Mutagenesis of hydrogenase accessory genes of Synechocystis sp PCC 6803 Additional homologues of hypA and hypB are not active in hydrogenase maturation Dorte Hoffmann, Kirstin Gutekunst, Monika Klissenbauer, Rudiger Schulz-Friedrich and Jens Appel ă ă Botanisches Institut, Christian-Albrechts University, Kiel, Germany Keywords hyp genes; cobalt transport; arginase; agmatinase; cyanobacteria Correspondence J Appel, Botanisches Institut, University of Kiel, Am Botanischen Garten 1–9, 24118 Kiel, Germany Fax: +49 431 880 4238 Tel: +49 431 880 4237 E-mail: jappel@bot.uni-kiel.de (Received 13 May 2006, revised 27 June 2006, accepted August 2006) doi:10.1111/j.1742-4658.2006.05460.x Genes homologous to hydrogenase accessory genes are scattered over the whole genome in the cyanobacterium Synechocystis sp PCC 6803 Deletion and insertion mutants of hypA1 (slr1675), hypB1 (sll1432), hypC, hypD, hypE and hypF were constructed and showed no hydrogenase activity Involvement of the respective genes in maturation of the enzyme was confirmed by complementation Deletion of the additional homologues hypA2 (sll1078) and hypB2 (sll1079) had no effect on hydrogenase activity Thus, hypA1 and hypB1 are specific for hydrogenase maturation We suggest that hypA2 and hypB2 are involved in a different metal insertion process The hydrogenase activity of DhypA1 and DhypB1 could be increased by the addition of nickel, suggesting that HypA1 and HypB1 are involved in the insertion of nickel into the active site of the enzyme The urease activity of all the hypA and hypB single- and double-mutants was the same as in wildtype cells Therefore, there seems to be no common function for these two hyp genes in hydrogenase and urease maturation in Synechocystis Similarity searches in the whole genome yielded Slr1876 as the best candidate for the hydrogenase-specific protease The respective deletion mutant had no hydrogenase activity Deletion of hupE had no effect on hydrogenase activity but resulted in a mutant unable to grow in a medium containing the metal chelator nitrilotriacetate Growth was resumed upon the addition of cobalt or methionine Because the latter is synthesized by a cobalt-requiring enzyme in Synechocystis, HupE is a good candidate for a cobalt transporter in cyanobacteria The large subunit of heterodimeric NiFe-hydrogenases contains a metal complex of a nickel and an iron ion The two are held in close proximity by two disulfide bridges provided by two cysteine residues of the protein The iron has two cyanide ions and one carbon monoxide as ligands, whereas the nickel ion is coordinated by two additional cysteines [1,2] This metal centre is at the heart of hydrogen oxidation and proton reduction Its assembly depends upon the presence of at least six genes collectively called hydrogenase pleio- tropic (hyp) because of the pleiotropic effect of their deletion on the synthesis of all hydrogenases in Escherichia coli [3] In a last step, a hydrogenase-specific protease cleaves a C-terminal peptide from the protein Many investigations, especially into the processing of the large subunit of hydrogenase (HycE) from E coli, have unraveled the role of the proteins encoded by the hyp genes [3] Although the origin of the carbon monoxide is still not known, the cells have to provide carbamoylphosphate for the production of Abbreviation hyp, hydrogenase pleiotropic 4516 FEBS Journal 273 (2006) 4516–4527 ª 2006 The Authors Journal compilation ª 2006 FEBS D Hoffmann et al the cyanide ligands [4,5] Corresponding homologues of the genes of the carbamoylphosphate synthase genes (carAB) can be found in all cyanobacteria sequenced to date The carbamoyl group is transferred to the C-terminal cysteine of HypE This step is catalysed by HypF via a carbamoyl-AMP intermediate In an ATP-dependent dehydration reaction the C-terminal thiocarboxamide of HypE is then transformed into a thiocyanate, which is suggested to be the precursor of the cyanide ligands [6,7] Iron is probably introduced into this process by a complex of HypC and HypD [8] At this complex, the coordination of the CN and CO ligands to iron might be accomplished HypC was also shown to form a complex with the large subunit of the hydrogenase, thus serving as a kind of chaperone [9,10] In Thiocapsa roseopersicina, two homologues of HypC have been shown to be necessary for the expression of all three hydrogenases It was discussed that one of them works as a chaperone and the other could be part of a complex with HypD [11] HypA and HypB are responsible for the insertion of nickel A number of bacterial sequences reveal a N-terminal domain containing stretches of histidine residues in HypB These residues have been shown to bind up to 18 nickel ions per dimer in Bradyrhizobium japonicum, thus functioning as a storage site [12] The C-terminal domain has a high similarity to GTPases HypB of E coli hydrolyses GTP when processing the large subunit of hydrogenase [13,14] The N-terminal histidine residue of HypA also takes part in the process and seems to play an essential role during nickel insertion [15] In Helicobacter pylori, HypA and HypB have been shown to be part of the maturation of urease also This result is surprising because all the genes for processing urease are found in the genome of H pylori [16,17] In the final step of the maturation process, a hydrogenase-specific protease cleaves the C-terminal peptide