chem. 260, 12866–12874. 23. Boyer, H.W. & Roulland-Dussoix, D. (1969) A complementation analysis of the restriction and modification of DNA in Escherichia coli. J. Mol. Biol. 41, 459–472. 24. Sambrook, J., Fritsch, E.F. & Maniatis, T. (1989) Molecular cloning. A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor NY. 25. Sanger, F., Nicklen, S. & Coulson, A.R. (1977) DNA sequencing with chain-terminating inhibitors. Biotechnology 24, 104–108. 26. Ducancel, F., Boulain, J.C., Tremeau, O. & Menez, A. (1989) Direct expression in E. coli of a functionally active protein A-snake toxin fusion protein. Protein Eng. 3, 139–143. 27. Boyot, P., Pillet, L., Ducancel, F., Boulain, J.C., Tremeau, O. & Menez, A. (1990) A recombinant snake neurotoxin generated by chemical cleavage of a hybrid protein recovers full biological properties. FEBS Lett. 266, 87–90. 28. Pichon, Y. & Boistel, J. (1967) Current–voltage relations in the isolated giant axon of the cockroach under voltage-clamp condi- tions. J. Exp. Biol. 47, 343–355. 29. Pelhate, M. & Sattelle, D.B. (1982) Pharmacological properties of insects axons: a review. J. Insect Physiol. 28, 889–903. 30. Benkhalifa, R., Stankiewicz, M., Lapied, B., Turkov, M., Zilberberg, N., Gurevitz, M. & Pelhate, M. (1997) Refined elec- trophysiological analysis suggests that a depressant toxin is a sodium channel opener rather than a blocker. Life Sci. 61, 819–830. 31. Chavez-Olortegui, C., Amara, D.A., Rochat, H., Diniz, C. & Granier, C. (1991) In vivo protection against scorpion toxins by liposomal immunization. Vaccine 9, 907–910. 32. Reed, L. & Muench, H. (1938) A simple method of estimating fifty percent in eucaryotic end point. Am. J. Hyg. 27, 493–497. 33. Housset, D., Habersetzer-Rochat, C., Astier, J.P. & Fontecilla- Camps, J.C. (1994) Crystal structure of toxin II from the scorpion Androctonus australis hector refined at 1.3 A ˚ resolution. J. Mol. Biol. 238, 88–103. 34. Jablonski, M.J., Watt, D.D. & Krishna, N.R. (1995) Structure of an old world-like neurotoxin from the venom of the new world scorpion Centruroides sculpturatus ewing. J. Mol. Biol. 248, 449–458. 35. Sali, A. & Blundell, T.L. (1993) Comparative protein modeling by satisfaction of spatial restraints. J. Mol. Biol. 234, 779–815. 36. Laskowski, R.A., MacArthur, M.W., Moss, D.S. & Thornton, J.M. (1993) PROCHECK – a program to check the stereo chemical quality of protein structure. J. Appl. Crystallogr. 26, 283–291. 37. Sippl, M.J. (1993) Recognition of errors in three-dimensional structures of proteins. Proteins 17, 355–362. 38. Nicholls, A., Sharp, K.A. & Honig, B. (1991) Protein folding and association: insights from the interfacial and dynamic properties of hydrocarbons. Proteins 11, 281–296. 39. Nilsson, B., Moks, T., Jansson, B., Abrahmsen, L., Elmblad, A., Holmgren,E.,Henrichson,C.,Jones,T.A.&Uhlen,M.(1987) A synthetic IgG-binding domain based on staphylococcal protein A. Protein Eng. 1, 107–113. 40. Hodgson, D., Gasparini, S., Drevet, P., Ducancel, F., Bouet, F., Boulain, J.C., Harris, J.B. & Me ´ nez, A. (1993) Production of recombinant notechis 11¢2L, an enzymatically active mutant of a phospholipase A2 from Notechis scutatus scutatus venom, as directly generated by cleavage of a fusion protein produced in Escherichia coli. Eur. J. Biochem. 212, 441–446. 41. Danse, J.M., Rowan, E.G., Gasparini, S., Ducancel, F., Vatan- pour-Young, L.C., Poorheidari, G., Lajeunesse, E., Drevet, P., Me ´ nez, R., Pinskasfeld, S., Boulain, J.C., Harvey, A.L. & Me ´ nez, A. (1994) On the site by which a-dendrotoxin binds to voltage- dependent potassium channels: site directed mutagenesis reveals that the lysine triplet 28–30 is not essential for binding. FEBS Lett. 356, 153–158. 42. El Ayeb, M., Delori, P. & Rochat, H. (1983) Immunochemistry of scorpion a-toxins antigenic homologies checked with radio- immuno-assays (RIA). Toxicon 21, 709–716. 43. Chen, H., Gordon, D. & Heinmann, H.S. (2000) Modulation of cloned skeletal muscle sodium channels by the scorpion toxins LqhII, LqhIII and LqhaIT. Pflu ¨ gers Arch. 439, 423–432. 44. Fontecilla-Camps, J.C., Habersetzer-Rochat, C. & Rochat, H. (1988) Orthorhombic crystals and three-dimensional structure of the potent toxin II from the scorpion. Androctonus australis hector. Proc. Natl Acad. Sci. USA 85, 7443–7447. 45. Zilberberg, N., Froy, O., Loret, E., Cestele, S., Arad, D., Gordon, D. & Gurevitz, M. (1997) Identification of structural elements of a scorpion alpha-neurotoxin important for receptor site recognition. J. Biol. Chem. 272, 14810–14816. 46. Tugarinov, V., Kustanovitz, I., Zilberberg, N., Gurevitz, M. & Anglister, Y. (1997) Solution structures of a highly insecticidal recombinant scorpion alpha-toxin and a mutant with increased activity. Biochemistry 36, 2414–2424. 2840 B. Bouhaouala-Zahar et al. (Eur. J. Biochem. 269) Ó FEBS 2002 [...]...Ó FEBS 2002 Design of chimeric scorpion a- toxins (Eur J Biochem 269) 2841 47 Vita, C (1997) Engineering novel proteins by transfer of active sites to natural scaffolds Curr Opin Biotechnol 8, 429–434 48 Kharrat, R., Darbon, H., Rochat, H & Granier, C (1989) Structure-activity relationships of scorpion a- toxins Multiple residues contribute to the interaction with receptors Eur J Biochem 181,... Moskowitz, H., Eitan, M., Warner, C., Catterall, W .A & Zlotkin, E (1992) Localization of receptor sites for insect-selective toxins on sodium channels by site directed antibodies Biochemistry 31, 7622–7628 50 Gurevitz, M., Gordon, D., Ben-Natan, S., Turkov, M & Froy, O (2001) Diversification of neurotoxins by C-tail ÔwigglingÕ: a scorpion recipe for survival FASEB J 15, 1201–1205 51 Pelhate, M., Stankiewicz,... M & Froy, O (2001) Diversification of neurotoxins by C-tail ÔwigglingÕ: a scorpion recipe for survival FASEB J 15, 1201–1205 51 Pelhate, M., Stankiewicz, M & Benkhalifa, R (1998) Anti-insect scorpion toxins: historical account, activities and prospects C R Soc Biol 192, 463–484 . A chimeric scorpion a- toxin displays de novo electrophysiological properties similar to those of a- like toxins Balkiss Bouhaouala-Zahar 1 , Rym Benkhalifa 1 ,. phyla [10]. Scorpion a- toxins are classically divided into the follow- ing three groups: (a) mammal a- toxins that are highly active on mammals, and display very