Gene expression in response to endoplasmic reticulum stress in Arabidopsis thaliana Shinya Kamauchi, Hiromi Nakatani, Chiharu Nakano and Reiko Urade Graduate School of Agriculture, Kyoto University, Uji, Japan Keywords endoplasmic reticulum; fluid microarray; gene expression; tunicamycin; unfolded protein response Correspondence R Urade, Graduate School of Agriculture, Kyoto University, Uji, Kyoto 611-0011, Japan Fax: +81 774 38 3758 Tel: +81 774 38 3757 E-mail: urade@kais.kyoto-u.ac.jp Database The nucleotide sequence data for soybean SEL-1L are available in the DDBJ ⁄ EMBL ⁄ GenBank databases under accession number AB197676 (Received 15 March 2005, revised 11 May 2005, accepted 16 May 2005) doi:10.1111/j.1742-4658.2005.04770.x Eukaryotic cells respond to the accumulation of unfolded proteins in the endoplasmic reticulum (ER) In this case, so-called unfolded protein response (UPR) genes are induced We determined the transcriptional expression of Arabidopsis thaliana UPR genes by fluid microarray analysis of tunicamycin-treated plantlets Two hundred and fifteen up-regulated genes and 17 down-regulated ones were identified These genes were reanalyzed with functional DNA microarrays, using DNA fragments cloned through fluid microarray analysis Finally, 36 up-regulated and two downregulated genes were recognized as UPR genes Among them, the up-regulation of genes related to protein degradation (HRD1, SEL-1L ⁄ HRD3 and DER1), regulation of translation (P58IPK), and apoptosis (BAX inhibitor-1) was reconfirmed by real-time reverse transcriptase-PCR The induction of SEL-1L protein in an Arabidopsis membrane fraction on tunicamycin-treatment was demonstrated Phosphorylation of initiation factor-2a, which was inhibited by P58IPK, was decreased in tunicamycin-treated plantlets However, regulatory changes in translation caused by ER stress were not detected in Arabidopsis Plant cells appeared to have a strategy for overcoming ER stress through enhancement of protein folding activity, degradation of unfolded proteins, and regulation of apoptosis, but not regulation of translation A nascent polypeptide synthesized on the rough endoplasmic reticulum (ER) is translocated and folded with the assistance of molecular chaperones and other folding factors such as glycosylation ⁄ modification enzymes and disulfide oxidoreductases within the ER However, the folding of nascent polypeptides occasionally does not occur, resulting in the accumulation of unfolded or misfolded proteins in the ER (ER stress) To solve this problem, eukaryotic cells sense ER stress and induce a set of genes called unfolded protein response (UPR) genes In the budding yeast Saccharomyces cerevisiae, ER transmem- brane protein kinase ⁄ riboendonuclease Ire 1p is activated by ER stress [1,2], and nonconventionally splices mRNA of basic leucine zipper transcription factor Hac 1p [3–5] Hac 1p is translated from the spliced mRNA and induces the UPR genes, having a UPR cis-acting regulatory element [6–8] On DNA microarray analysis, 381 genes have been identified as UPR ones induced by both tunicamycin (TM) and dithiothreitol [9] These comprise  6% of the total yeast genes encoding 173 unknown proteins and 208 proteins related to folding, glycosylation ⁄ modification, translocation, protein degradation, Abbreviations AARE, amino acid response element; ATF6, activating transcription factor 6; AZC, L-azetidine-2-carboxylic acid; BI-1, Bax inhibitor-1; eIF2a, initiation factor-2a; Endo H, endoglycosidase H; ER, endoplasmic reticulum; ERAD, ER-associated protein degradation; ERSE, ER stress response element; MS, Murashige and Skoog medium; PDI, protein disulfide isomerase; PKR, double stranded RNA-activated protein kinase; P-UPRE, plant-specific UPR element; RAMP4, ribosomal-associated membrane protein 4; TM, tunicamycin; UPR, unfolded protein response; UPRE, UPR cis-acting regulatory element; XBP-1, X-box binding factor FEBS Journal 272 (2005) 3461–3476 ª 2005 FEBS 3461 Unfolded protein response genes in Arabidopsis vesicle trafficking ⁄ transport, vacuolar protein sorting, cell wall biogenesis, and lipid ⁄ inositol metabolism In comparison with those of yeast, the UPR genes of mammalian cells are induced through a much more complicated mechanism, which has been shown to be triggered by at least three transcription factors, X-box binding factor (XBP-1), activating transcription factor (ATF6), and ATF4 [10] The mammalian paralog of yeast Ire 1p is activated by ER stress and splices the invalid mRNA into mature mRNA encoding 371amino acid XBP-1 [11,12] XBP-1 translated from the spliced mRNA is translocated to the nucleus [13], where it binds to its target sequence in the regulatory regions of the P58IPK, ERdj4, HEDJ, EDEM, protein disulfide isomerase (PDI)-P5, ribosomal-associated membrane protein (RAMP4), DnaJ ⁄ HSP40-like genes, etc [14] ATF6 is an ER transmembrane protein that senses ER stress through its luminal domain, and then moves to Golgi bodies to be cleaved by site-1 and site-2 proteases [15–17] The cleaved ATF6 cytoplasmic domain is released from Golgi membranes into the nucleus, where it induces, in the presence of nuclear factor Y, ER chaperone genes including BIP, GRP94, Calreticulin and ORP150, which have an ER stress response element (ERSE) in their regulatory regions [18,19] PERK is an interferone-induced double stranded RNA-activated protein kinase (PKR)-related protein that senses ER stress through its luminal domain and then phosphorylates initiation factor-2a (eIF2a), resulting in inhibition of bulk protein translation [20,21] and stimulation of translation of ATF4 [22] ATF4 is a basic leucine zipper transcription factor that induces the transcription of many amino acid synthetic enzymes and amino acid transporters by binding to the amino acid response element (AARE) in the regulatory regions of these genes [23] ATF4 has also been shown to stimulate the transcription of CHOP, which is important for apoptotic cell death [24] In contrast to the UPR mechanism(s) in yeast and animal cells, that of plant cells is not well understood Putative plant paralogs of yeast Ire1p have been found in Arabidopsis thaliana and Oryza sativa [25,26] Their N-terminal luminal domains have each been shown to function as a sensor for ER stress in yeast However, neither target mRNAs of transcription factors for plant Ire1p nor target genes induced by this system have been identified On the other hand, the mRNAs of BiP, calreticulin, calnexin and PDI have been shown to be induced on treatment with TM and dithiothreitol in Arabidopsis, Zea mays, Phaseolus vulgalis, Glycine max and Nicotiana tabacum on northern analysis [27– 31] The 21 UPR genes up-regulated by the stress induced by both TM and dithiothreitol have been 3462 S Kamauchi et al identified among 8297 genes of the  27 000 proteincoding genes of Arabidopsis with an Affimetrix GeneChips [32] In this paper, we present a list of the UPR genes of Arabidopsis identified among all the protein-coding genes In order to increase the accuracy of the list, the genes selected on fluid microarray analysis were reanalyzed by functional DNA microarray analysis In addition to the genes related to protein folding and degradation, genes related to protein translation and apoptosis are also included in the list Results Fluid microarray analysis of gene expression on TM-treatment To identify UPR genes among all the genes expressed in Arabidopsis, we adopted the fluid microarray method, by which target genes can be cloned from selected fluid microarray beads The fluid microarray beads and probes for array analysis were prepared using the mRNA from plantlets treated with or without TM for h BiP mRNA, a representative UPR gene, in TM-treated plantlets, was shown to increase 5.7 times compared to the level in untreated plantlets on real-time RT-PCR analysis For the control experiment, competitive hybridization and sorting of the beads with a cell sorter were performed on · 104 beads with a : mixture of the probes, which had been prepared from noninduced plantlets, and differentially labeled with Cy5 and fluorescein In the control experiment, almost all of the beads after the control hybridization were sorted in the diagonal line region, the fluorescence intensities for fluorescein and Cy5 being the same (Fig 1A) Based on the distribution of beads in this experiment, we set three gates to collect beads, i.e., for ones more heavily labeled with Cy5 (U1 and U2) and fluorescein (D) For differential gene expression analysis, probes from TM-treated plantlets were labeled with Cy5 Probes from nontreated plantlets were labeled with fluorescein Then · 105 beads were hybridized with a : mixture of the two types of probes For analysis of differential gene expression, 1473 and 1703 beads were collected in fractions U1 and U2 of the up-regulated genes, and 3550 beads in fraction D of the down-regulated genes (Figs 1B and 2A) The DNA fragments on beads in these fractions were amplified by PCR and then sequenced In the up-regulated fractions, 215 genes (Table S1) were found as clusters of clones, which were identified on more than two beads, and 412 as singlet