Reconstruction of de novo pathway for synthesis of UDP-glucuronic acid and UDP-xylose from intrinsic UDP-glucose in Saccharomyces cerevisiae Takuji Oka and Yoshifumi Jigami Research Center for Glycoscience, National Institute of Advanced Industrial Science and Technology (AIST), Tsukuba, Japan Keywords Saccharomyces cerevisiae; UDP-glucuronic acid; UDP-glucuronic acid decarboxylase; UDP-glucose dehydrogenase; UDP-xylose Correspondence Y Jigami, Research Center for Glycoscience, National Institute of Advanced Industrial Science and Technology (AIST), AIST Tsukuba Central 6, Higashi 1-1, Tsukuba 305-8566, Japan Fax: +81 29 861 6161 Tel: +81 29 861 6160 E-mail: jigami.yoshi@aist.go.jp (Received 27 February 2006, revised April 2006, accepted 12 April 2006) doi:10.1111/j.1742-4658.2006.05281.x UDP-d-glucuronic acid and UDP-d-xylose are required for the biosynthesis of glycosaminoglycan in mammals and of cell wall polysaccharides in plants Given the importance of these glycans to some organisms, the development of a system for production of UDP-d-glucuronic acid and UDP-d-xylose from a common precursor could prove useful for a number of applications The budding yeast Saccharomyces cerevisiae lacks an endogenous ability to synthesize or consume UDP-d-glucuronic acid and UDP-d-xylose However, yeast have a large cytoplasmic pool of UDP-dglucose that could be used to synthesize cell wall b-glucan, as a precursor of UDP-d-glucuronic acid and UDP-d-xylose Thus, if a mechanism for converting the precursors into the end-products can be identified, yeast may be harnessed as a system for production of glycans Here we report a novel S cerevisiae strain that coexpresses the Arabidopsis thaliana genes UGD1 and UXS3, which encode a UDP-glucose dehydrogenase (AtUGD1) and a UDP-glucuronic acid decarboxylase (AtUXS3), respectively, which are required for the conversion of UDP-d-glucose to UDP-d-xylose in plants The recombinant yeast strain was capable of converting UDP-d-glucose to UDP-d-glucuronic acid, and UDP-d-glucuronic acid to UDP-d-xylose, in the cytoplasm, demonstrating the usefulness of this yeast system for the synthesis of glycans Furthermore, we observed that overexpression of AtUGD1 caused a reduction in the UDP-d-glucose pool, whereas coexpression of AtUXS3 and AtUGD1 did not result in reduction of the UDP-dglucose pool Enzymatic analysis of the purified hexamer His-AtUGD1 revealed that AtUGD1 activity is strongly inhibited by UDP-d-xylose, suggesting that AtUGD1 maintains intracellular levels of UDP-d-glucose in cooperation with AtUXS3 via the inhibition of AtUGD1 by UDP-d-xylose The d-glucuronic acid and d-xylose monosaccharides are critically important for plants, fungi, vertebrates and mammals [1–4] In plants, d-xylose is mainly present in the form of cell wall polysaccharides and N-glycan [5] In mammals, d-xylose is involved in linking proteoglycans to proteins, and d-glucuronic acid is involved in the elongation of various types of glycosaminoglycans [6] Some of the O-linked glycans, including the Xyl-a1,3-Xyl-a1,3-Glc-b1-O-Ser chain, have also been identified as d-xylose-containing oligosaccharides in bovine factor IX [7] Glycosyltransferases make use of UDP-d-glucuronic acid (UDP-GlcA) and UDP-d-xylose (UDP-Xyl) in the synthesis of cell wall polysaccharides and for attachment Abbreviations AtXT1, xylosyltransferase 1; GDP-Fuc, GDP-L-fucose; GDP-Man, GDP-D-mannose; TEAA, triethylamine acetate; UDP-Glc, UDP-D-glucose; UDP-GlcA, UDP-D-glucuronic acid; UDP-Xyl, UDP-D-xylose; UGD, UDP-glucose dehydrogenase; UXS, UDP-xylose synthase FEBS Journal 273 (2006) 2645–2657 ª 2006 The Authors Journal compilation ª 2006 FEBS 2645 Synthesis of UDP-glucuronic acid and UDP-xylose T Oka and Y Jigami of oligosaccharides to proteins in a variety of organisms For example, O-xylosyltransferase I can transfer d-xylose to proteoglycan core proteins in humans, and b1,2-xylosyltransferase can transfer d-xylose via a b1,2linkage to the b-linked mannose of N-linked oligosaccharides in plants [5,8] It has also been reported that in plants, xylosyltransferase (AtXT1) is involved in cell wall a1,6-xyloglucan biosynthesis [9] In higher eukaryotes, UDP-Xyl is