from the large subunit For each hydrogenase there is a specific protease, and the uncleaved peptide seems to stabilize the protein during the maturation process [3] Bioinformatic analysis suggests that the two hydrogenases of cyanobacteria also need two different proteases for their proper processing [18] Synechocystis sp PCC 6803 harbours a single bidirectional NiFe-hydrogenase All the homologues of the hyp genes are spread over the chromosome as single genes or in different gene clusters [19] Two homologues of hypA and hypB are present Because of sequence similarities, we tentatively named the genes slr1675 hypA1, sll1078 hypA2, sll1432 hypB1 and sll1079 hypB2 The only hyp genes encoded in the same Cyanobacterial hydrogenase accessory genes gene cluster are hypA2 and hypB2 A similarity search in the complete genome did not uncover a second copy of hypC In addition to these genes, slr2135 was annotated as hydrogenase accessory (hupE) in the cyanobase (http://www.kazusa.or.jp/cyano/) All the HupE homologues are membrane proteins and are predicted to contain at least six transmembrane helices The hupE of Rhizobium leguminosarum was hypothesized to encode a nickel transporter [20] In an attempt to characterize the genes needed for the expression of an active hydrogenase in Synechocystis, we deleted all of the hyp genes and hupE, and characterized the corresponding mutants Because it is known that different copies of hypA and hypB can complement each other in Ralstonia eutropha (now renamed Cupriavidus necator) [21], the corresponding double mutants were also constructed Results and Discussion Characterization of hyp mutants Deletion and insertion mutants of hypA1 (slr1675), hypA2 (sll1078), hypB1 (sll1432), hypB2 (sll1079), hypC, hypD, hypE, hypF, slr1876, and hupE were created The vectors constructed and the primers used to amplify the DNA fragments are listed in Tables and After streaking transformants 5–6 times on agar plates, they were tested for proper segregation by Southern blotting or PCR All mutants could be segregated completely Hydrogenase activity measurements revealed that the enzyme was only active in wild-type cells, hypA2::Km, hypB2::Km and DhupE None of the other mutants exhibited hydrogenase activity (Fig 1A) It could thus be concluded that all of the investigated hyp genes, apart from hypA2 and hypB2, are essential for hydrogenase processing in Synechocystis Similarity searches in the genome of Synechocystis using HoxW of R eutropha and HycI of E coli yielded Slr1876 as the best candidate for a hydrogenase-specific protease with a similarity of 54 and 43%, respectively Because deletion of slr1876 resulted in a mutant without hydrogenase activity, Slr1876 can be tentatively assigned to the proteases needed to cleave the C-terminus of the large hydrogenase subunit It seems appropriate to name it HoxW In order to rule out that any of the mutations affected the transcription of the hydrogenase structural genes, all mutants were tested by RT-PCR A hoxH transcript was detected in all of them (Fig 1B), confirming that the phenotype of the investigated hyp mutants is not due to an abolished transcription FEBS Journal 273 (2006) 4516–4527 ª 2006 The Authors Journal compilation ª 2006 FEBS 4517 Cyanobacterial hydrogenase accessory genes D Hoffmann et al Table Bacterial strains and plasmids used in this study Strain or plasmid E coli DH5a Synechocystis sp PCC 6803 Plasmids pBlueGM pBluescript SKpGEM-T pHP45W pKS-CAT pMOSblue-T pUC-4K phypA1 phypA2 phypB1 phypB2 phypC phypD phypE phypF phoxW pDA1 pDA2 pDB1 pDB2 pDC pDD pDE pDF pDW 4518 Description Source or reference Cloning strain F– u80 dLacZM15 (lacZYA-argF) U169 recA1 endA1 hsdR17(rk–, mk+) phoA supE44– thi-1 gyrA96 relA1 Wild-type, Lee McIntosh, East Lansing, MI, USA Source of Gmr cassette; amplified with with Gen-up, Gen-down-primers, digested with SalI and inserted in the SalI site of the pBlueskript SK pUC19-derivative, with bla- and lacZ gene, Ampr Cloning vector with T-overhangs at the 3¢-ends; T7- and Sp6-promotors; lacZ gene; Ampr Source of Spr cassette pBluescript SK-containing SspI–NaeI fragment of pBR322 with Cmr cassette inserted into EcoRV site Cloning vector, Ampr Source of Kmr; Ampr pGEM-T vector containing hypA1 (slr1675), amplified with NhypA1 and ChypA1-primers pGEM-T vector containing hypA2 (sll1078), amplified with NhypA2 and ChypA2-primers pMOSblue-T vector containing hypB1 (sll1432), amplified with NhypB1 and ChypB1-primers pMOSblue-T vector containing hypB2 (sll1079), amplified with NhypB2 and ChypB2-primers pGEM-T vector containing hypC (ssl3580), amplified with NhypC and ChypC-primers pGEM-T vector containing hypD (slr1498), amplified with NhypD and ChypD-primers pGEM-T vector containing hypE (sll1462), amplified with NhypE and ChypE-primers pGEM-T vector containing hypF (sll0322), amplified with NhypF and ChypF-primers pGEM-T vector containing hoxW (slr1876), amplified with NhoxW and ChoxW-primers pGEM-T vector with DNA-fragments of hypA1 for homologous recombination and an inserted Cmr cassette pGEM-T vector with the hypA2 gene and an inserted Kmr cassette in the BclI –site pMOSblue-T vector with the hypB1 gene and an inserted Spr cassette in the BalI sites pMOSblue-T vector with the hypB2 gene and an inserted Kmr cassette in the EcoRI site pGEM-T vector with DNA-fragments of hypC for homologous recombination and an inserted Gmr cassette