clones, which were identified on single beads (Table S2) For the FEBS Journal 272 (2005) 3461–3476 ª 2005 FEBS S Kamauchi et al Unfolded protein response genes in Arabidopsis A B Fig Competitive hybridization on fluid microarrays (A) Control hybridization: · 104 beads were hybridized with a : mixture of differentially labeled probes from noninduced plantlets (B) Competitive hybridization: · 105 beads were hybridized with a : mixture of cDNA probes prepared from induced (Cy5) and noninduced plantlets (fluorescein) as described under Experimental procedures After hybridization, beads that went to gates U1, U2 and D were collected and subjected to gene analysis as described under Experimental procedures down-regulated fraction, 10% of the total beads were analyzed to reveal 17 genes as clusters of clones (Table 1) and 34 as singlet clones (Table S2) Analysis with functional DNA microarrays In order to increase the accuracy of the list of UPR genes, we reanalyzed the genes selected on fluid microarray analysis with functional DNA microarrays The functional DNA microarrays were prepared by spotting PCR fragments from the 215 up-regulated cluster genes (Table S1) and the 17 down-regulated cluster genes (Table 1) cloned on fluid microarray analysis Singlet genes were omitted from the functional DNA microarray analysis, because the list of singlet genes was predicted to contain missorted non-UPR genes at a high frequency Functional DNA microarray analyses were performed with mRNA preparations from plantlets treated with or without TM, dithiothreitol or l-azetidine-2-carboxylic acid (AZC) AZC is a proline analog that is incorporated in nascent polypeptides instead of proline and prevents the folding of the polypeptides [33] Induction of BiP mRNA by dithiothreitol- or AZC-treatment (3 h or 17 h, respectively) was confirmed to be 3.4 or 22-times higher than that in untreated plantlets on real-time RT-PCR analysis To identify the up-regulated UPR genes, it was required that candidate UPR genes show a mean fold variation of greater than 1.2-fold with all the treatments with TM, dithiothreitol and AZC In addition, from the list, we eliminated the genes in which the degree of variation was lower than the sum of the background variation and twice the standard deviation The degree of background FEBS Journal 272 (2005) 3461–3476 ª 2005 FEBS variation was obtained by means of a self ⁄ self hybridization experiment with Cy5 or Cy3-labeled target DNA fragments prepared from nontreated plantlet mRNA Thus, the expression difference between selected genes was regarded as being significant below a probability of error of 5% Thirty-six genes were confirmed to be induced under the three different inductive conditions, because these genes satisfied this criterion (Fig 2B and Table 2) These genes comprised 30 for which some functional information was available and six for which no information was available Among them, 27 genes were putative paralogs that have been reported to be UPR genes in yeast and ⁄ or mammalian cells The functional categories comprise protein folding (13 genes), translocation (six genes), ER-associated protein degradation (ERAD) (three genes; HRD1-like, SEL-1L ⁄ HRD3-like, and DER1-like), protein glycosylation and modification (two genes), regulation of translation (P58IPK) [34], and vesicle trafficking (two genes) The induction of HRD1-like, SEL-1L ⁄ HRD3-like, DER1-like, and P58IPK mRNA was confirmed by real-time RT-PCR analysis (Fig 3) In addition, we found that an antiapoptosis protein, Bax inhibitor-1 (BI-1) [35,36], was also included in the list of up-regulated UPR genes Induction of this paralog by ER stress in organisms other than plants has not been reported The induction of BI-1 mRNA by ER stress in Arabidopsis was confirmed by real-time RT-PCR analysis (Fig 3) Furthermore, the induction (1.5-fold variation) of Homo sapiens BI-1 by TM-treatment for 24 h was confirmed in Hep G2 cells, a cell line derived from a human hepatoma, by real-time RT-PCR (data not shown) 3463 Unfolded protein response genes in Arabidopsis S Kamauchi et al Putative cis-acting regulatory element of UPR genes Fig Overview of the fluid microarray and functional microarray analyses (A) Gene selection by fluid microarray analysis Gates, U1, U2 and D were set as shown in Fig 1B Singlet, a gene identified on a single bead Cluster, a gene identified on more than two beads (B) Analysis with functional DNA microarrays The genes selected in (A) were analyzed Two hundred and thirty-two genes (215 up-regulated cluster and 17 down-regulated cluster genes) were spotted on functional DNA microarrays The functional DNA microarray analysis was carried out with target DNA fragments prepared from the mRNA of control plantlets or plantlets treated with tunicamycin (TM), dithiothreitol (DTT) or L-azetidine-2-carboxylic acid (AZC) as described under Experimental procedures The numbers are the numbers of genes that showed an expression difference between control plantlets and plantlets treated with TM, DTT or AZC The numbers in the ‘Overlap’ row are the numbers of overlapping up-regulated genes or down-regulated genes upon treatments with the three reagents (C) Venn diagram of the numbers of overlapping and nonoverlapping putative UPR cis-acting regulatory elements of the 36 up-regulated genes selected in (B) The numbers in parentheses are the numbers of genes that have a cis-acting regulatory element Bold letters are the numbers of overlapping genes ERSE, CCAAT-N9-(A ⁄ C)CACG; XbpI, TGACGTG(G ⁄ T); P-UPRE, ATTGG(T ⁄ G)CCACGTCAT; AARE, TT(G ⁄ T)CATCA To identify the down-regulated UPR genes, we required that candidate UPR genes show a mean fold variation of lower than 0.8-fold with all the treatments with TM, dithiothreitol and AZC Two genes encoding vegetative storage proteins, Vsp1 and Vsp2 [37,38], satisfied this criterion Vsp2-beads comprised 58% of the beads collected and were analyzed at gate D 3464 In yeast, ER stress activates Ire1p, which triggers the nonconventional splicing of HAC1 mRNA [3–5] Hac1p produced from the spliced mRNA induces the transcription of UPR genes by binding to their UPR cis-acting regulatory element (UPRE), CAGCGTG [6–8] In mammals, four kinds of cis-acting regulatory elements, which respond to ER stress, are known Mammalian UPRE (TGACGTG-T ⁄ G) has been shown to be the specific cis-acting regulatory element for XBP1 and is referred to as the XBP1 binding site [39,40] ERSE (CCAAT-N9-CCACG) has been found to be recognized by both ATF6 and XBP1 in vitro [41] ERSEII (ATTGG-N-CCACG) has also been demonstrated to be a target of ATF6 [42] Binding of ATF6 to these cis-acting regulatory elements occurs in collaboration with general transcription factor nuclear factor-Y [43,44] AARE (C ⁄ EBT-ATF) (TT-G ⁄ T-CATCA), which was discovered in the CHOP promoter, is recognized by ATF4, translation of which is accelerated by ER stress [24] In plants, a plant-specific UPR element (P-UPRE) (ATTGGTCCACGTCATC), which contains two mammalian UPR cis-acting regulatory elements such as ERSEII and XBP1 binding sequences, was found in the 5¢ upstream regions of the BiP and calnexin genes [45] Furthermore, complementary sequences to the mammalian ERSE and XBP1 binding sequences have been found in the 5¢ upstream regions of several genes that are induced by TM- or dithiothreitol-treatment [32,45] Therefore, we searched for P-UPRE, the XBP1 binding sequence, ERSE, AARE, or complementary sequences in the 5¢ upstream regions (up to 1000 nucleotides) of the UPR genes Single or plural putative cis-acting regulatory elements were found in the 5¢ upstream regions of 28 of the 36 up-regulated genes (Fig 2C and Table 3) No cis-acting regulatory element sequence was found in the 5¢ upstream regions of the two down-regulated genes Increase in putative SEL-1L due to ER stress in Arabidopsis In yeast and mammalian cells, the HRD1 ⁄ HRD3 (SEL-1L) ubiquitination system coupled to protein degradation by 26S proteasomes is known to be induced to remove unfolded proteins under ER stress [9,46] Plant paralogs of these genes have not been identified yet In this study, the transcriptional induction of genes homologous to mammalian HRD1 and SEL-1L [47–49] was observed (Fig 3) Then, HRD1and SEL-1L-like cDNAs were cloned with mRNA of FEBS Journal 272 (2005) 3461–3476 ª 2005 FEBS S Kamauchi et al Unfolded protein response genes in Arabidopsis Table Genes recovered at gate D and functional DNA microarray analysis of them Tunicamycin (TM), dithiothreitol (DTT) and L-azetidine2-carboxylic acid (AZC) values are means for six experiments Control ratio obtained on competitive hybridization with Cy5- and Cy3-labeled control mRNA; values are means for six experiments SD, standard deviation; n.d., not determined Fluid microbead array (number of beads) Functional DNA microarray (fold variation) AGI gene Description U1 U2 D TM DTT At5g24770 At5g24780 At2g39330 At5g50960 At3g04120 At5g64120 At4g34490 At4g37410 At5g04140 At4g22470 At5g47930 At1g01060 At2g07671 At4g32610 At2g07707 At3g02200 At5g51190 Vegetative storage protein Vsp2 Vegetative storage protein Vsp1 Putative mylosinase-binding protein