synthesized from UDP-d-glucose (UDP-Glc) by two enzymes These are UDP-glucose dehydrogenase (UGD, EC 1.1.1.22), which catalyzes formation of UDP-GlcA from UDPGlc by a concomitant reduction of two molecules of NAD+ to NADH, and UDP-glucuronic acid decarboxylase (UDP-xylose synthase; UXS, EC 4.1.1.35), which catalyzes the formation of UDP-Xyl from UDPGlcA via decarboxylation of the C6-carboxylic acid component of glucuronic acid (Fig 1) Moreover, UDP-GlcA can also be generated by oxidation of myoinositol in plants; however, the biological significance and quantitative contribution of this pathway are not yet clear (Fig 1) [10] UGD is a key enzyme in the biosynthesis of UDPGlcA, and the genes that encode UGDs have been cloned and characterized from bacteria, fungi, plants and mammals [11–14] It has been reported that during developmental stages, UGD is highly expressed in leaves and roots but not in the stems of Arabidopsis thaliana [13,15] Furthermore, UGD activity is strongly inhibited by UDP-Xyl [13,16], suggesting that feedback inhibition may regulate conversion of various UDPsugars in plants (Fig 1) The genes encoding UXSs that irreversibly convert UDP-GlcA to UDP-Xyl have also been identified in fungi, in mammals and in plants, including A thaliana [2,4,17,18] In fact, six different UXS isoforms have been identified in A thaliana and they can be classified into two types AtUXS1 and AtUXS2 are type II membrane proteins localized to the Golgi AtUXS3 lacks an N-terminal transmembrane region and is a soluble protein localized to the cytoplasm [17,18] In mammalian cells, only the membrane-type UXS enzyme has been identified [4] The reason for the existence of multiple UXS isoforms in plants is unclear, and the functional differences between the membrane-bound and soluble UXSs is also not known In plants, UDP-GlcA is converted into UDP-d-apiose, UDP-d-galacturonic acid, UDP-Xyl and UDPl-arabinose, which are substrates for many cell wall carbohydrates, including hemicellulose and pectin (Fig 1) UDP-sugars make up approximately 40–50% of the wall polysaccharide mass However, the yeast cell wall consists mostly of b-glucan, a-mannan and chitin, and there are no synthetic or breakdown pathways for UDP-GlcA and UDP-Xyl In the budding yeast Saccharomyces cerevisiae, UDP-Glc, which is a substrate of b1,3-glucan synthase and b1,6-glucan synthase in the synthesis of cell wall b-glucan polysaccharides, is abundant in the cytoplasm [19–21] Therefore, yeast appears to have the potential to produce large amounts of UDP-GlcA and UDP-Xyl in the cytoplasm Recently, two groups, including our own, reported the synthesis of GDP-l-fucose (GDP-Fuc) from inherent cytoplasmic GDP-d-mannose (GDP-Man) by expressing either Escherichia coli- or A thalianaderived GDP-mannose-4,6-dehydratase and GDP4-keto-6-deoxymannose-3,5-epimerase-4-reductase in UDP-D-glucose (UDP-Glc) NAD UDP-glucose dehydrogenase (UGD) NADH myoinositol D-glucuronic + acid D-glucuronic acid-1-P UDP-D-glucuronic acid UDP-D-glacturonic acid (UDP-GlcA) UDP-D-apiose UDP-glucuronic acid decarboxylase (UXS) CO UDP-D-xylose UDP-L-arabinose (UDP-Xyl) Cell wall synthesis (hemicellulose, pectin etc.) 2646 Fig Schematic representation of the plant biosynthetic pathway for production of UDP-sugars UDP-xylose is produced by UDP-glucose dehydrogenase (UGD) and UDP-xylose synthase (UXS) activity via UDPglucuronic acid from UDP-glucose The various UDP-sugars are generated from substrates by UDP-sugar-converting enzymes The UDP-sugars produced are then used in cell wall synthesis An alternative route for the production of UDP-glucuronic acid via myoinositol has also been identified and characterized FEBS Journal 273 (2006) 2645–2657 ª 2006 The Authors Journal compilation ª 2006 FEBS T Oka and Y Jigami A We next examined the activity of the hybrid enzymes from cytoplasmic fractions of the recombinant TOY1 AtUXS3 (40 kDa) B W303a TOY1 UDP-Glc UDP-Glc UDP-GlcA Cloning and expression of AtUGD1 and AtUXS3 genes in yeast In vitro activities of UGD and UXS AtUGD1 Results 10 11 12 13 14 10 11 12 13 14 Time (min) C W303a TOY2 A260 In order to generate yeast strains capable of producing large amounts of the nucleotide sugars, we