pGEM-T vector with the hypD gene and an inserted Spr cassette in the Eco91I site pGEM-T vector with the hypE gene and an inserted Kmr cassette in the BclI sites pGEM-T vector with the hypF gene and an inserted Spr cassette in the HindIII sites pGEM-T vector with DNA-fragments of hoxW for homologous recombination and an inserted Spr cassette Invitrogen, Karlsruhe, Germany [41] Derivative of pBlueskript SK- with the Gmr-cassette from pUC119 [42] Stratagene, Heidelberg, Germany Promega, Madison,WI, USA Accession number K02163 [43] This study Amersham, Freiburg, Germany Accession number X06404 [44] This study This study This study This study This study This study This study This study This study This study This study This study This study This study This study This study This study This study FEBS Journal 273 (2006) 4516–4527 ª 2006 The Authors Journal compilation ª 2006 FEBS D Hoffmann et al Cyanobacterial hydrogenase accessory genes Table (Continued) Strain or plasmid Description Source or reference pDhupE pGEM-T vector with DNA-fragments of hupE for homologous recombination and an inserted Gmr cassette pCRII-TOPO with fragment amplified with the primers N-PsbA2 and C-psbA2 pIGA [37] with KpnI fragment of pSBA2 inserted into KpnI site cut with ScaI religated, partially digested with SalI and religated, Kmr pDH1 vector containing SalI ⁄ NdeI hypA1 gene of the phypA1vector inserted in the SalI ⁄ NdeI site pDH1 vector containing SalI ⁄ NdeI hypA2 gene of the phypA2 vector inserted in the SalI ⁄ NdeI site pDH1 vector containing SalI ⁄ NdeI hypB1 gene of the phypB1 vector inserted in the SalI ⁄ NdeI site pDH1 vector containing SalI ⁄ NdeI hypB2 gene of the phypB2 vector inserted in the SalI ⁄ NdeI site pDH1 vector containing SalI ⁄ NdeI hypC gene of the phypC vector inserted in the SalI ⁄ NdeI site pDH1 vector containing SalI ⁄ NdeI hypD gene of the phypD vector inserted in the SalI ⁄ NdeI site pDH1 vector containing SalI ⁄ NdeI hypE gene of the phypE vector inserted in the SalI ⁄ NdeI site pDH1 vector containing SalI ⁄ NdeI hypF gene of the phypF vector inserted in the SalI ⁄ NdeI site pDH1 vector containing SalI ⁄ NdeI hoxW gene of the phoxW vector inserted in the SalI ⁄ NdeI site This study pSBA2 pDH1 pDHA1 pDHA2 pDHB1 pDHB2 pDHC pDHD pDHE pDHF pDHW To perform complementation studies a vector (pDH1) was constructed that allows the expression of any ORF under the control of the psbAII promotor Constructs of all different hyp genes were made Because pDH1 confers resistance to kanamycin it could not be used to complement the DhypE mutant All constructs except those containing hypA2 and hypB2 were able to restore hydrogenase activity to the wild-type level in the respective mutants This confirms that the absence of hydrogenase activity was due to the specific mutation and not to some unpredictable side effects Function of hypA and hypB in hydrogenase maturation The function of hypA and hypB was investigated in more detail Because HypA and HypB were shown to be involved in the insertion of nickel into the active site of hydrogenases in E coli [13–15], the respective Synechocystis single- and double-mutants of hypA and hypB were grown in medium supplemented with nickel Because we found nickel to inhibit growth and elicit cell death at 50 lm, its concentration was not raised above 15 lm to keep cells growing Hydrogenase activity could be increased from 0% of the wild-type level This study This study This study This study This study This study This study This study This study This study This study in the DhypA1 and DhypB1 to 19 and 30%, respectively (Fig 2) This suggests that hypA1 and hypB1 play a role in the insertion of Ni2+ into the cyanobacterial hydrogenase As no changes in hydrogenase activity were detected in hypA2 and hypB2 mutants compared with wild-type cells, and neither was able to complement their respective counterparts in the DhypA1 and DhypB1, the transcription of both genes was tested by RT-PCR Both hypA2 and hypB2 were shown to be transcribed, thus ruling out that these additional homologues are silent in Synechocystis (Fig 3) In H pylori it was shown that the hydrogenaseprocessing genes hypA and hypB have a dual function, as they are also necessary for proper processing of the nickel-containing urease, despite, as in Synechocystis, the respective genes ureE and ureG being present in this organism [16,17] The urease activity of all hypA and hypB mutants (DhypA1,hypA2::Km, DhypA1hypA2::Km, DhypB1,hypB2::Km, DhypB1hypB2::Km) was investigated An enzyme activity of 0.025 mg)1 protein was measured, showing no difference compared with wild-type cells Interference of the urease- and hydrogenase-processing pathways in Synechocystis, as described for H pylori, was therefore excluded FEBS Journal 273 (2006) 4516–4527 ª 2006 The Authors Journal compilation ª 2006 FEBS 4519 Cyanobacterial hydrogenase accessory genes D Hoffmann et al Table Primers used for the amplification of deletion constructs and RT-PCR Underlined sequence corresponds to tag Name Gene Sequence Position NhypA1 ChypA P1hypA1 P2hypA1 slr1675 AGTTAATCATATGCACGAAG TAGGACTTGGTCGACGCTCAACTCAGT ACCATCAGCACTAGCCGGGA AGCGAGGTGCCGCCATCAAGCTTAAC AGTTGGAACTAGCATCCCTAGAAC TCAATAATATCGAATTCCTGCAGTTTGC TCCATCAGACTAACTTCGTGCA CTCCTTCCGTTTTTCCGGTT CATATGCATGAAACAGACATGACCA AGTGGATCCGTTAATAAAAAATTTAGTCTCG CATATGTGCCAAAACTGCGGTT TTTTTCCTTCAACTCTTAG CATATGCACCAATCCATTGAC