Nucleotide-binding protein Glyceraldehyde-3-phosphate dehydrogenase C subunit Peroxidase Adenylyl cyclase-associated protein CAP2 Cytochrome P450 Ferredoxin-dependent glutamate synthase Extensin-like protein Ribosomal protein S27 Similar to DNA binding protein CCA1 Unknown Unknown Unknown Unknown Unknown 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 182 12 15 2 2 5 31 12 0.20 0.19 0.36 0.97 0.68 n.d 0.94 0.28 0.83 0.27 1.15 0.24 0.21 0.92 0.28 0.99 1.12 0.78 0.79 1.10 1.20 0.99 n.d 0.94 1.03 0.97 0.91 0.95 0.82 0.93 0.96 0.90 1.00 0.99 Arabidopsis plantlets by RT-PCR Their nucleotide sequences coincided with those presented in the database of ‘The Arabidopsis Information Resource’ (http://www.arabidopsis.org/) The putative amino acid sequence of an HRD1-like protein contained an N-terminal signal sequence and five membrane-spanning regions (data not shown) The recombinant luminal domain of the HRD1-like protein was expressed in Escherichia coli and purified Unfortunately, autoubiquitination activity was not detected for the recombinant HRD1-like protein On the other hand, the putative amino acid sequence of Arabidopsis SEL-1L (At SEL-1L) contained an N-terminal signal sequence (Met1–Glu20), two N-glycosylation consensus sequences, and a membrane-spanning region (Phe623– Arg643) near the C-terminus (data not shown) The amino acid sequence of a soybean paralog of SEL-1L, which was deduced from the nucleotide sequence of cDNA cloned from young leaves by RT-PCR, was closely similar to Arabidopsis ones (data not shown) Anti-(At SEL-1L) serum was prepared with the recombinant luminal domain (Phe21–Val622) of At SEL-1L, which was expressed in E coli and isolated The antiserum only immunoreacted with a 74 kDa protein of control plantlets on western blotting analysis (Fig 4A) With TM-treatment, the 74 kDa protein gradually decreased and a 70 kDa band began to appear at h after the treatment During the next 24 h, the 70 kDa band significantly increased The size of the 74 kDa FEBS Journal 272 (2005) 3461–3476 ª 2005 FEBS AZC 0.38 0.12 n.d 5.64 0.98 0.05 0.02 0.84 n.d 0.02 0.69 0.01 6.56 0.74 2.16 0.32 2.95 Control (SD) 0.99 0.98 1.10 0.93 1.01 1.01 1.09 0.94 3.89 1.03 1.09 0.89 1.30 1.10 1.04 0.93 18.08 (0.04) (0.05) (0.05) (0.08) (0.03) (0.03) (0.14) (0.04) (6.12) (0.03) (0.06) (0.08) (0.15) (0.09) (0.07) (0.06) (0) band decreased to 70 kDa on endoglycosidase H (Endo H) digestion On the other hand, the 70 kDa band was insensitive to Endo H (Fig 4B) From these results, the 70 kDa protein was thought to be a nonglycosylated form of At SEL-1L On cell fractionation, At SEL-1L was assumed to be a membrane protein, as judging from the existence of a putative membrane spanning region (Fig 4C) The 70 kDa band of plantlets treated with TM for 24 or 48 h was denser than the 74 kDa band of the control plantlets (Fig 4B) Thus, it was suggested that At SEL-1L polypeptides were synthesized from the At SEL-1L mRNA induced by ER stress, but that N-glycosylation of newly synthesized At SEL-1L molecules was inhibited by TM ER stress and phosphorylation of eIF2a In this study, we found that the mRNA of P58IPK was induced by ER stress (Table and Fig 3) P58IPK was first identified as an inhibitor of interferon-induced PKR in mammalian cells [50] The PKR family responds to different stress signals and attenuates translation by phosphorylating the specific serine residue of eIF2a [51] to protect cells from the stress P58IPK inhibits PKR-mediated translational arrest by inactivating the kinase by binding to the domain of PKR family members In mammals, ER stress also causes translational arrest through phosphorylation of eIF2a by PKR-like ER kinase, PERK [20,52] 3465 Unfolded protein response genes in Arabidopsis S Kamauchi et al Table Genes up-regulated by ER stress Tunicamycin (TM), dithiothreitol (DTT) and L-azetidine-2-carboxylic acid (AZC) values are means for six experiments Control ratio obtained on competitive hybridization with Cy5- and Cy3-labeled control mRNA; values are means for six experiments SD, standard deviation Fluid microbead array (number of beads) AGI gene U1 Description PROTEIN FOLDING At1g09080 BiP-likea,b At5g28540 BiPa,b At5g42420 BiP At5g61790 Calnexin 1a,b At5g07340 Calnexin 2a,b At1g56340 Calreticulin At1g09210 Calreticulin 2a,b At4g24190 AtHsp90-7a,b At2g47470 Similar to PDIa At1g77510 Similar to PDI At2g32920 Similar to PDIa At1g04980 Similar to PDI At5g58710 AtCYP20-1 (cyclophilin ROC7) GLYCOSYLATION ⁄ MODIFICATION At2g02810 UDP-glucose ⁄ UDP-galactose transportera,b At2g41490 UDP-GlcNac:dolichol phosphate N-acetyl-glucosamine-1-phosphate transferasea TRANSLOCATION At5g50460 SEC61 gamma subunit At1g29310 Similar to SEC61 alpha subunit At2g34250 Similar to SEC61 alpha subunit At1g27330 Similar to SERP1 ⁄ RAMP4 At1g27350 Similar to SERP1 ⁄ RAMP4a,b At3g51980 Similar to ER chaperone SIL PROTEIN DEGRADATION At1g65040 Similar to HRD1 At4g21810 Similar to DER1a,b At1g18260 Similar to SEL-1L ⁄ HRD3 TRANSLATION At5g03160 P58IPK VESICLE TRAFFICKING At3g07680 Similar to Emp24p At4g21730 Similar to NEM-sensitive fusion protein ANTI-APOPTOSIS At5g47120 BI-1 UNCLASSIFIED At2g25110 Similar to stroma cell-derived factora At5g09410 Similar to anther ethylene-up-regulated calmodulin-binding protein ER1 UNKNOWN At5g18090 At1g56580 At5g64510 At5g14890 At3g22235 At1g29060 a ` Gene identified by Martınez and Chrispeels [32] 3466 b Functional DNA microarray (fold variation) TM DTT AZC Control (SD) 3.13 1.14 1.21 0.27 0.97 1.02 0.95 1.05 1.05 0.91 1.01 0.95 1.01 U2 302 140 82 0 16 34 30 2 91 26 12 22 44 54 38.24 3.81 4.12 3.42 2.37 2.16 2.43 3.86 2.11 3.82 2.46 3.22 1.43 38.35 4.06 4.09 2.63 2.34 2.07 2.02 2.65 2.28 2.68 2.50 3.00 1.34 508.73 36.22 53.67 25.26 10.48 1.94 1.51 6.88 3.53 11.98 10.30 10.46 2.13 3.53 2.08 21.95 0.94 (0.04) 1.55 1.53 6.67 1.01 (0.09) 0 203 22 120 13 34 1.94 1.5 1.27 2.42 2.05 2.39 1.66 1.61 1.38 1.82 1.72 3.00 5.54 11.89 2.11 13.48 10.61 52.88 0 11 3.36 1.67 1.54 2.33 1.59 1.54 6.48 4.23 9.16 0.99 (0.07) 1.09 (0.07) 0.96 (0.11) 14 2.06 1.76 10.76 0.94 (0.11) 0 1.47 7.52 1.29 9.68 2.73 688.38 0.98 (0.05) 1.05 (0.19) 2.30 1.73 86.70 0.99 (0.07) 2.14 1.20 2.08 1.20 9.17 3.59 0.93 (0.03) 0.89 (0.05) 0 70 1.20 1.95 12.74 3.60 1.51 1.79 1.25 1.98 5.87 5.60 2.49 1.78 14.31 9.66 181.56 46.17 1.28 33.69 1.07 0.97 0.96 0.98 1.08 0.98 0.90 1.04 1.29 1.05 1.11 1.02 (0.33) (0.14) (0.10) (0) (0.09) (0.15) (0.05) (0.12) (0.19) (0.07) (0.08) (0.13) (0.08) (0.13) (0.10) (0.07) (0.04) (0.19) (0.12) (0.06) (0.02) (0.32) (0.05) (0.09) (0.07) Genes identified by Noh et al [54] FEBS Journal 272 (2005) 3461–3476 ª 2005 FEBS S Kamauchi et al Fig Confirmation of transcriptional induction of six genes by real-time RT-PCR analysis The amounts of actin, BiP, HRD1, SEL1L, DER1, p58IPK and BI-1 mRNAs in total RNA from Arabidopsis plantlets treated with TM (black bars), DTT (hatched bars), or AZC (white bars) for h were determined by real-time RT-PCR as described under Experimental procedures The value for each mRNA was standardized to the value for actin mRNA in the corresponding total RNA preparation Fold expression change was calculated as the ratio of mRNA in the plantlets treated and untreated with a stress reagent Each value represents the mean for two experiments Mammalian P58IPK has been shown to be induced at a later phase of ER stress [53] Deletion of P58IPK has been reported to result in an increase in phosphorylated eIF2a Hence P58IPK is thought to function as a feedback regulator for translational regulation in the later phase of ER stress The phosphorylated Ser51 of eIF2a in plantlets was examined during ER stress by western blot analysis (Fig 5A) The level of phosphorylated eIF2a (Ser51) in the plantlets treated with TM was lower than that in untreated plantlets The phosphorylated eIF2a increased again on removal of TM from the medium after h of treatment However, the protein synthesis in plantlets, which was assayed as the incorporation of [35S]-labeled Met and Cys into nascent proteins, was not affected by TM-treatment (Fig 5B) Discussion In this study, we tried to make a list of the UPR genes in Arabidopsis In total, 215 up-regulated and 17 down-regulated cluster genes were cloned from mRNA of Arabidopsis plantlets treated with TM on fluid microarray analysis A functional DNA array was prepared by using the cloned gene fragments, and then used for analysis Among the 215 up-regulated cluster genes, only 63 showed statistically positive signals on functional DNA array analysis, showing differences in the expression of target mRNA of the plantlets treated with or without TM Because the fluid microarray FEBS Journal 272 (2005) 3461–3476 ª 2005 FEBS Unfolded protein response genes in Arabidopsis beads included a large number with highly expressed housekeeping genes, some of them might be missorted at the gates, which would expand the list of genes Of the beads collected at gates U1 and D on fluid microarray analysis, 89 and 87% were regarded as up-regulated and down-regulated genes on functional DNA microarray analysis, respectively On the other hand, 38% of the beads collected at gate U2 were regarded as up-regulated