first cloned and expressed UDP-Xyl synthetic genes in yeast The AtUGD1 gene, which encodes UGD, and the AtUXS3 gene, which encodes UXS, were amplified by PCR from an A thaliana cDNA library Next, we placed the AtUGD1 and AtUXS3 genes under the control of the S cerevisiae constitutive TDH3 promoter (plasmid vectors pRS305-UGD1-VSV-G and pRS304-UXS3-c-Myc, respectively) AtUGD1 was N-terminally tagged with VSV-G and AtUXS3 was C-terminally tagged with c-Myc The constructs were integrated into the leu2 locus of chromosome III of S cerevisiae strain W303a to yield the strain TOY1, and into the trp1 locus of chromosome IV of S cerevisiae strain W303a to yield the strain TOY2 The strain TOY3 coexpresses AtUGD1 and AtUXS3 This strain was constructed by introducing the linearized fragments of both pRS305-UGD1-VSV-G and pRS304-UXS3-c-Myc into the S cerevisiae strain W303a To confirm protein expression, cytoplasmic fractions were prepared as described in Experimental procedures, and protein production was analyzed with antibodies to epitope tag The AtUGD1 fusion construct resulted in production of a protein of approximately 54 kDa in the TOY1 and TOY3 strains, whereas the protein encoded by AtUXS3 was detected as a 40-kDa band within the TOY2 and TOY3 strains (Fig 2A) (54 kDa) A260 S cerevisiae [22,23] Despite the biological importance of UDP-Xyl, there is currently no affordable system for production of large amounts of this nucleotide sugar Thus, we worked to develop a similar system for in vivo production of UDP-Xyl by introducing UDP-Xyl synthetic genes into yeast cells Our system facilitates efficient production of UDP-GlcA and UDP-Xyl via conversion of a large precursor pool of UDP-Glc into the derivative molecules Here, we report the generation of yeast strains capable of producing large amounts of the nucleotide sugars, and also discuss the implications of our results in yeast for the study of metabolic regulation in plants Synthesis of UDP-glucuronic acid and UDP-xylose UDP-Xyl UDP-GlcA UDP-GlcA 10 11 12 13 14 10 11 12 13 14 Time (min) Fig Expression of functional AtUGD1 and AtUXS3 in yeast (A) Immunoblotting analyses of AtUGD1 and AtUXS3 The presence of the AtUGD1 enzyme was detected with VSV-G antibody A 54-kDa protein band was observed in the TOY1 and TOY3 strains (left panel) The AtUXS3 enzyme was detectable as a 40-kDa band with a c-Myc antibody in the TOY2 and TOY3 strains (right panel) Lane 1, Control W303a strain; lane 2, TOY1 strain; lane 3, TOY2 strain; lane 4, TOY3 strain (B) In vitro activities of UDP-glucose dehydrogenase (C) In vitro activities of UDP-glucuronic acid decarboxylase Enzyme activities were assayed as described in Experimental procedures Reaction samples were analyzed by HPLC using a reverse-phase column (cosmosil 5C18-AR-II) The retention times of UDP-D-glucose (UDP-Glc), UDP-D-xylose (UDP-Xyl) and UDP-Dglucuronic acid (UDP-GlcA) were 7.4 min, 7.8 and 11.8 min, respectively, under identical assay conditions cells UDP-GlcA synthetic activity was assayed by providing UDP-Glc as substrate and NAD+ as a cofactor The cytoplasmic fraction of control W303a cells showed no conversion of UDP-Glc to UDP-GlcA However, a cytoplasmic fraction from TOY1 cells showed a clear UDP-GlcA peak, indicating that the cells express an AtUGD1 gene product that is functional in vitro (Fig 2B) FEBS Journal 273 (2006) 2645–2657 ª 2006 The Authors Journal compilation ª 2006 FEBS 2647 Synthesis of UDP-glucuronic acid and UDP-xylose T Oka and Y Jigami Similarly, we assayed UDP-Xyl synthesis by providing UDP-GlcA as substrate and NAD+ as cofactor The cytoplasmic fraction from control W303a cells showed no peak of UDP-Xyl, whereas that from TOY2 cells, which express the AtUXS3 gene, showed a prominent peak of UDP-Xyl, clearly indicating that functional AtUXS3 can also be expressed in yeast (Fig 2C) In vivo production of UDP-GlcA and UDP-Xyl in yeast To find whether the expression of AtUGD1 or AtUXS3 altered the intracellular levels of UDP-Glc, UDP-GlcA and UDP-Xyl, we first analyzed the nucleotide sugars present in W303a, TOY1 and TOY3 cells by ESI-MS Cells were grown in YPAD medium [1% Bacto-yeast extract, 1% Bacto-pepton, 0.003% adenine