TTTTACTGTGTTGATTTTGA TCCTTTCCTCATATGTGTCTAGCC TCTTAACTCGTCGACTTAAACTCCCAT TTGGGCATACTTTATCTGGC CGCCACCTAACAATTCGGTCGACTGAT AGACTTGGCAGAAATGGGAGTTT GGTTCGTGCCTTCATCCGTCGACCAAC CTGGCCAGGTAGGGCTAGACACA CATGGTTAGCCCCATTCATA CATATGAAATACGTTGATGAATATC ATTGTCGGATCCCAGCAAAACT CATATGAACTTAGTCTGTCCCGTTCCC CTTGTCGACTGGAGTCCTAACAAATACGG CATATGTTAAAAACCGTTGCCATACAG GGATCCAGTTGAGTTAACAGATATATTGC CATATGCCAGGCCAATCCACCA ATTTTGAGGATCCCTTGGCTTTATC GTGGACTTGATTAGTTAATT TGCTCAATCAATCACCGGATCCCTCCG CCCCTTGGTATTGGGGGAGAGAT TTGGCACCCAGCCTGCGCGATTAAAGT GGACTTGGTGGATTGGCCTGGCA AGTTACCAAATACCAAGAAT ACATCTACCACCGCCACAGG GGTTCGTGCCTTCATCCGTCGACTTTCCT CCCTTTTTCCACAGG CGCCACCTAACAATTCGGTCGACCTTATG GGATAATAGGTTGC TTGTAATTTCTGCTTGATATC TGACGCACCTCGAGTCGACGGATGA AGGCACGAACCCAGT GAAGCCGATCTAGAGTCGACCGAATT GTTAGGTGGCGGTACTT GATTGCGGCTTTAGGGTACCAGTG TGTTGGAGAGTCGGTACCATATGGTTA 1955211–1955230 1955553–1955579 1954925–1954945 1955528–1955555 CTGAGACCGTGTGCGTTGCGAATGTAGTGTa CTGAGACCGTGTGCGTTGCGAAT TATGGGCTTAGTTGGGAAAA AGACCGTGTGCGAGTTGCCATTGATCCAAA AGACCGTGTGCGAGTTGCCATT CGGTTGTAGTGCGGTGGGAA AGACCGTGTGCGAAACTATCATCGGTACTTTA 1672231–1672245 1672231–1672238 1672805–1672824 1907805–1907821 1907805–1907814 1908607–1908588 798855–798873 slr1675 P3hypA1 P4hypA1 NhypA2 ChypA2 NhypB1 ChypB1 NhypB2 ChypB2 NhypC ChypC P1hypC P2hypC sll1078 sll1432 sll1079 ssl3580 ssl3580 P3hypC P4hypC NhypD ChypD NhypE ChypE NhypF ChypF NhoxW ChoxW P1hoxW P2hoxW slr1498 sll1462 sll0322 slr1876 slr1876 P3hoxW P4hoxW P1hupE P2hupE slr2135 P3hupE P4hupE Gm-up Gm-down F-psbA2 R-psbA2 Primer for RT-PCR: og46–57tag1 og46–57tag2 og46–7a hypB1-tag1 hypB1-tag2 hypB1 hypB2-tag1 4520 sll1226 sll1226 sll1226 sll1432 sll1432 sll1432 sll1079 1955222–1955249 1955838–1955858 799958–799936 799562–799583 1908622–1908603 1907749–1907767 799536–799518 798812–798831 1757503–1757526 1754355–1754367 1757218–1757238 1757716–1757743 1757515–1757542 1758035–1758055 54533–54554 55677–55656 992771–992749 991728–991747 2434762–2434739 2432452–2432474 1227090–1227108 1227559–1227583 1226794–1226814 1227535–1227562 1227091–1227121 1227841–1227861 1260919–1260938 1261212–1261192 1261997–1262016 1262321–1262301 6721–6744 7222–7248 FEBS Journal 273 (2006) 4516–4527 ª 2006 The Authors Journal compilation ª 2006 FEBS D Hoffmann et al Cyanobacterial hydrogenase accessory genes Table (Continued) Name Gene Sequence Position hypB2-tag2 hypB2 hypA2 ureC-tag1 ureC-tag2 ureC ureG-tag1 sll1079 sll1079 sll1078 sll1750 sll1750 sll1750 sll0643 798855–798862 799362–799341 799958–799936 560216–560231 560216–560223 561146–561129 430737–430758 ureG-tag2 ureG sll0643 sll0643 AGACCGTGTGCGAAACTATCA AAGTGAGTTAAAAATGGCGGTT CATATGCATGAAACAGACATGACCAA AGACCGTGTGCGATTAACATGTCTAGATG AGACCGTGTGCGATTAACATG AGCTACGCCCACACCTTT AGACCGTGTGCGA CACTCTCCAAAAACACCATATCCA AGACCGTGTGCGACTCTCCAA AAGCCTTGAGGCAAAAATATCAATTG 430737–430744 430965–430940 Fig (A) Hydrogenase activity of wild-type cells and of deletion mutants of the hydrogenase accessory genes and DhupE (B) RT-PCR with RNA of wild-type and all the deletion mutants of the hyp genes and hoxW For each strain, the reaction including reverse transcription (+) and a negative control without reverse transcription was applied Investigations of the immediate vicinity of hypA2 and hypB2 on the chromosome revealed an ORF annotated as an agmatinase (speB2, sll1077) directly upstream of hypA2 Studies on arginine catabolism in Synechocystis could not clearly assign the substrate of SpeB2 [22] Agmatinases belong to arginase-related enzymes that catalyse the splitting of guanidinium groups to urea and amino compounds Arginases are known to contain a binuclear manganese active site [23–25] The complete sequences of all available cyano- bacterial strains show homologues to speB2 in Synechococcus WH 8102, Synechococcus WH 5701, Synechococcus CC 9605, and Synechococcus sp PCC 7002 Strikingly, in all cases, genes highly similar to hypA and hypB are situated immediately downstream on the chromosome (Fig S1) The transition metal inserted into the active site of SpeB2 might be manganese, nickel or cobalt Whether HypA2 and HypB2 are metallochaperones involved in the processing of this enzyme needs to be further investigated FEBS Journal 273 (2006) 4516–4527 ª 2006 The Authors Journal compilation ª 2006 FEBS 4521 Cyanobacterial hydrogenase accessory genes D Hoffmann et al Fig Hydrogenase activity of cultures of wild-type cells and the hypA- and hypB-deletion mutants grown with the addition of nickel up to a concentration of 15 lM Effect of deletion of hupE on metal uptake Homologues of hupE ⁄ ureJ are widespread among bacteria and are frequently found in hydrogenase or urease gene clusters Because urease and hydrogenase are nickel-dependent enzymes, the encoded proteins were suggested to belong to a family of nickel ⁄ cobalt transporters with six to seven transmembrane helices, and were subsequently shown to transport nickel in the proteobacterium Rhodopseudomonas palustris [26,27] Moreover, because hupE is annotated as a hydrogenase accessory gene in the cyanobase, we investigated the effect of its deletion on hydrogenase and urease activity and metal transport Surprisingly, DhupE did not show a difference compared with wild-type cells concerning its hydrogenase activity (Fig 1A) or its urease activity (data not shown), although the nickel content of the BG-11 medium used was beyond the detection limit (1.7 nm) Moreover, its