genes on functional DNA microarray analysis This suggests that the discrepancy between the values obtained in the two analyses is mainly due to the beads missorted at gate U2 However, of the rest, the 50 genes that showed no up-regulated signal for the plantlets treated with TM showed an up-regulated signal in the plantlets treated with dithiothreitol and ⁄ or AZC In addition, 23 of the genes that showed no difference in expression on DNA microarray analysis between plantlets treated and untreated with TM had putative UPR cis-acting regulatory elements in their upstream regions Furthermore, 27 of the 63 genes were eliminated on functional DNA microarray analysis from the list by setting some criteria Therefore, the remaining 36 genes, which satisfied these criteria, were considered to be reliable up-regulated UPR genes Among these 36 genes, 12 coincided with up-regulated UPR genes previously identified on analysis with an Affimetrix GeneChips loaded with 8297 Arabidopsis probe sets [32,54] Two down-regulated genes, Vsp1 and Vsp2, which satisfied all the criteria, are known to be for temporary nitrogen-storage proteins [38], and are subject to regulation by sugars, light, phosphates, nitrogen, wounding, auxins, jasmonates and oxidative-stress [55] The down-regulation of Vsp1 and Vsp2 may result in an increase in the intracellular amino acid pool, which may play an important role in the recovery from ER stress In mammalian cells, ER stress affects cellular amino acid metabolism via the PERK ⁄ ATF4-mediated signaling pathway, which induces some amino acid synthesis- and transport-related genes [23] No putative UPR cis-acting regulatory element was found in the 5¢ upstream regions of Arabidopsis Vsp1 and Vsp2 Therefore, it is not clear whether these genes are directly regulated by the UPR system or down-regulated by a metabolic disorder caused by ER stress Thirteen genes, which encode six protein families responsible for protein folding, are included in the UPR gene list Among them, BiP (three genes), calnexin (two genes), calreticulin (two genes), and AtHSP 907 (one gene) have been shown to be induced by ER stress on northern blotting [25,54] Four genes encoding PDI families are also included in the list PDI and its family members are characterized by the pres3467 Unfolded protein response genes in Arabidopsis S Kamauchi et al Table Putative cis-acting regulatory elements of genes up-regulated by ER stress Position designated from the 5¢ terminus of the ATG initiation codon Lowercase letters in sequences correspond to N9 in ERSE-like sequence CCAAT-N9-(A/C) CACG cis-Acting regulatory element AGI gene Description Motif-like Position At1g09080 BiP-like At5g28540 At5g42420 BiP BiP At5g61790 Calnexin At5g07340 At1g56340 At1g09210 At4g24190 Calnexin Calreticulin Calreticulin AtHsp90-7 At2g47470 At1g77510 At2g32920 At1g04980 Similar Similar Similar Similar CGTGTcaagaagtgATTGG(142–124) CGTGTctgcttgtgATTGG(220–202) ATTGGTCCACGTCAT(168–154) CCACGTCA(187–180) ATTGGACCACGTCAT(193–179) CGTGGcctgttatgATTGG(237–219) TGACGTGG(240–233) ATTGGGCCCAGGTCA(290–274) CGTGTatttaactaATTGG(147–129) CGTGTcggttacctACCGG(178–160) CCAATacaaaactaCCACG(229–211) CCACGTCA(253–246) CCACGTCA(139–132) CCAATgaaaactctCCACG(158–140) At5g58710 AtCYP20-1 (cyclophilin ROC7) At2g02810 At2g41490 Similar to UDP-glucose ⁄ UDP-galactose transporter UDP-GlcNac:dolichol phosphate N-acetylglucosamine1-phosphate transferase ERSE-like ERSE-like P-UPRE Xbp1 binding-like P-UPRE ERSE-like Xbp1 binding-like P-UPRE ERSE-like ERSE-like ERSE-like Xbp1 binding-like Xbp1 binding-like ERSE-like – ERSE-like Xbp1 binding-like Xbp1 binding-like ERSE-like – ERSE-like – Xbp1 binding-like Xbp1 binding-like ERSE-like – ERSE-like ERSE-like Xbp1 binding-like ERSE-like ERSE-like – ERSE-like ERSE-like ERSE-like ERSE-like Xbp1 binding-like Xbp1 binding-like – ERSE-like – CGTGGcaaatccttATTGG(128–110) to to to to PDI PDI PDI PDI At5g50460 SEC61 gamma subunit At1g29310 At2g34250 At1g27330 At1g27350 At3g51980 Similar Similar Similar Similar Similar At1g65040 At4g21810 At1g18260 At5g03160 Similar to HRD1 Similar to DER1 Similar to SEL-1L ⁄ HRD3 P58IPK At3g07680 Similar to Emp24p At4g21730 At5g47120 At2g25110 At5g09410 Similar to NEM-sensitive fusion protein BI-1 Similar to stroma cell-derived factor Similar to anther ethylene-up-regulated calmodulinbinding protein ER1 At5g18090 At1g56580 At5g64510 At5g14890 At3g22235 At1g29060 3468 to to to to to Unknown Unknown Unknown Unknown Unknown Unknown SEC61 alpha subunit SEC61 alpha subunit SERP1 ⁄ RAMP4 SERP1 ⁄ RAMP4 ER chaperone SIL ERSE-like Xbp1 binding-like AARE-like AARE-like – – – ERSE-like CGTGTgacaatatcATTGG(128–110) TGACGTGT(131–124) TGACGTGG(83–76) CCAATtacaattgtACACG(134–116) TGACGTGT(171–164) TGACGTGT(322–315) CGTGTatccgtattATTGG(439–420) CCAATcactgaccgCCACG(223–205) CCAATtatagacggCCACG(269–251) TGACGTGT(149–142) CGTGTaataatataATTGG(146–128) CGTGTcgttatatcATTGG(338–320) CGTGGccggttactATTGG(176–158) CGTGGgtcataacgATTGG(244–226) CGTGTttaattatcATTGG(304–286) CCAATgatataacgCCACG(437–419) TGACGTGG(477–470) ACACGTCA(609–602) CGTGGatgattcttATTGG(298–280) CGTGTcggaggtttATTGG(271–253) TGACGTGG(396–389) TTTCATCA(154–161) TTTCATCA(271–278) CCAATattaaaacgCCACG(233–215) FEBS Journal 272 (2005) 3461–3476 ª 2005 FEBS S Kamauchi et al A Unfolded protein response genes in Arabidopsis A B B C Fig Increase in At SEL-1L in the membranes of Arabidopsis plantlets on TM-treatment (A) Plantlets were incubated in the presence (lanes 7–12) or absence of TM (lanes 1–6) for the indicated times Proteins were extracted and then subjected to SDS ⁄ PAGE At SEL-1L was stained by western blotting with antiserum as described under Experimental procedures (B) Plantlets were incubated in the presence (lanes and 4) or absence of TM (lanes and 2) for 48 h Proteins were extracted, digested with (lanes and 4) or without (lanes and 3) Endo H, and then subjected to SDS ⁄ PAGE At SEL-1L was stained by western blotting with antiserum as described under Experimental procedures (C) The total (lane 1), supernatant (lane 2), and membrane (lane 3) fractions obtained from the plantlets treated with TM for 48 h on centrifugation at 100 000 g were subjected to SDS ⁄ PAGE, and At SEL-1L was stained by western blotting with antiserum as described under Experimental procedures ence of one or two thioredoxin homologous motifs per molecule Yeast and mammalian PDIs are known as multifunctional folding catalysts and molecular chaperones, which catalyze the formation and rearrangement of disulfide bonds between correct pairs of cysteine residues in nascent polypeptide chains in the ER [56] Mammalian PDI functions not only as a catalytic enzyme but also as a subunit of microsome triacylglycerol transfer protein [57] and prolylhydroxylase [58] Mammalian PDI family ER-60 ⁄ ERp57, which also exhibits protein oxidoreductase activity, interacts and cooperates with calnexin or calreticulin for oxidative folding of N-glycosylated proteins [59–61] The genes of these PDI families are UPR genes [41] In the Arabidopsis genome, 13 genes encoding putative PDI-related proteins, i.e At1g04980 (NP 171990), At1g07960 (NP172274), At1g15020 (NP 172955), At1g35620 (NP 564462), At1g21750 (NP 173594), At1g52260 (NP 175636), At1g77510 (NP 177875), At2g01270 (NP 565258), At2g32920 (NP 180851), At2g47470 (NP182269), At3g54960 (NP 191056), At3g16110 (NP 188232), and At5g60640 (NP 568926), were found Identification and characterization of these PDI family proteins were not carried out However, they were supposed to play important roles in protein folding, as four PDI-related genes among the above 13 genes were FEBS Journal 272 (2005) 3461–3476 ª 2005 FEBS Fig Effect of TM-treatment on phosphorylation of eIF2a Plantlets were incubated in the medium with TM for h (lane 2), h (lane 3), or h (lane 4), or without TM for h (lane 1) as described under Experimental procedures In other experiments, plantlets were incubated in the medium with TM for h and then incubated in the medium without TM for an additional h (lane 5) or h (lane 6) (A) After the incubation, the proteins were extracted from the plantlets and subjected to SDS ⁄ PAGE Phosphorylated Ser51 of eIF2a was determined by western blot analysis as described under Experimental procedures (B) After the incubation, proteins of the plantlets were metabolically labeled with [35S]Met and [35S]Cys for 20 at 25 °C Then, the proteins were extracted and subjected to SDS ⁄ PAGE Labeled proteins were determined by fluorography as described under Experimental procedures confirmed to be induced by ER stress A gene encoding cyclophilin family protein ATCYP20-1 was identified as a UPR gene Twenty-nine genes encoding cyclophilin family members were found in the Arabidopsis genome [62] Among them, five gene products are assumed to be targeted to the ER lumen with N-terminal signal peptides Among them, ATCYP20-1 has the amino acid sequence RFWH, which is an essential sequence for peptidyl prolyl cis, trans isomerase activity Hence, it is suggested that ATCYP20-1 may participate in the folding of proteins in the ER The genes of six translocation-related proteins were found to be induced In mammalian