sulfate, 2% dextrose (glucose)] at 30 °C for 24 h and harvested by centrifugation Next, formic acid saturated with 1-butanol was added to the cell pellets on ice, and sugarnucleotides were extracted from the cytoplasm (see Experimental procedures) Finally, the extracts were separated by C18 chromatography, and UDP-Glc, UDP-GlcA and UDP-Xyl fractions were collected based on the retention times with the standards The purified UDP-sugar fractions were analyzed by ESI-MS Our expectation was that the TOY1 cells would produce UDP-GlcA but be unable to convert it to UDPXyl Consistent with this, both UDP-Glc (m ⁄ z: 564.6) and UDP-GlcA (m ⁄ z: 578.6) were detected in TOY1 cells (Fig 3A) As TOY3 carries both enzymes, we expected that not only UDP-Glc but also UDP-GlcA and UDP-Xyl would be present in these cells As expected, both UDP-Glc (m ⁄ z: 564.6) and UDP-Xyl (m ⁄ z: 534.6) were detected (Fig 3A) However, UDP-GlcA was not detected in the cytoplasm of the TOY3 strain This suggests that there was a complete conversion of the UDP-GlcA intermediate generated by AtUGD1 activity to UDP-Xyl as a final product by AtUXS3 activity To confirm the complete conversion of UDPGlcA to UDP-Xyl, we performed ESI-MS analyses on cytoplasmic fractions of W303a, TOY1 and TOY3 cells The assay revealed that UDP-GlcA was present only in the cells of strain TOY1, whereas UDP-Xyl was only present in the cells of strain TOY3, consistent with the idea that the TOY1 and TOY3 cells are useful for production of UDP-GlcA and UDP-Xyl, respectively In order to quantify the levels of UDP-sugars in the various yeast cell strains that we constructed, purified UDP-sugar fractions were analyzed by C30 chromatography UDP-Glc was detected in all strains, and a reduction in the relative levels of UDP-Glc was 2648 observed in TOY1 cells (Fig 3B and Table 1) Moreover, UDP-GlcA accumulated in TOY1 cells at a level of 5.71 lmolỈg)1 (dry weight) and was not detected in TOY3 cells (Fig 3B and Table 1) The results indicated that TOY1 could produce approximately 3.3 mg of UDP-Glcg)1 (dry weight) As expected, UDP-Xyl accumulated in the cytoplasm of TOY3 cells, in which both the AtUGD1 and AtUXS3 expression vectors were integrated into the yeast chromosome UDP-Xyl was expressed at a level of 1.69 lmolỈg)1 (dry weight) (Fig 3B and Table 1) The results indicated that TOY3 could produce approximately 0.9 mg of UDPXylỈg)1 (dry weight) These observations are in good agreement with what was observed by ESI-MS (Fig 3A) AtUGD1 acts as a hexamer It has been reported that mammalian UGD is active as a hexamer (more specifically, as a trimer of dimers) [14,24], whereas the UGDs from the virulent bacterial strain Streptococcus pyogenes and the pathogenic yeast strain Cryptococcus neoformans form dimers [25,26] For plants, however, the active complex for UGD has not previously been defined To determine the oligomeric state of AtUGD1, we purified recombinant AtUGD1 protein from yeast To this, we constructed the TOY4 strain, which harbors an expression plasmid that should produce a · His-tagged form of AtUGD1 Next, AtUGD1 was purified by FPLC from a crude enzyme fraction A single polypeptide of approximately 54 kDa was visualized in the final preparation following SDS ⁄ PAGE (Fig 4A) The molecular mass of the purified AtUGD1 was determined by HPLC analysis The purified recombinant AtUGD1 was eluted as a peak at a time of 26.9 from the gel filtration column (peak A) The inset panel shows molecular mass determination for the peaks with gel filtration standards On the basis of the elution of the molecular mass markers, this peak corresponds to a molecular mass of approximately 328 kDa (Fig 4B) Based on the predicted monomer molecular mass of 53 925 Da, this indicates that AtUGD1 is a hexamer protein Since no peaks of monomer AtUGD1 were detected in the purified recombinant AtUGD1 fraction, the hexamer structure of AtUGD1 is necessary to form an active enzyme AtUGD1 is involved in the maintenance of the cytoplasmic pool of UDP-Glc in vivo The quantitative analysis of UDP-sugars reveals that the amount of UDP-Glc in the TOY1 strain was FEBS Journal 273 (2006) 2645–2657 ª 2006 The Authors Journal compilation