growth did not differ from that of wildtype cells under normal conditions (Fig 4) We therefore used the metal chelator nitrilotriacetate added to the medium to compare the growth of mutant and wild-type cells Whereas the growth rate of wild-type cells was reduced to about half that of the control, the mutant was no longer able to grow at all, supporting the hypothesis that HupE is a metal transporter (Fig 4) As shown in Fig 4A, the growth inhibitory effect of nitrilotriacetate in case of the hupE mutant was partially antagonized by the addition of methionine, whereas the effect on wild-type cells was only marginal In Synechocystis, methionine is synthesized by the methionine synthase MetH, which catalyses a cobalamin-dependent methyl transfer from methyl tetrahydrofolate to homocysteine In the total genome no other enzymes catalysing the last step of methionine synthesis, for example MetE, could be found Therefore, this experiment suggests that the mutant is suffering from cobalt limitation It also shows that nickel-dependent enzymes like hydrogenase and urease are not essential for growth in Synechocystis, because under these conditions trace amounts of nickel should be masked quantitatively by nitrilotriacetate This is in accordance with previous results showing that lack of NiFe-hydrogenase has no influence on growth in Synechocystis [28] and that deletion of the urease yields viable mutants in Synechococcus sp PCC 7002 [29] Growth of the mutant was also resumed by the addition of cobalt at a concentration of 100 lm This is in clear contrast to wild-type cells, in which no Fig Agarose gel electrophoresis of RT-PCRs of transcripts of hypB1, hypB2, hypA2B2, ureG and ureC RT-PCR of wild-type RNA was performed as described in the Experimental procedures For each RT-PCR a reaction including reverse transcription (+), and a negative control without reverse transcription (–) was applied On the left marker bands are indicated 4522 FEBS Journal 273 (2006) 4516–4527 ª 2006 The Authors Journal compilation ª 2006 FEBS D Hoffmann et al Cyanobacterial hydrogenase accessory genes Fig Growth curves of wild-type cells and DhupE in the absence or presence of nitrilotriacetate (NTA) (A) Growth of wild-type cells and DhupE in the presence of nitrilotriacetate supplemented with 0.25 lM methionine (B) Wild-type cells and DhupE grown in the presence of nitrilotriacetate and different cobalt concentrations (C) Wild-type cells and DhupE grown in the presence of nitrilotriacetate and different nickel concentrations The control curves in normal medium without additions are shown for comparison difference could be detected in the presence of nitrilotriacetate with or without the addition of cobalt (Fig 4B) By adding 200 lm cobalt, the growth of the mutant could be increased further, but above this concentration toxic effects began to show, and no increase in growth rate could be attained at 300 lm cobalt A growth-inhibitory effect was detectable at 200 lm in wild-type cells (data not shown) Therefore, DhupE is dependent on additional supplementation, whereas wild-type cells not suffer from cobalt limitation The addition of nickel to the medium supplemented with nitrilotriacetate increased growth of both the hupE deletion mutant and wild-type cells Addition of 100 lm Ni2+ allowed wild-type cells to grow almost as fast as controls, whereas the growth-inhibitory effect of nitrilotriacetate could not be abolished in DhupE However, by adding 200 and 300 lm, growth could be continuously increased Above 300 lm Ni2+ no further increase could be elicited, probably because of toxic effects (data not shown) Because nickel is bound by nitrilotriacetate with a six times higher affinity than cobalt [30], the addition of nickel shifts the binding equilibrium of the cobalt in the medium to higher concentrations of the free ion The added nickel also allows the expression of urease and hydrogenase in the cells and leads to an increased growth rate in wild-type cells Taking these results into consideration, we assume that HupE is a cobalt transporter Whether HupE is also able to transport nickel remains to be shown Nevertheless, it should be concluded from our results that there is another uptake pathway apart from HupE for nickel in Synechocystis that allows the mutant to take up nickel at concentrations < 1.7 nm Recent bioinformatic analysis of a large set of bacterial genomes suggests that the five genes sll0381 to sll0385 encode an ATP-dependent nickel transporter in Synechocystis [31] Transport of cobalt by HupE is supported by a suggested vitamin B12-dependent riboswitch which was detected upstream of its gene [32] This type of riboswitch is thought to be involved in the vitamin B12dependent transcriptional regulation of downstream genes Our growth analysis supports the suggestion that HupE is needed for the expression of a functional methionine synthase that is dependent on vitamin B12 These results are also very interesting regarding investigations of the demand for cobalt in marine cyanobacteria [33,34] It is plausible that the investigated strains Prochlorococcus and Synechococcus need a specific cobalt transporter Similarity searches in the FEBS Journal 273 (2006) 4516–4527 ª 2006 The Authors Journal compilation ª 2006 FEBS 4523 Cyanobacterial hydrogenase accessory genes D Hoffmann et al marine Synechococcus WH 8102 and the Prochlorococcus strains