cells and yeast, translocon subunit proteins are thought to be induced to enhance retrotranslocation of unfolded proteins from the ER to the cytosol [63] The retrotranslocated proteins are degraded by 26S proteasomes Recently, in tobacco, a GFP-fusion protein containing the P region of calreticulin, which is a model of a misfolded 3469 Unfolded protein response genes in Arabidopsis protein in the ER, was shown to be retrotranslocated to the cytosol, ubiquitinated, and then degraded [64] The induction of translocon subunits by ER stress in Arabidopsis suggests that an ERAD system similar to those of yeast or mammalian cells may remove misfolded proteins produced in the ER of plant cells This is supported by our finding that the genes encoding putative plant DER1, HRD1 and SEL-1L ⁄ HRD3 were also induced by ER stress DER1 is a hydrophobic protein that is localized to the ER In yeast, deletion of DER1 prevents degradation of unfolded proteins, suggesting that the function of DER1 may be specifically required for ERAD [65] Yeast HRD1 is an ERmembrane-anchored ubiquitin ligase, which is required for the degradation and ubiquitination of several ERAD substrates, and is associated with relevant ubiquitin-conjugating enzymes [46] At HRD1, which has the same nucleotide sequence as that registered in ‘The Arabidopsis Information Resource’, was cloned by RT-PCR with mRNA from Arabidopsis Six transmembrane regions and a RING-H2 domain of Arabidopsis HRD1 (At HRD1) showed high sequence homology with those of yeast and human HRD1s Unfortunately, it is unclear whether or not At HRD1 functions as an ubiquitin ligase, as the cytosolic domain of At HRD1, which was expressed in E coli and isolated, showed no self-ubiquitination activity with an in vitro assay system involving commercial human E1 and yeast E2 (UbCH5c) Yeast HRD3 is an ER-resident glycoprotein with a single span near the C-terminus, which stabilizes HRD1 and regulates the cytosolic HRD1 RING-H2 domain through interaction with the HRD1 transmembrane domain [66] We showed that At SEL-1L was a membrane-anchored glycoprotein and that it increased under ER stress In order to clarify the details of the mechanism of plant ERAD, functional characterization of these proteins must be performed In mammalian cells, ER stress responses are composed of three steps, i.e., enhancement of the refolding and degradation of unfolded proteins, attenuation of translation [20,21], and apoptosis [24] ER stress has not been found to cause attenuation of translation in plants In this study, we found that the P58IPK gene was up-regulated by ER stress Mammalian P58IPK is induced at a later phase of ER stress and inhibits PKR-mediated translational arrest by binding to the kinase domain of the PKR family [53] However, bulk protein translation of Arabidopsis was not affected by ER stress, even though the phosphorylation of eIF2a (Ser51) was partially inhibited by ER stress The phosphorylation of eIF2a (Ser51) increases the translational efficiency of yeast GCN4 mRNA and mammalian 3470 S Kamauchi et al ATF4 mRNA, which have four and two upstream open reading frames in the 5¢ noncoding portion, respectively [67,68] Induction of Arabidopsis P58IPK followed by a decrease in the phosphorylation of eIF2a (Ser51) may increase the translational efficiency for unidentified gene(s) It is unclear whether apoptosis may function as a UPR in plants, although inhibition of ER-type IIA Ca2+-pumps has been reported to induce ER stress and apoptosis in soybean cells [69] In this study, we identified apoptosis-related gene BI-1 as a UPR gene BI-1 is an evolutionarily conserved integral membrane protein localized in the ER [35,36] In mammalian cells, BI-1 affords protection from apoptosis induced by ER stress by inhibiting BAX activation and translocation to mitochondria, by preserving the mitochondrial membrane potential, and by suppressing caspase activation [70] BAX and Bcl2, and their relatives were not found in plants However, in rice and barley, BI-1 has been shown to suppress fungal elicitor-induced apoptosis [71,72] Experimental procedures Plant materials and treatments Sterile seeds of Arabidopsis thaliana (Columbia) were germinated in 0.5· Murashige and Skoog medium [73] containing 1% (w ⁄ v) sucrose (MS), and cultured for two weeks To prepare a cDNA tagged library and probes for transcriptome analysis with fluid microarrays or functional DNA microarrays, whole plantlets were treated by immersing their roots in MS containing lgỈmL)1 TM, mm dithiothreitol or 50 mm AZC for the indicated times For the control experiment, plantlets were treated with MS without stress reagents For relative quantification of mRNA by real-time RT-PCR, and pulse-labeling experiments with [35S]Met and [35S]Cys, the upper parts of plants were cut off from their roots and immersed in MS with a stress reagent Real-time RT-PCR analysis Total RNA was isolated with an RNeasy Plant Mini kit (Qiagen, Valencia, CA) from plant tissues treated with or without TM for h Relative quantification of mRNA was carried out by the real-time RT-PCR method with an ABI PRISM 7000 Sequence Detection System (Applied Biosystems, Foster City, CA) Forward primers, 5¢-AAGTCGT TGCACCTCCTGAGA-3¢, 5¢-TCAAGGACGCTGTTGT CACTGT-3¢, 5¢-ACACGGCAAATAACGTTCATCTCTA3¢, 5¢-GGACTGCTTTCATCTGGCTTGT-3¢, 5¢-TCTCT GTTGGGTTTATCTCTTTGGTT-3¢, 5¢-TGATGGAAGA AGCAGTGGATGA-3¢ and 5¢-CGTAGAAGAGTGGTA FEBS Journal 272 (2005) 34613476 ê 2005 FEBS S Kamauchi et al CAAGCAGATG-3Â, were used for detection of the mRNAs of actin, BiP, P58IPK, BI-1, At HRD1, At SEL-1L or Arabidopsis DER1 (At DER1), respectively Reverse primers, 5¢-ATCGACGGGCCTGACTCAT-3¢, 5¢-CAACATTGAGCCCAGCAATAAC-3¢, 5¢-CAGCTAT TTAAGCCGTCTTTTCCA-3¢, 5¢-GATAGATGCAGAGC CACCAAAGA-3¢, 5¢-CGGACATGAGAGAGCAAAGT CA-3¢, 5¢-CAGCTGCAAATTATGGTGAAG-3¢ and 5¢ACCCGACGGTGGTGACTACA-3¢, were used for detection of the mRNAs of actin, BiP, P58IPK, BI-1, At HRD1, At SEL-1L and At DER1, respectively TaqMan probes (Applied Biosystems), 5¢-VIC-CAG TACCTTCCAGCAGATGTGGATCGC-TAMRA-3¢, 5¢FAM-CCAGCTTACTTACTTCAATGATGCTCAAAGG C-TAMRA-3¢, 5¢-FAM-CTATGCAAGGTCTCAGTCAG GCTCGGC-TAMRA-3¢, 5¢-FAM-ATGCTAATGTGGC TCCAGTTTGCCTCT-TAMRA-3¢, 5¢-FAM-TCCACTCT CTTTTGAGCCATCCAATGC-TAMRA-3¢, 5¢-FAM-AA CGACTTGCTTTTGCTCTTCTCTCGC-TAMRA-3¢ and 5¢-FAM-ATTATAACCCGGTCGTATCTCACGGC-TAM RA-3¢, were used for detection of the mRNAs of actin, BiP, P58IPK, BI-1, At HRD1, At SEL-1L and At DER1, respectively Preparation of fluid microarrays A cDNA tagged library was constructed according to Brenner’s method [74] In brief, mRNA was extracted from plant tissues, except roots, treated with or without TM for h A total of 2.5 lg of mRNA from plants treated with or without TM was combined and converted to cDNA with a 5¢-biotin-conjugated anchored (dT19) primer containing a BsmBI restriction sequence as a primer and a dNTP mixture containing 5-methyl dCTP as a substrate The DNA fragments were digested with DpnII and BsmBI, and then ligated into a tag vector (tag library plasmid) (Takara Bio Co Ltd, Kyoto, Japan) DNA fragments for loading onto antitag microbeads were prepared by PCR using the tagged library as a template and a 6-carboxyl-fluorescein-labeled reverse primer (BD Biosciences Clontech, Palo Alto, CA) The DNA fragments were digested with PacI and then treated with T4 DNA polymerase in the presence of dGTP to expose the tags as single strands The DNA fragments were loaded onto antitag microbeads Microbeads combined with cDNA were selected with a cell sorter, MoFloTM (DacoCytomation, Glostrup, Denmark), and then treated with T4 DNA polymerase and T4 DNA ligase to fill the gap between the cDNA and the tag 6-Carboxyl-fluorescein was removed by DpnII digestion Then the antisense strand of cDNA on the microbeads was labeled by ligation with an adaptor carrying 3¢-6-carboxyl-fluorescein and removed by treatment with 150 mm NaOH The microbeads that carried antisense strands were removed from the microbeads that carried sense strands using the cell sorter FEBS Journal 272 (2005) 3461–3476 ª 2005 FEBS Unfolded protein response genes in Arabidopsis Fluid microarray analysis For analysis of differentially expressed mRNA in Arabidopsis treated with or without TM, fluid microarray analysis was performed Probes for competitive hybridization on the fluid microrrays were prepared from the same mRNA sources as those used for the preparation of the cDNA tagged library In brief, mRNA was converted to cDNA using a flanking oligo dT primer carrying a T7 promoter sequence for first strand synthesis The probes were synthesized from cDNA derived from control or TM-treated plantlets by T7 RNA polymerase reaction in the presence of fluorescein-UTP or Cy5-UTP A mixture of probes was then hybridized with a mixture of · 105 fluid microarray beads prepared from the control or TM-treated plantlets at 50 °C overnight Labeled fluid microarray beads were washed in 1· NaCl ⁄ Cit (0.15 m NaCl, 0.015 m sodium citrate, pH 7) ⁄ 0.1% (w ⁄ v) SDS and 0.1· NaCl ⁄ Cit ⁄ 0.1% (w ⁄ v) SDS at 65 °C for 15 [75] The distribution of microbeads in Fig 1A allowed us to set gates for collecting microbeads that were more heavily labeled with Cy5 