ª 2006 FEBS T Oka and Y Jigami Synthesis of UDP-glucuronic acid and UDP-xylose intensity A260 B A UDP-Glc 564.6 UDP-Glc W303a W303a UDP-GlcA 578.6 TOY1 UDP-GlcA TOY1 UDP-Glc 564.6 UDP-Glc UDP-Glc 564.6 UDP-Glc TOY3 UDP-Xyl TOY3 UDP-Xyl 534.6 500 510 520 530 540 550 560 570 580 590 600 (m/z) 10 15 20 25 Time (min) Fig In vivo activities of UDP-glucose dehydrogenase and UDP-glucuronic acid decarboxylase (A) ESI-MS analysis of UDP-sugars in yeast Nucleotide sugars were extracted as described in Experimental procedures Ten A600 nm cells of UDPS-C18 fractions from W303a, TOY1 and TOY3 cells were analyzed by ESI-MS The mass spectra are shown for the control strain W303a (upper panel), TOY1 (middle panel), and TOY3 (bottom panel) The mass units for UDP-D-xylose (UDP-Xyl), UDP-D-glucose (UDP-Glc) and UDP-D-glucuronic acid (UDP-GlcA) are observable at 534.6, 564.6, and 578.6, respectively (B) Production of UDP-GlcA and UDP-Xyl in vivo UDP-sugars were extracted as described in Experimental procedures The UDPS-C30 fractions from W303a, TOY1, TOY2 and TOY3 cells were separated and detected by HPLC The column was equilibrated with 20 mM triethylamine acetate (TEAA) buffer (pH 7.0) at a flow rate of 0.7 mLỈmin)1 UDP-sugars were detected by UV260 nm absorbance The retention times of UDP-Glc, UDP-Xyl and UDP-GlcA were 13.4 min, 14.6 and 20.3 min, respectively, under identical assay conditions Experiments were performed in triplicate reduced to approximately 54% relative to that in W303a strain (Fig 3B and Table 1) In contrast, in the TOY3 strain, the amount of UDP-Glc was comparable to that in the W303a strain To gain a better understanding of how the amount of UDP-sugars was regulated in the cells, we analyzed several properties of the recombinant AtUGD1 The substrate saturation kinetics of AtUGD1 was determined by HPLC in which the concentration of UDP-Glc was between 15 and 100 lm, and the apparent Km value was determined to be 15.3 lm (data not shown) We also measured the inhibition constant (Ki) of AtUGD1 Inhibition by UDP-GlcA and UDP-Xyl was measured with various concentrations of UDP-Glc and saturating levels of NAD+ Double-reciprocal plots of the data revealed a pattern consistent with competitive inhibition when UDP-Glc was the varying substrate (Fig 5A,B; left panels) This kinetic pattern is entirely FEBS Journal 273 (2006) 2645–2657 ª 2006 The Authors Journal compilation ª 2006 FEBS 2649 Synthesis of UDP-glucuronic acid and UDP-xylose T Oka and Y Jigami UDP-Xyl strongly inhibited AtUGD1 activity, and then the UDP-Glc pool of TOY3 cells recovered to a level comparable to that in W303a cells This result indicates that AtUGD1 maintains the pool of UDPGlc of the cell in cooperation with AtUXS3 via inhibition of UDP-Xyl by AtUGD1 in vivo Table Quantification of UDP-sugar levels in yeast The amounts of UDP-glucose, UDP-glucuronic acid and UDP-xylose were calculated from peak areas shown in Fig 3B The amounts of sugar-nucleotides are expressed as the amounts of UDP-glucose equivalent, obtained in the triplicate experiments ND, not determined Strain UDP-glucose (lmolỈg)1 dry weight) UDP-glucuronic acid (lmolỈg)1 dry weight) UDP-xylose (lmolỈg)1 dry weight) W303a TOY1 TOY3 2.21 ± 0.28 1.20 ± 0.23 2.53 ± 0.11 ND 5.71 ± 1.06 ND ND ND 1.69 ± 0.40 Discussion Bioinformatic analysis of several genome sequences has revealed the presence of many glycosyltransferaselike genes in the genomes of diverse species, including the plant A thaliana [27] In order to study these glycosyltransferase-like genes, it would be advantageous to have access to a ready supply of sugar nucleotide substrates to be used in functional analyses However, UDP-GlcA and UDP-Xyl have until now been precious materials It has been difficult to produce UDPGlcA and UDP-Xyl in plants or bacteria, because UDP-GlcA or UDP-Xyl synthesized in those organisms are further converted to the other UDP-sugars or used in the synthesis of oligosaccharides and polysaccharides of the cell wall In S cerevisiae, however, d-glucuronic acid and d-xylose are not components of the cell wall and are not attached to proteins, which gives every indication that the yeast S cerevisiae lacks consumptive