available at cyanobase revealed the presence of orthologues to hupE in all their genomes Experimental procedures Cultivation and growth experiments Synechocystis sp PCC 6803 was grown in BG-11 medium as described previously [28] Transformants were selected on BG-11 agar plates containing 50 lgỈmL)1 kanamycin, 25 lgỈmL)1 chloramphenicol, 20 lgỈmL)1 spectinomycin or lgỈmL)1 gentamicin, respectively Total segregation was checked by PCR and Southern hybridization For growth experiments cultures were bubbled with air Cloning procedures DNA cloning and PCR amplification were performed using standard procedures [35] In order to construct the deletion mutants (Table 1) the primers listed in Table were used to amplify DNA fragments Using two different strategies, an antibiotic resistance cassette was transferred into the respective gene for the following homologous recombination into the genome The hypB1 and hypB2 genes were cloned into the pMOSblue-T vector (Amersham, Freiburg, Germany) and hypA2, hypD, hypE and hypF were cloned into the pGEM-T vector (Promega, Madison, WI, USA) The respective antibiotic resistance cassette was then inserted after restriction digests The mutants of hypA1, hypC and hoxW were produced through a PCR fusion, adapted from Chenchick et al [36], of 300 bp PCR products made from the regions up- and downstream of the gene with a resistance cassette The PCR fusion (step 1, 95 °C for min; step 2, 95 °C for 30 s; step 3, 60 °C for min; step 4, 68 °C for 25 min; 30 cycles from step to step 4) was accomplished by complementary overhangs of the primers P2 and P3 (Table 2) with the antibiotic resistance cassette To express the hyp genes in a different locus a vector was constructed using the constructed pIGA vector of Kunert et al [37] For this purpose the psbAII promotor was amplified with the primers FpsbA2 and RpsbA2 (Table 1) The resulting fragment was cut with KpnI and ligated in the KpnI site of pIGA This vector was digested with ScaI and religated The resulting vector was partially digesting with SalI and after blunt ending with Klenow religated to yield the vector pMK1 In the NdeI and SalI of the pDH1 the amplified ORFs of the different hyp genes were inserted All constructs were sequenced before transformation in Synechocystis Southern blot hybridization For Southern analyses, genomic DNA was isolated from Synechocystis cells grown on agar plates Cells were 4524 resuspended in 100 lL TE buffer (10 mm Tris, mm Na2EDTA, pH 8.0) and the suspension was supplemented with an equal volume of glass beads (0.5 mm diameter), lL of a 10% (w ⁄ v) SDS solution and 100 lL phenol ⁄ chloroform ⁄ isoamylalcohol (25 : 24 : v ⁄ v ⁄ v) The mixture was vortexed three times for 10 s and then centrifuged at 10 000 g for 10 The supernatant was extracted once with phenol ⁄ chloroform ⁄ isoamylalcohol and twice with chloroform ⁄ isoamylalcohol (24 : v ⁄ v) and centrifuged at 10 000 g for min, respectively The DNA was precipitated by the addition of ⁄ 10 volume sodium acetate (3 m, pH 6.5) and 2.5 · volume of 100% ethanol for h at )20 °C After centrifugation (15 700 g for 15 at )8 °C), the pellet was washed with 70% ethanol Then the pellet was dried in a vacuum centrifuge and resuspended in 20 lL TE buffer overnight at °C Southern hybridization was carried out with the Dig-system (Roche Diagnostics GmbH, Mannheim, Germany) as described by the manufacturer RNA isolation and RT-PCR Total RNA from Synechocystis was isolated by phenol– chloroform extraction [38] After precipitating the nucleic acids, the pellet was dried and resuspended in TE buffer An equal volume of m LiCl was added and the mixture was incubated for 1.5 h at )20 °C The DNA-containing supernatant was removed after centrifuging at 18 000 g for 30 at )8 °C The LiCl precipitation of RNA was repeated with the pellet for a second time The RNA pellet was resuspended in a small volume of water and treated with DNase I (Roche, Mannheim, Germany), extracted first with phenol ⁄ chloroform ⁄ isoamylalcohol (25 : 24 : v ⁄ v ⁄ v) and then twice with chloroform ⁄ isoamylalcohol (24 : v ⁄ v) Sodium acetate (3 m, pH 6.5) in an amount equalling ⁄ 10 of the extract volume and ethanol ()20 °C) corresponding to 2.5 times of the extract volume was added The mixture was incubated for 30 at )80 °C After centrifugation (20 at 15 000 g at °C) the RNA pellet was washed with 70% ethanol, dried and resuspended in a small volume of water cDNA was synthesized with a tagged primer (Table 2) that annealed with 15–19 nucleotides specific to the corresponding gene and carried a tag of 13–14 nucleotides at its 5¢-end as a target for subsequent PCR according to the method of Cobley et al [39] Five hundred nanograms of RNA were incubated with pmol primer and 20 nm dNTPs for at 65 °C The reaction was chilled on ice Subsequently, 5· buffer (Invitrogen, Karlsruhe, Germany) and 40 U RNase Inhibitor (MBI Fermentas, St Leon-Rot, Germany) were added After incubating the mixture at 42 °C for min, 200 U Superscript II (Invitrogen) was added In a control reaction the reverse transcriptase was replaced by water Reverse transcription was performed at 42 °C for 50 The reaction was termin- FEBS Journal 273 (2006) 4516–4527 ª 2006 The Authors Journal compilation ª 2006 FEBS D Hoffmann et al ated by incubating at 70 °C for 15 Then the reaction was immediately chilled on ice and treated with U RNaseH (Roche, Mannheim, Germany) An