or fluorscein (Fig 1B) The polygons in Fig 1B represent the gates at which microbeads carrying up-regulated or down-regulated clones (D) were collected The upregulated clone fraction was further separated at two gates (U1 and U2) to divide the beads fraction into two DNA fragments on the sorted beads were amplified by PCR, subcloned into pT7Blue-2 (Novagen, Darmstadt, Germany), and then sequenced by the Dye Terminator method Sequences of more than 300 nucleotides were adopted as useful data from the sequence data obtained Filtering of sequence data and trimming of the vector sequence were carried out with the Paracel Filtering Package (Paracel, Inc., Pasadena, CA) The obtained sequence was searched for the sequence data in ‘The Arabidopsis Information Resource’ (http://www.arabidopsis.org/index.jsp) Then, clustering of the sequence was performed with the Paracel Clustering Package (Paracel, Inc.) Functional DNA microarray analysis Functional DNA microarrays were prepared by spotting the PCR fragments derived from the genes selected as upor down-regulated genes on fluid microarray analysis The PCR fragments were amplified using the cDNA fragments subcloned into pT7Blue-2 as a template Each fragment was spotted at two sites on a slide glass Target DNA fragments were synthesized by in vitro reverse transcription reaction using Cy3-dUTP or Cy5-dUTP from 1.5 lg of mRNA of control plantlets or plantlets treated with TM, dithiothreitol or AZC for h, h or 17 h The labeled targets were hybridized to a functional DNA microarray in 6· NaCl ⁄ Cit ⁄ 0.2% (w ⁄ v) SDS ⁄ 5· Denhardt’s solution ⁄ carrier DNA at 65 °C for 14 h [75], and then washed in 1.2· NaCl ⁄ Cit ⁄ 0.2% (w ⁄ v) SDS, 2.2· NaCl ⁄ Cit ⁄ 0.2% (w ⁄ v) SDS and then 3.2· NaCl ⁄ Cit ⁄ 0.2% (w ⁄ v) SDS at 3471 Unfolded protein response genes in Arabidopsis 55 °C for The functional DNA microarray was rinsed once with 0.05· NaCl ⁄ Cit The fluorescence was scanned with a GeneChipÒ Scanner 428 (Affymetrix, Inc., Santa Clara, CA) The same experiments were carried out using three functional DNA microarrays The data were analysed using BioDiscovery imagene Ver 4.2 (BioDiscovery, El Segundo, CA) The mean Cy5 : Cy3 ratio values were calculated as the Cy5 value divided by both the correction value and the raw Cy3 value Calculation of the correction value was carried out as described below: (a) Spots were selected according to the following criteria: [signal mean] ) [background mean] more than 60 000, and [signal mean] more than [background mean] + · [background standard deviation (SD)]; (b) Log (Cy5 : Cy3) of the spots selected in (a) was calculated; (c) Mean value I SD of (b) was calculated; (d) Spots were selected according to the following criteria: Log (Cy5 : Cy3) ranged within the mean values I SD obtained in (c); (e) Mean Log (Cy5 : Cy3) of the spots selected in (d) was calculated; (f) Mean Log (Cy5 : Cy3) in (e) was converted to a natural value, which corresponds to the correction value Control experiments (self ⁄ self hybridization) to obtain a spot-specific background Cy5 : Cy3 ratio for judgment of significant differences in the Cy5 : Cy3 ratio were carried out Target DNA fragments were synthesized using Cy3-dUTP or Cy5-dUTP from the mRNA of control plantlets, and then hybridized competitively to a functional DNA microarray under the same conditions as for the comparative experiments Mean control Cy5 : Cy3 ratios and their SD were calculated from the six values obtained in triplicate control experiments on two spots on functional DNA microarray assays Most of the background [Cy5 : Cy3 I SD] values were in the range of 1.2–0.8 Hence, it was judged as a significant difference when the Cy5 : Cy3 ratio was more than 1.2 and also more than [background Cy5 : Cy3 ratio + · SD], or less than 0.8 and also less than [background mean] + · [background standard deviation (SD)] Construction of an expression vector for the putative luminal domain of At SEL-1L The cDNA encoding At SEL-1L was cloned by RT-PCR with a forward primer, 5¢-ACGTCGCTGCAGCGATCT GATCACTGAGAAAC-3¢, and a reverse primer, 5¢-AAA GCCGGTACCCTCTGCTATTACAATGACGAAAACGAT TATC-3¢, using mRNA from Arabidopsis plantlets treated with TM for h The obtained fragments were digested with PstI and KpnI, and then cloned into pBluescript (Stratagene, La Jolla, CA) digested with PstI and KpnI The insert in the vector was sequenced by the fluorescence dideoxy chain termination method (Applied Biosystems) An expression vector for the putative luminal domain of At SEL-1L, which corresponds to residues 21–621, was constructed as described below For cloning into an expression 3472 S Kamauchi et al vector, two kinds of DNA fragments were amplified by PCR with two sets of primers One set comprised a forward primer as the DNA sequence encoding the N-terminus of the luminal domain of At SEL-1L containing an NdeI restriction site, 5¢-ACGTCTGACATATGTTTGGCGT TCACGCTCGTCCC-3¢, and a reverse primer corresponding to the sequence containing a XhoI restriction site in At SEL-1L, 5¢-AAATCTTCATCCTCCTCGCCTCGAG-3¢ The other set comprised a forward primer corresponding to the sequence containing a XhoI restriction site in At SEL1L, 5¢-AAAGGTGCTCTAAGGAAATCTCGAG-3¢, and a reversed primer as the DNA sequence encoding the C-terminus of the luminal domain of At SEL-1L containing a XhoI restriction site, GTGGTGCTCGAGCACCACATT CTCTATCCAAGTCTC-3¢ The former or latter PCR fragments produced were digested with NdeI and XhoI, or XhoI, respectively, and then cloned into pET-30Xa ⁄ LIC digested with NdeI and XhoI Expression vector pET-30 ⁄ At SEL-1L allows the fusion of the histidine tag LEHHHHHH to the C-terminus of a recombinant protein Expression and purification of the recombinant luminal domain of At SEL-1L BL21(DE3) cells were transformed with pET-30/At SEL-1L The expression of the putative luminal domain of At SEL-1L was induced by the addition of 0.4 mm isopropyl thio-b-d-galactoside for h The recombinant protein was produced as inclusion bodies in E coli The cells from L culture broth were collected by centrifugation, disrupted by sonication in 40 mL of 20 mm Tris ⁄ HCl buffer, pH 7.9, containing mm imidazole, 0.5 m NaCl and mm CaCl2 (binding buffer), and then centrifuged at 10 000 g for 30 at °C The pellet was suspended in the binding buffer containing m urea and mm 2-mercaptoethanol (urea-binding buffer) by sonication, and dissolved by adjusting the pH to with m NaOH and then readjusting it to with m HCl A sample was applied to a HisBind quick cartridge (Novagen) equilibrated with the urea-binding buffer After washing the cartridge with the urea-binding buffer, the luminal domain of At SEL-1L was eluted with the urea-binding buffer containing m imidazole, and then concentrated with a Centriprep-10 (Millipore, Billerica, MA) The purified luminal domain of At SEL-1L was used for the preparation of rabbit antiserum The recombinant protein was confirmed to have an initial methionine residue by N-terminal sequencing Analysis of At SEL-1L in Arabidopsis Plantlets treated with TM for the indicated times were frozen in liquid nitrogen and then ground into a fine powder with a micropestle SK-100 (Tokken, Inc., Chiba, Japan) Proteins were extracted from 100 mg of the tissue with FEBS Journal 272 (2005) 3461–3476 ª 2005 FEBS S Kamauchi et al 80 lL of Laemmli’s SDS ⁄ PAGE buffer [76] containing a 1% (v ⁄ v) cocktail of protease inhibitors (Sigma, Inc., St Louı` s, MO) by boiling for For Endo H treatment, 300 mg of plant tissue was ground, suspended in 800 lL of 100 mm tricine ⁄ KOH buffer, pH 7.5, containing 0.5 m sucrose, mm EDTA and a 1% (v ⁄ v) cocktail of protease inhibitors, and then filtered through a cell strainer (BD Biosciences, Bedford, MA) The filtrate was centrifuged at 1000 g for 10 at °C to remove tissue debris The supernatant obtained was centrifuged at 100 000 g for h at °C The pellet was dissolved in 16 lL 0.1 m phosphate buffer, pH 5.5, containing 0.2% (w ⁄ v) SDS and 0.5% (v ⁄ v) 2-mercaptoethanol by boiling for The resulting solution was diluted with four volumes of 0.1 m phosphate buffer and then digested with 15 mU Endo H (Sigma, Inc.) at 37 °C overnight After digestion, proteins were treated with the SDS ⁄ PAGE buffer For cell fraction analysis, the supernatant and pellet fraction obtained on centrifugation at 100 000 g were treated with the SDS ⁄ PAGE buffer Twenty-five micrograms of protein was subjected to SDS ⁄ PAGE and then blotted onto a poly(vinylidene difluoride) membrane The At SEL-1L protein was then immunostained with : 1000diluted anti-At SEL-1L serum and horseradish peroxidaseconjugated rabbit Ig antiserum (Promega, Madison, WI) as secondary antibodies, using Western Lightning Chemiluminescence Reagent (PerkinElmer Life Sciences, Boston, MA) Pulse labeling of proteins For pulse labeling of proteins, plant tissues cut from the roots were treated with or without TM for the indicated times, and then incubated in mL of MS containing 50 lCi (1850 kBq) each of [35S]Met and [35S]Cys (NEN Life Science Products, Inc., Boston, MA) for 20 at 25 °C The labeled plant tissues were rinsed with MS, frozen with liquid nitrogen, and then ground with an