pathways for UDP-GlcA and UDP-Xyl consistent with both UDP-GlcA and UDP-Xyl being competitive inhibitors for UDP-Glc binding The Ki parameters 99 lm and 4.9 lm were calculated from a replot of the slopes versus UDP-GlcA and UDP-Xyl concentrations, respectively (Fig 5A,B; right panels) The results suggest that feedback inhibition occurs when there is a low concentration of UDP-Xyl relative to UDP-GlcA This suggested that the UDP-GlcA generated in the cells could not strongly inhibit the AtUGD1 activity in TOY1 cells, resulting in a 54% reduction of the UDP-Glc pool in the TOY1 cells relative to the amount of UDP-Glc pool in W303a control cells In the TOY3 strain, AtUXS3 activity concomitantly converted UDP-GlcA to UDP-Xyl (kDa) (Kav) B A220 A 1.400 peak A 1.200 1.000 250 A 0.800 150 0.600 100 0.400 75 50 0.200 0.000 0.0 His-AtUGD1 200.0 400.0 600.0 800.0 (kDa) (54 kDa) 37 25 20 15 10 15 20 25 30 35 Time (min) Fig Analysis of · His-tagged AtUGD1 protein (A) Expression and purification of recombinant · His-tagged AtUGD1 protein The AtUGD1 cDNA was expressed under the TDH3 promoter in W303a cells The proteins extracted from the recombinant yeast cells were separated by 4–20% SDS ⁄ PAGE, and the gel was stained with Coomassie Brilliant Blue Lane 2, crude protein fraction; lane 3, purified protein fraction (54 kDa shown by His-AtUGD1); lanes and 4, protein molecular mass markers (B) Oligomeric form analysis of the · His-tagged AtUGD1 protein Purified · His-tagged AtUGD1 protein was fractionated by gel filtration HPLC at a flow rate of 0.20 mLỈmin)1 A single AtUGD1 peak was detected (peak A) The molecular mass of the oligomeric form was estimated by comparison with molecular mass standards Average retention time in the column was plotted versus the log of the molecular weight for each standard (inset panel) Standards used were as follows: thyroglobulin, 669 kDa; ferritin, 440 kDa; catalase, 232 kDa; ovalbumin, 43 kDa 2650 FEBS Journal 273 (2006) 2645–2657 ª 2006 The Authors Journal compilation ª 2006 FEBS T Oka and Y Jigami Synthesis of UDP-glucuronic acid and UDP-xylose µM UDP-Xyl UDP-Xyl 2.5 µM UDP-Xyl 7.5 µM UDP-Xyl 17.5 µM 50 40 30 20 10 -0.050 0.05 0.1 0.15 (Slope (v -1 vs UDP-Glc-1) 1/UGD activity -1 (µM [UDP-Glc]/min) A 500 400 300 200 100 -100 1/[UDP-Glc] (µM) -1 10 20 30 [UDP-Xyl] (µM) UDP-GlcA µM UDP-GlcA 100 µM UDP-GlcA 200 µM UDP-GlcA 300 µM 100 80 60 40 20 -0.050 0.05 0.1 1/[UDP-Glc] (µM) -1 Thus, we reasoned that yeast could be used to make and provide a ready source of high-quality UDPsugars via introduction of exogenous genes that produce the modified sugars from substrates that are present in yeast To test this hypothesis, we expressed the AtUGD1 and AtUXS3 genes, which encode UGD and UXS of A thaliana, with the hope of producing UDP-GlcA and UDP-Xyl in yeast We found that introduction of the transgenes resulted in detectable converting activity that changed UDP-Glc to UDP-Xyl via UDP-GlcA The enzymatic activity could be observed both in vivo and in vitro in cells (or cell extracts) that express both transgenes Our results provide strong evidence that recombinant AtUGD1 is efficiently expressed and enzymatically active in S cerevisiae (Figs 2A and 3A) Previously, Tenhaken and Thulke reported that a recombinant soybean UGD that has significant amino acid identity to AtUGD1 was expressed in an inactive form in E coli [13] In addition, Laurence et al have reported that two orthologs of AtUGD1 from tobacco 0.15 (Slope (v -1 vs UDP-Glc-1) Fig Inhibition of recombinant AtUGD1 protein (A) Inhibition kinetics on UDP-Dxylose (UDP-Xyl) using UDP-D-glucose (UDPGlc) as the variable substrate (B) Inhibition kinetics on UDP-D-glucuronic acid (UDPGlcA) using UDP-Glc as the variable substrate UDP-glucose dehydrogenase (10.8 · 10)6 Unit) was assayed at 25 °C and at pH 8.4 for 40 One unit of enzyme activity is defined as the amount of enzyme that resulted in production of lmol UDPGlcmin)1 at 25 °C For each substrate, reactions were performed in duplicate 1/UGD activity -1 (µM [UDP-Glc]/min) B 0 -100 700 600 500 400 300 200 100 -200 -100 0 100 200 300 400 -100 [UDP-GlcA] (µM) can be expressed in an inactive form in E coli [28] Hinterberg et al