aliquot of lL of the RT reaction was used to amplify the cDNA with a gene specific and an adapter specific primer (Table 2) Hydrogen measurements Hydrogenase activity was determined by a H2-evolution assay using dithionite and methylviologen as electron donor as described by Appel et al [28] but with a Clark-type electrode from Hansatech (DW Liquid Clark electrode, Hansatech Institute, Norfolk, UK) The electrode was connected to a lab-made control box with a voltage of )600 mV Urease measurements Urease activity was determined according to the method of Kaltwasser & Schlegel [40] with a 0.04 m Tris buffer (pH 8.0), 0.8 mm alpha-ketoglutarate, 0.03 m urea and U glutamate dehydrogenase in the assay mixture of mL The activity was measured at 366 nm with a spectrophotometer (Shimadzu UV-2501PC, Kyoto, Japan) at 30 °C Detection of nickel and cobalt Nickel and cobalt concentrations were determined using AAnalyst300 (Perkin-Elmer, Boston, MA, USA) with standards of nickel and cobalt from Johnson & Matthey (Zurich, Switzerland) Acknowledgements Financial support from Linde AG, InnovationsStiftung Schleswig-Holstein and Studienstiftung des deutschen Volkes are gratefully acknowledged Special thanks to T Eitinger (Humboldt-University, Berlin) for helpful discussions We thank Sabine Karg and Monika Schneeweiss for excellent technical assistance References Volbeda A, Charon MH, Piras C, Hatchikian EC, Frey M & Fontecilla-Camps JC (1995) Crystal structure of the nickel–iron hydrogenase from Desulfovibrio gigas Nature 373, 580–587 Happe RP, Roseboom W, Pierik AJ, Albracht SPJ & Bagley KA (1996) Biological hydrogen production Nature 385, 126 Blokesch M, Paschos A, Theodoratou E, Bauer A, Hube M, Huth S & Bock A (2002) Metal insertion into ă NiFe-hydrogenases Biochem Soc Trans 30, 674–680 Cyanobacterial hydrogenase accessory genes Paschos A, Glass RS & Bock A (2001) Carbamoylphoă sphate requirement for synthesis of the active center of [NiFe]-hydrogenases FEBS Lett 488, 9–12 Paschos A, Bauer A, Zimmermann A, Zehelein E & Bock A (2002) HypF, a carbamoyl phosphate-convertă ing enzyme involved in [NiFe] hydrogenase maturation J Biol Chem 277, 49945–49951 Reissmann S, Hochleitner E, Wang H, Paschos A, Lottspeich F, Glass RS & Bock A (2003) Taming of a ă poison: biosynthesis of the NiFe-hydrogenase cyanide ligands Science 299, 1067–1070 Blokesch M, Paschos A, Bauer A, Reissmann S, Drapal N & Bock A (2004) Analysis of the transcarbamoylaă tiondehydration reaction catalyzed by the hydrogenase maturation proteins HypF and HypE Eur J Biochem 271, 3428–3436 Blokesch M & Bock A (2002) Maturation of [NiFe]-hyă drogenases in Escherichia coli: the HypC cycle J Mol Biol 324, 287–296 Drapal N & Bock A (1998) Interaction of the hydrogeă nase accessory protein HypC with HycE, the large subunit of Escherichia coli hydrogenase during enzyme maturation Biochemistry 37, 2941–2948 10 Magalon A & Bock A (2000) Analysis of the HypC ă hycE complex, a key intermediate in the assembly of the metal center of the Escherichia coli hydrogenase J Biol Chem 275, 21114–21120 11 Maroti G, Fodor BD, Rakhely G, Kovacs AT, Arvani S & Kovacs KL (2003) Accessory proteins functioning selectively and pleiotropically in the biosynthesis of [NiFe] hydrogenases in Thiocapsa roseopersicina Eur J Biochem 270, 2218–2227 12 Fu C, Olson JW & Maier RJ (1995) HypB protein of Bradyrhizobium japonicum is a metal-binding GTPase capable of binding 18 divalent nickel ions per dimer Proc Natl Acad Sci USA 92, 2333–2337 13 Maier T, Jacobi A, Sauter M & Bock A (1993) The ă product of the hypB gene, which is required for nickel incorporation into hydrogenases, is a novel guanine nucleotide-binding protein J Bacteriol 175, 630–635 14 Maier T, Lottspeich F & Bock A (1995) GTP ă hydrolysis by HypB is essential for nickel insertion into hydrogenases in E coli Eur J Biochem 230, 133– 138 15 Blokesch M, Rohrmoser M, Rode S & Bock A (2004) ă HybF, a zinc-containing protein involved in NiFe hydrogenase maturation J Bacteriol 186, 2603–2611 16 Olson JW, Metha NS & Maier RJ (2001) Requirement of nickel metabolism proteins HypA and HypB for full activity of both hydrogenase and urease in Helicobacter pylori Mol Microbiol 39, 176–182 17 Mehta N, Olson JW & Maier RJ (2003) Characterization of Helicobacter pylori nickel metabolism accessory FEBS Journal 273 (2006) 4516–4527 ª 2006 The Authors Journal compilation ª 2006 FEBS 4525 Cyanobacterial hydrogenase accessory genes 18 19 20 21 22 23 24 25 26 27 28 29 30 31 D Hoffmann et al proteins needed for maturation of both urease and hydrogenase J Bacteriol 185, 726734 Wunschiers R, Batur M & Lindblad P (2003) Preă sence and expression of hydrogenase specific C-terminal endopeptidases in cyanobacteria BMC Microbiol 3, Kaneko T, Sato S, Kotani H, Tanaka A, Asamizu E, Nakamura Y, Miyajima N, Hirosawa M, Sugiura M, Sasamoto S et al (1996) Sequence analysis of the genome of the unicellular cyanobacterium Synechocystis sp PCC 6803 II Sequence determination of the entire genome and assignment of potential protein-coding regions DNA Res 3, 109–136 Ruiz-Argueso T, Palacios JM & Imperial J (2000) ă Uptake hydrogenases in root nodule bacteria In Prokaryotic Nitrogen Fixation A Model System for the Analysis of a Biological Process (Triplett EW, ed.), pp 489–507 Horizon Scientific Press, Norfolk Wolf I, Buhrke T, Dernedde J, Pohlmann A & Friedrich B (1998) Duplication