electrical homogenizer, S-203, equipped with a spindle (Inouchi-Seieidou Ltd, Osaka, Japan) The disrupted sample was boiled for in SDS ⁄ PAGE buffer containing a 10% (v ⁄ v) cocktail of protease inhibitors Then, 35 lg of protein was subjected to SDS ⁄ PAGE [35S]Met and [35S]Cys in the gel were detected by fluorography with Enlightning (NEN Life Science Products, Inc.) Detection of phosphorylated Ser51 of eIF2a Plant tissues cut off from the roots were treated as described above with or without TM for the indicated times Plant proteins (30 lg of proteins) were separated by SDS ⁄ PAGE and then blotted onto poly(vinylidene difluoride) membranes Phosphorylated Ser51 of eIF2a was immunostained with rabbit eIF2a phospho-specific polyclonal antibodies (Biosource International, Camarillo, CA) FEBS Journal 272 (2005) 3461–3476 ª 2005 FEBS Unfolded protein response genes in Arabidopsis Protein measurement The concentrations of proteins were measured using an RC DC protein assay kit (Bio-Rad Laboratories, Hercules, CA), with c-immunoglobulin as an internal standard Acknowledgements We greatly thank Dr Makoto Kito, Emeritus Professor of Kyoto University, for the critical reading of the manuscript, valuable advice and warm encouragement This study was supported by a Grant for the Program for Promotion of Basic Research Activities for Innovative Biosciences References Cox JS, Shamu CE & Walter P (1993) Transcriptional induction of genes encoding endoplasmic reticulum resident-proteins requires a transmembrane protein kinase Cell 73, 1197–1206 Mori K, Ma W, Gething M-J & Sambrook JF (1993) A transmembrane protein with cdc2+ ⁄ CDC28-related kinase activity is required for signaling from the ER to the nucleus Cell 74, 743–756 Cox JS & Walter P (1996) A novel mechanism for regulating the activity of a transcription factor that controls the unfolded protein response Cell 87, 391–404 Mori K, Kawahara T, Yoshida H, Yanagi H & Yura T (1996) Signalling from the endoplasmic reticulum to the nucleus: transcription factor with a basic-leucine zipper motif is required for the unfolded protein-response pathway Genes Cells 1, 803–817 Nikawa J, Akiyoshi M, Hirata S & Fukuda T (1996) Saccharomyces cerevisiae IRE2 ⁄ HAC1 is involved in IRE1-mediated KAR2 expression Nucleic Acids Res 24, 4222–4226 Kohno K, Normington K, Sambrook J, Gething M-J & Mori K (1993) The promoter region of the yeast KAR2 (BiP) gene contains a regulatory domain that responds to the presence of unfolded proteins in the endoplasmic reticulum Mol Cell Biol 13, 877–890 Mori K, Ogawa N, Kawahara T, Yanagi H & Yura T (1998) Palindrome with a spacer of one nucleotide is characteristic of the cis-acting unfolded protein response element in Saccharomyces cerevisiae J Biol Chem 273, 9912–9920 Mori K, Sant A, Kohno K, Normington K, Gething MJ & Sambrook JF (1992) A 22 bp cis-acting element is necessary and sufficient for the induction of the yeast KAR2 (BiP) gene by unfolded proteins EMBO J 11, 2583–2593 Travers KJ, Patil CK, Wodicka L, Lockhart DJ, Weissman JS & Walter P (2000) Functional and genomic 3473 Unfolded protein response genes in Arabidopsis 10 11 12 13 14 15 16 17 18 19 20 21 analyses reveal essential coordination between the unfolded protein response and ER-associated degradation Cell 101, 249–258 Mori K (2000) Tripartite management of unfolded proteins in the endoplasmic reticulum Cell 101, 451–454 Calfon M, Zeng H, Urano F, Till JH, Hubbard SR, Harding HP, Clark SG & Ron D (2002) IRE1 couples endoplasmic reticulum load to secretory capacity by processing the XBP-1 mRNA Nature 415, 92–96 Tirasophon W, Welihinda AA & Kaufman RJ (1998) A stress response pathway from the endoplasmic reticulum to the nucleus requires a novel bifunctional protein kinase ⁄ endoribonuclease (Ire1p) in mammalian cells Genes Dev 12, 1812–1824 Yoshida H, Matsui T, Yamamoto A, Okada T & Mori K (2001) XBP1 mRNA is induced by ATF6 and spliced by IRE1 in response to ER stress to produce a highly active transcription factor Cell 107, 881–891 Lee AH, Iwakoshi NN & Glimcher LH (2003) XBP-1 regulates a subset of endoplasmic reticulum-resident chaperone genes in the unfolded protein response Mol Cell Biol 23, 7448–7459 Haze K, Yoshida H, Yanagi H, Yura T & Mori K (1999) Mammalian transcription factor ATF6 is synthesized as a transmembrane protein and activated by proteolysis in response to endoplasmic reticulum stress Mol Biol Cell 10, 3787–3799 Okada T, Haze K, Nadanaka S, Yoshida H, Seidah NG, Hirano Y, Sato R, Negishi M & Mori K (2003) A serine protease inhibitor prevents endoplasmic reticulum stressinduced cleavage but not transport of the membranebound transcription factor ATF6 J Biol Chem 278, 31024–31032 ´ Ye J, Rawson RB, Komuro R, Chen X, Dave UP, Prywes R, Brown MS & Goldstein JL (2000) ER stress induces cleavage of membrane-bound ATF6 by the same proteases that process SREBPs Mol Cell 6, 1355–1364 Haze K, Okada T, Yoshida H, Yanagi H, Yura T, Negishi M & Mori K (2001) Identification of the G13 (cAMP-response-element-binding protein-related protein) gene product related to activating transcription factor as a transcriptional activator of the mammalian unfolded protein response Biochem J 355, 19–28 Yoshida H, Okada T, Haze K, Yanagi H, Yura T, Negishi M & Mori K (2000) ATF6 activated by proteolysis binds in the presence of NF-Y (CBF) directly to the cis-acting element responsible for the mammalian unfolded protein response Mol Cell Biol 20, 6755–6767 Harding HP, Zhang Y, Bertolotti A, Zeng H & Ron D (2000) Perk is essential for translational regulation and cell survival during the unfolded protein response Mol Cell 5, 897–904 Harding HP, Zhang Y & Ron D (1999) Protein translation and folding are coupled by an endoplasmic-reticulum-resident kinase Nature 397, 271–274 3474 S Kamauchi et al 22 Harding HP, Zhang Y, Zeng H, Novoa I, Lu PD, Calfon M, Sadri N, Yun C, Popko B, Paules R, Stojdl DF, Bell JC, Hettmann T, Leiden JM & Ron D (2003) An integrated stress response regulates amino acid metabolism and resistance to oxidative stress Mol Cell 11, 619–633 23 Barbosa-Tessmann IP, Chen C, Zhong C, Schuster SM, Nick HS & Kilberg MS (1999) Activation of the unfolded protein response pathway induces human asparagine synthetase gene expression J Biol Chem 274, 31139–31144 24 Bruhat A, Averous J, Carraro V, Zhong C, Reimold AM, Kilberg MS & Fafournoux P (2002) Differences in the molecular mechanisms involved in the transcriptional activation of the CHOP and asparagine synthetase genes in response to amino acid deprivation or activation of the unfolded protein response J Biol Chem 277, 48107– 48114 25 Koizumi N, Martı` nez IM, Kimata Y, Kohno K, Sano H & Chrispeels MJ (2001) Molecular characterization of two Arabidopsis Ire1 homologs, endoplasmic reticulumlocated transmembrane protein kinases Plant Physiol 127, 949–962 26 Okushima Y, Koizumi N, Yamaguchi Y, Kimata Y, Kohno K & Sano H (2002) Isolation and characterization of a putative transducer of endoplasmic reticulum stress in Oryza sativa Plant Cell Physiol 43, 532– 539 27 D’Amico L, Valsasina B, Daminati MG, Fabbrini MS, Nitti G, Bollini R, Ceriotti A & Vitale A (1992) Bean homologs of the mammalian glucose-regulated proteins: induction by tunicamycin and interaction with newly synthesized seed storage proteins in the endoplasmic reticulum Plant J 2, 443–455 28 Fontes EBP, Shank BB, Wrobel RL, Moose SPO, Brian GR, Wurtzel ET & Boston RS (1991) Characterization of an immunoglobulin binding protein homolog in the maize floury-2 endosperm mutant Plant Cell 3, 483–496 29 Koizumi N, Ujino T, Sano H & Chrispeels MJ (1999) Overexpression of a gene that encodes the first enzyme in the biosynthesis of asparagine-linked glycans makes plants resistant to tunicamycin and obviates the tunicamycin-induced unfolded protein response Plant Physiol 121, 353–361 30 Oliver SC, Venis MA, Freedman RB & Napier RM (1995) Regulation of synthesis and turnover of maize auxin-binding protein, and observations on its passage to the plasma membrane: comparisons to maize immunoglobulin-binding protein cognate Planta 197, 465–474 31 Shank KJ, Su P, Brglez I, Boss WF, Dewey RE & Boston RS (2001) Induction of lipid metabolic enzymes during the endoplasmic reticulum stress response in plants Plant Physiol 126, 267–277 FEBS Journal 272 (2005) 3461–3476 ª 2005 FEBS S Kamauchi et al 32 Martı` nez IM & Chrispeels MJ (2003) Genomic analysis of the unfolded protein response in Arabidopsis shows its connection to important cellular processes Plant Cell 15, 561–576 33 Lee AS (1987) Coordinated regulation of a set of genes by glucose and calcium ionophores in mammalian cells Trends Biochem Sci 12, 20–23 34 Bilgin DD, Liu Y, Schiff M & Dinesh-Kumar SP (2003) P58IPK, a plant ortholog of double-stranded RNAdependent protein kinase PKR inhibitor, functions in viral pathogenesis Dev Cell 4, 651–661 35 Bolduc N, Ouellet M, Pitre F & Brisson LF (2003) Molecular characterization of two plant BI-1 homologues which suppress Bax-induced apoptosis in human 293 cells Planta 216, 377–386 36 Kawai-Yamada M, Jin L, Yoshinaga K, Hirata A & Uchimiya H (2001) Mammalian Bax-induced plant cell death can be down-regulated