reported that the heterologous expression of soybean UGD was successful only under a narrow range of conditions using an E coli expression system, and, moreover, the recombinant protein was somewhat unstable [29] These studies suggested that the E coli expression system is not appropriate for expression of active UGD-converting enzymes It is known that eukaryotic proteins expressed in E coli often form protein inclusion bodies, due to a difference in the protein-folding system between prokaryotes and eukaryotes As, like A thaliana, the yeast S cerevisiae is eukaryotic, it is perhaps not surprising that AtUGD1 was successfully expressed in yeast and that the recombinant protein was stable and active However, one cannot exclude the possibility that expression levels of protein are dependent on codon usage of the host For example, arginine codons (AGA, 18.9%; AGG, 10.9%) are used at a high frequency in A thaliana, but both codons are rarely used in E coli (AGA, 2.1%; FEBS Journal 273 (2006) 2645–2657 ª 2006 The Authors Journal compilation ª 2006 FEBS 2651 Synthesis of UDP-glucuronic acid and UDP-xylose T Oka and Y Jigami AGG, 1.2%) It has been suggested that differences in codon usage could account for limited or poor protein expression in E coli In contrast to what is true for bacteria, codon usage in S cerevisiae (AGA, 21.3%; AGG, 9.3%) is similar to that in A thaliana [30] Therefore, expression in the yeast S cerevisiae has the potential to be a better system for the characterization of many plant genes for which researchers not know and ⁄ or have not yet been able to test the biochemical function of their gene products In this work, molecular mass determination revealed that AtUGD1 acts as a hexamer Previously, a recombinant UGD1 from soybean expressed in E coli was reported to act as monomer [29] However, as the recombinant protein in E coli was somewhat unstable, it seems plausible that the exogenous protein was misfolded in bacteria, thus clouding interpretation of the experimental result A hexameric structure has been observed for the native soybean UGD in gel filtration studies [31] We confirmed the results of the above studies In this work, in no case did we observe any data consistent with a monomer Instead, the most probable interpretation of the results presented here is that the AtUGD1 protein is active as a hexamer, just as has been found for several other eukaryotic proteins of this type In addition, Sommer et al indicated that the Lys279 residue of human UGD is likely to have a role in maintaining the hexameric structure [24], and the Lys279 residue is conserved in the amino acid sequence of AtUGD1, consistent with our results The quantification of UDP-sugars in yeast cell extracts revealed that in the TOY1 strain expressing only AtUGD1, UDP-GlcA accumulated to a large extent in the cytoplasm In addition, the TOY3 strain coexpressing AtUGD1 and AtUXS3 could produce UDP-Xyl but we did not observe significant accumulation of the UDP-GlcA intermediate (Table 1) Recently, Ernst and Klaffke reported the chemical synthesis of UDP-Xyl [32]; however, their method had some potential problems, including low yield and contamination of the final compound with a ⁄ b anomers (a ⁄ b ¼ : 3) In the case of enzymatic conversion of UDP-sugar, it is not necessary to consider contamination with a ⁄ b anomers Furthermore, as our system is based on yeast, which is essentially a renewable factory for protein production, our system makes it at least theoretically possible to scale up production levels dramatically There are many important and valuable UDP-sugars in plants in addition to UDP-GlcA and UDP-Xyl, such as UDP-l-arabinose, UDP-d-galacturonic acid, UDP-l-rhamnose and UDP-d-apiose [1] It is difficult to isolate these UDP-sugars from the plant biomass, 2652 because most of the sugars are incorporated into plant structures As these UDP-sugars can be produced from UDP-Glc, valuable UDP-sugars can be synthesized by expressing the responsible UDP-sugar-converting enzymes in yeast cells [33–37] Our system for creating a UDP-Xyl synthesis pathway in yeast provided clear evidence that UDP-Xyl plays an important role in maintaining the