of hyp genes involved in maturation of [NiFe] hydrogenases in Alcaligenes eutrophus H16 Arch Microbiol 170, 451–459 Quintero MJ, Muro-Pastor AM, Herrero A & Flores E (2000) Arginine catabolism in the cyanobacterium Synechocystis sp strain 6803 involves the urea cycle and arginase pathway J Bacteriol 182, 1008–1015 Perozich J, Hempel J & Morris SM Jr (1998) Roles of conserved residues in the arginase family Biochim Biophys Acta 1382, 23–37 Kanyo ZF, Scolnick LR, Ash DE & Christianson DW (1996) Structure of a unique binuclear manganese cluster in arginase Nature 383, 554–557 Christianson DW & Cox JD (1999) Catalysis by metalactivated hydroxide in zinc and manganese metalloenzymes Annu Rev Biochem 68, 33–57 Eitinger T, Suhr J, Moore L & Smith AC (2005) Secondary transporters for nickel and cobalt ions: theme and variations Biometals 18, 399–405 Hebbeln P & Eitinger T (2004) Heterologous production and characterization of bacterial nickel ⁄ cobalt permeases FEMS Microbiol Lett 230, 129–135 Appel J, Phunpruch S & Schulz R (2000) The bidirectional hydrogenase of Synechocystis sp PCC 6803 works as an electron valve during photosynthesis Arch Microbiol 173, 333–338 Sakamoto T, Delgaizo VB & Bryant DA (1998) Growth on urea can trigger death and peroxidation of the cyanobacterium Synechococcus sp strain PCC 7002 Appl Environ Microbiol 64, 2361–2366 Schwarzenbach G & Biedermann W (1948) Titration von Metallen mit Nitrilotriessigsaure H3X Endpunktsă indikation durch pH-Effekte Helv Chim Acta 31, 331 340 Rodionov DA, Hebbeln P, Gelfand MS & Eitinger T (2006) Comparative and functional genomic analysis of prokaryotic nickel and cobalt transporters: evidence for 4526 32 33 34 35 36 37 38 39 40 41 42 43 44 a novel group of ATP-binding cassette transporters J Bacteriol 188, 317–327 Rodionov DA, Vitreschak AG, Mironov AA & Gelfand MS (2003) Comparative genomics of the vitamin B12 metabolism and regulation in prokaryotes J Biol Chem 278, 41148–41159 Saito MA, Moffett JW, Chisholm SW & Waterbury JB (2002) Cobalt limitation and uptake in Prochlorococcus Limnol Oceanogr 47, 1629–1636 Saito MA, Rocap G & Moffett JW (2005) Production of cobalt ligands in a Synechococcus feature, the Costa Rica upwelling dome Limnol Oceanogr 50, 279–290 Sambrook J & Russell DW (2001) Molecular Cloning: A Laboratory Manual Cold Spring Habor Laboratory Press, Cold Spring Harbor, NY Chenchik A, Moqadam F & Siebert PD (1996) A new method for fullength cDNA cloning by PCR In A Laboratory Guide to RNA: Isolation, Analysis and Synthesis (Krieg PA, ed.), pp 273–321 Wiley-Liss, New York Kunert A, Hagemann M & Erdmann N (2000) Construction of promoter probe vectors for Synechocystis sp PCC 6803 using the light-emitting reporter systems GFP and LuxAB J Microbiol Methods 41, 185–194 Golden SS, Brusslan J & Haselkorn R (1987) Genetic engineering of the cyanobacterial chromosome Methods Enzymol 153, 228–229 Cobley JG, Clark AC, Weerasurya S, Queseda FA, Xiao JY, Bandrapali N, D’Silva I, Thounaojam M, Oda JF, Sumiyoshi T et al (2002) CpeR is an activator required for expression of the phycoerythrin operon (cpeBA) in the cyanobacterium Fremyella diplosiphon and is encoded in the phycoerythrin linker– polypeptide operon (cpeCDESTR) Mol Microbiol 44, 1517–1531 Kaltwasser H & Schlegel HG (1966) NADH-dependent coupled enzyme assay for urease and other ammoniaproducing systems Anal Biochem 16, 132–138 Smart LB, Anderson SL & McIntosh L (1991) Genetic inactivation of the photosystem I reaction center in the cyanobacterium Synechocystis sp PCC 6803 EMBO J 10, 3289–3296 Wohlleben W, Arnold W, Bissonnette L, Pelletier A, Tanguay A, Roy PH, Gamboa GC, Barry GF, Aubert E, Davies J et al (1989) On the evolution of Tn21-like multiresistance transposons: sequence analysis of the gene (aacC1) for gentamicin acetyltransferase-3-I (AAC(3)-I), another member of the Tn21-based expression cassette Mol Gen Genet 217, 202–208 Prentki P & Krisch HM (1984) In vitro insertional mutagenesis with a selectable DNA fragment Gene 29, 303–313 Taylor LA & Rose RE (1988) A correction in the nucleotide sequence of the Tn903 kanamycin resistance determinant in pUC4K Nucleic Acids Res 16, 358 FEBS Journal 273 (2006) 4516–4527 ª 2006 The Authors Journal compilation ª 2006 FEBS D Hoffmann et al Supplementary material The following supplementary material is available online: Fig S1 All the available cyanobacterial genomes were screened for the presence of speB2 homologs The Cyanobacterial hydrogenase accessory genes genetic maps of regions in the vicinity of all the speB2 found in other cyanobacteria and in Rhizobium species NGR234 are shown This material is available as part of the online article from http://www.blackwell-synergy.com FEBS Journal 273 (2006) 4516–4527 ª 2006 The Authors Journal compilation ª 2006 FEBS 4527 ... mutation and not to some unpredictable side effects Function of hypA and hypB in hydrogenase maturation The function of hypA and hypB was investigated in more detail Because HypA and HypB were... shown to be involved in the insertion of nickel into the active site of hydrogenases in E coli [13–15], the respective Synechocystis single- and double-mutants of hypA and hypB were grown in medium... with NhypA2 and ChypA2-primers pMOSblue-T vector containing hypB1 (sll1432), amplified with NhypB1 and ChypB1-primers pMOSblue-T vector containing hypB2 (sll1079), amplified with NhypB2 and ChypB2-primers