by overexpression of Arabidopsis Bax Inhibitor-1 (AtBI-1) Proc Natl Acad Sci USA 98, 12295–12300 37 Utsugi S, Sakamoto W, Murata M & Motoyoshi F (1998) Arabidopsis thaliana vegetative storage protein (VSP) genes: gene organization and tissue-specific expression Plant Mol Biol 38, 565–576 38 Utsugi S, Sakamoto W, Ogura Y, Murata M & Motoyoshi F (1996) Isolation and characterization of cDNA clones corresponding to the genes expressed preferentially in floral organs of Arabidopsis thaliana Plant Mol Biol 32, 759–765 39 Lee K, Tirasophon W, Shen X, Michalak M, Prywes R, Okada T, Yoshida H, Mori K & Kaufman RJ (2002) IRE1-mediated unconventional mRNA splicing and S2P-mediated ATF6 cleavage merge to regulate XBP1 in signaling the unfolded protein response Genes Dev 16, 452–466 40 Wang Y, Shen J, Arenzana N, Tirasophon W, Kaufman RJ & Prywes R (2000) Activation of ATF6 and an ATF6 DNA binding site by the endoplasmic reticulum stress response J Biol Chem 275, 27013–27020 41 Yoshida H, Haze K, Yanagi H, Yura T & Mori K (1998) Identification of the cis-acting endoplasmic reticulum stress response element responsible for transcriptional induction of mammalian glucose-regulated proteins Involvement of basic leucine zipper transcription factors J Biol Chem 273, 33741–33749 42 Kokame K, Kato H & Miyata T (2001) Identification of ERSE-II, a new cis-acting element responsible for the ATF6-dependent mammalian unfolded protein response J Biol Chem 276, 9199–9205 43 Li M, Baumeister P, Roy B, Phan T, Foti D, Luo S & Lee AS (2000) ATF6 as a transcription activator of the endoplasmic reticulum stress element: thapsigargin stress-induced changes and synergistic interactions with NF-Y and YY1 Mol Cell Biol 20, 5096–5106 FEBS Journal 272 (2005) 3461–3476 ª 2005 FEBS Unfolded protein response genes in Arabidopsis 44 Yoshida H, Okada T, Haze K, Yanagi H, Yura T, Negishi M & Mori K (2001) Endoplasmic reticulum stress-induced formation of transcription factor complex ERSF including NF-Y (CBF), and activating transcription factors 6a and 6b that activates the mammalian unfolded protein response Mol Cell Biol 21, 1239–1248 45 Oh D-H, Kwon C-S, Sano H, Chung W-I & Koizumi N (2003) Conservation between animals and plants of the cis-acting element involved in the unfolded protein response Biochem Biophys Res Commun 301, 225–230 46 Bays NW, Gardner RG, Seelig LP, Joazeiro CA & Hampton RY (2001) Hrd1p ⁄ Der3p is a membraneanchored ubiquitin ligase required for ER-associated degradation Nat Cell Biol 3, 24–29 47 Donoviel DB, Donoviel MS, Fan E, Hadjantonakis A & Bernstein A (1998) Cloning and characterization of Sel-1l, a murine homolog of the C elegans sel-1 gene Mech Dev 78, 203–207 48 Harada Y, Ozaki K, Suzuki M, Fujiwara T, Takahashi E, Nakamura Y & Tanigami A (1999) Complete cDNA sequence and genomic organization of a human pancreas-specific gene homologous to Caenorhabditis elegans Sel-1 J Hum Genet 44, 330–336 49 Nadav E, Shmueli A, Barr H, Gonen H, Ciechanover A & Reiss Y (2003) A novel mammalian endoplasmic reticulum ubiquitin ligase homologous to the yeast Hrd1 Biochem Biophys Res Commun 303, 91–97 50 Lee TG, Tang N, Thompson S, Miller J & Katze MG (1994) The 58,000-dalton cellular inhibitor of the interferon-induced double-stranded RNA-activated protein kinase (PKR) is a member of the tetratricopeptide repeat family of proteins Mol Cell Biol 14, 2331–2342 51 Yan W, Frank CL, Korth MJ, Sopher BL, Novoa I, Ron D & Katze MG (2002) Control of PERK eIF2a kinase activity by the endoplasmic reticulum stressinduced molecular chaperone P58IPK Proc Natl Acad Sci USA 99, 15920–15925 52 Melville MW, Hansen WJ, Freeman BC, Welch WJ & Katze MG (1997) The molecular chaperone hsp40 regulates the activity of P58IPK, the cellular inhibitor of PKR Proc Natl Acad Sci USA 94, 97–102 53 van Huizen R, Martindale JL, Gorospe M & Holbrook NJ (2003) P58IPK, a novel endoplasmic reticulum stressinducible protein and potential negative regulator of eIF2a signaling J Biol Chem 278, 15558–15564 54 Noh S-J, Kwon CS, Oh D-H, Moon JS & Chung W-I (2003) Expression of an evolutionarily distinct novel BiP gene during the unfolded protein response in Arabidopsis thaliana Gene 311, 81–91 55 Mira H, Martı` nez N & Penarrubia L (2002) Expression ˜ of a vegetative-storage-protein gene from Arabidopsis is regulated by copper, senescence and ozone Planta 214, 939–946 3475 Unfolded protein response genes in Arabidopsis 56 Gilbert HF (1998) Protein disulfide isomerase Methods Enzymol 290, 26–50 57 Wetterau JR, Combs KA, Spinner SN & Joiner BJ (1990) Protein disulfide isomerase is a component of the microsomal triglyceride transfer protein complex J Biol Chem 265, 9800–9807 58 Tasanen K, Parkkonen T, Chow LT, Kivirikko KI & Pihlajaniemi T (1988) Characterization of the human gene for a polypeptide that acts both as the b subunit of prolyl 4-hydroxylase and as protein disulfide isomerase J Biol Chem 263, 16218–16224 59 Oliver JD, van der Wal FJ, Bulleid NJ & High S (1997) Interaction of the thiol-dependent reductase ERp57 with nascent glycoproteins Science 275, 86–88 60 Urade R, Okudo H, Kato H, Moriyama T & Arakaki Y (2004) ER-60 domains responsible for interaction with calnexin and calreticulin Biochemistry 43, 8858–8868 61 Zapun A, Darby NJ, Tessier DC, Michalak M, Bergeron JJ & Thomas DY (1998) Enhanced catalysis of ribonuclease B folding by the interaction of calnexin or calreticulin with ERp57 J Biol Chem 273, 6009–6012 62 Romano PG, Horton P & Gray JE (2004) The Arabidopsis cyclophilin gene family Plant Physiol 134, 1268– 1282 63 Pilon M, Schekman R & Romisch K (1997) Sec61p ă mediates export of a misfolded secretory protein from the endoplasmic reticulum to the cytosol for degradation EMBO J 16, 4540–4548 64 Brandizzi F, Hanton S, DaSilva LL, Boevink P, Evans D, Oparka K, Denecke J & Hawes C (2003) ER quality control can lead to retrograde transport from the ER lumen to the cytosol and the nucleoplasm in plants Plant J 34, 269–281 65 Knop M, Finger A, Braun T, Hellmuth K & Wolf DH (1996) Der1, a novel protein specifically required for endoplasmic reticulum degradation in yeast EMBO J 15, 753–763 66 Gardner RG, Swarbrick GM, Bays NW, Cronin SR, Wilhovsky S, Seelig L, Kim C & Hampton RY (2000) Endoplasmic reticulum degradation requires lumen to cytosol signaling: Transmembrane control of Hrd1p by Hrd3p J Cell Biol 151, 69–82 67 Hinnebusch AG (2000) Mechanism and regulation of initiator methionyl-tRNA binding to ribosomes In Translational Control of Gene Expression (Sonenberg N Hershey JWB & Mathews M, eds), pp 185–244 Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY 3476 S Kamauchi et al 68 Vattem KM & Wek RC (2004) Reinitiation involving upstream ORFs regulates ATF4 mRNA translation in mammalian cells Proc Natl Acad Sci USA 101, 11269– 11274 69 Zuppini A, Navazio L & Mariani P (2004) Endoplasmic reticulum stress-induced programmed cell death in soybean cells J Cell Sci 117, 2591–2598 70 Chae H-J, Kim H-R, Xu C, Bailly-Maitre B, Krajewska M, Krajewski S, Banares S, Cui J, Digicaylioglu M, Ke N et al (2004) BI-1 regulates an apoptosis pathway linked to endoplasmic reticulum stress Mol Cell 15, 355–366 71 Huckelhoven R, Dechert C & Kogel K-H (2003) Overă expression of barley BAX inhibitor induces breakdown of mlo-mediated penetration resistance to Blumeria graminis Proc Natl Acad Sci USA 100, 5555– 5560 72 Matsumura H, Nirasawa S, Kiba A, Urasaki N, Saitoh H, Ito M, Kawai-Yamada M, Uchimiya H & Terauchi R (2003) Overexpression of Bax inhibitor suppresses the fungal elicitor-induced cell death in rice (Oryza sativa l) cells Plant J 33, 425–434 73 Murashige T & Skoog F (1962) A revised medium for rapid growth and bioassays with tobacco tissue cultures Physiol Plant 15, 473–497 74 Brenner S, Williams SR, Vermaas EH, Storck T, Moon K, McCollum C, Mao J-I, Luo S, Kirchner JJ, Eletr S et al (2000) In vitro cloning of complex mixtures of DNA on microbeads: physical separation of differentially expressed cDNAs Proc Natl Acad Sci USA 97, 1665–1670 75 Sambrook J & Russell D (2001) Molecular Cloning: a Laboratory Manual, 3rd edn Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY 76 Laemmli UK (1970) Cleavage of structural proteins during the assembly of the head of bacteriophage T4 Nature 227, 680–685 Supplementary material The following supplementary material for this article is available online: Table S1 Up-regulated genes selected for functional DNA microarray analysis Table S2 List of singlet genes identified on fluid microarray analysis FEBS Journal 272 (2005) 3461–3476 ª 2005 FEBS ... protein response genes in Arabidopsis vesicle trafficking ⁄ transport, vacuolar protein sorting, cell wall biogenesis, and lipid ⁄ inositol metabolism In comparison with those of yeast, the UPR genes... analysis In addition to the genes related to protein folding and degradation, genes related to protein translation and apoptosis are also included in the list Results Fluid microarray analysis of gene. .. containing the P region of calreticulin, which is a model of a misfolded 3469 Unfolded protein response genes in Arabidopsis protein in the ER, was shown to be retrotranslocated to the cytosol,