cytoplasmic pool of UDP-Glc in vivo, suggesting that the proposed regulatory system for the UDP-Glc pool may also be applicable in plant cells UDP-Glc is important for synthesis of the cell wall in plants Thus, it is essential for plants to maintain a constant pool of UDP-Glc, which is accomplished by a regulatory system in the cell In TOY1 yeast cells (with AtUGD1), the UDPGlc pool was reduced due to the lack of a similar regulatory system In contrast, in TOY3 yeast cells (with both AtUGD1 and AtUXS3), the UDP-Glc pool was maintained at levels comparable to the UDP-Glc pool in W303a control cells Many enzymatic and transcriptional studies have suggested that the production of UDP-GlcA may be rate-limiting in providing precursors for synthesis of the cell wall [13,15,16] However, it has been impossible to obtain direct confirmation of the hypothesis on the basis of the size of the UDP pool in vivo, because of the complexity of the UDPsugar regulation system in plant cells Our yeast system, by contrast, made it possible to quantify changes in the UDP-sugar pool in vivo, as these cells lack endogenous UDP-sugar-converting enzymes, with the exception of enzymes used in the synthesis of UDPGlc, UDP-d-galactose and UDP-N-d-acetylglucosamine We previously reported that MUR1 and GER1 tightly associate to form a functional complex required for the stable enzymatic activity that can produce GDP-Fuc from GDP-Man [23] However, interaction between AtUGD1 and AtUXS3 was not observed in immunoprecipitation experiments (data not shown), suggesting that the regulation of the UDP-Glc pool is not the result of direct protein interaction but is instead mediated by an intermediary inhibition mechanism of UDP-Xyl Thus, the yeast reconstruction system will be useful to further understand the regulation and interaction of UDP-sugar-converting enzymes Yeast can be used as a host for the expression of valuable proteins modified by artificial glycosylation [38,39] Kainuma et al indicated that protein glycosylation remodeling can be carried out using intrinsic sugar nucleotides in yeast via the introduction of heterologous genes required for artificial glycosylation [38] Here, we built on that success by constructing recombinant yeast strains that produce the sugar FEBS Journal 273 (2006) 2645–2657 ª 2006 The Authors Journal compilation ª 2006 FEBS T Oka and Y Jigami Synthesis of UDP-glucuronic acid and UDP-xylose nucleotides UDP-GlcA and UDP-Xyl, similar to what was done for production of recombinant yeasts that make GDP-Fuc from GDP-Man [23] In the future, it will be interesting to explore the possibility of expanding the approach to generate novel yeast strains that can produce proteins that have been modified by glycosylation with sugars not normally found in yeast, such as gluruconic acid, xylose and fucose Experimental procedures Microorganisms and growth conditions The yeast strains used in this work are listed in Table S cerevisiae W303a cells were used as the wild-type strain for this study [40] Strains were grown in synthetic minimal medium containing 0.5% dextrose (glucose) (SD) or YPAD medium [41] Cell growth in submerged culture was done by inoculating 0.1 D600 nm cells into 200 mL of growth medium in a 1000-mL Erlenmeyer flask The flasks were then shaken at 120 r.p.m at 30 °C Standard transformation procedures for S cerevisiae were used [42] Construction of the expression vector Plasmid vectors for expression of AtUGD1 and AtUXS3 (GenBank accession numbers AY143922 and AF387789) were constructed as follows The genes were amplified by PCR from an A thaliana lambda cDNA Library (Stratagene, La Jolla, CA) using the following oligonucleotide primers: for UGD-VSV-G, UGD1-VSV-G-EcoRI-F (5¢-AGAATTCATGTATACTGATATTGAAATGAATAG ATTGGGTAAAATGGTGAAGATATGCTGCATAGGA G-3¢) and UGD1-SalI-R (5¢-AAAAAGTCGACTCATGCC ACAGCAGGCATATCCTT-3¢); for UGD1-His, UGD1His-EcoRI-F (5¢-AGAATTCATGCATCACCATCACCAT CACATGGTGAAGATATGCTGCATAG-3¢) and UGD1SalI-R, UXS3-EcoRI-F (5¢-AGATTCATGGCAGCTACA AGTGAGAAACAGA-3¢); and for UXS-c-Myc, UXS3-cMyc-XhoI-R (5¢-TCTCGAGTTACAAATCTTCTTCAGAA ATCAATTTTTGTTCGTTTCTTGGGACGTTAAGCCTT AG-3¢) The PCR products were digested with the appropriate restriction enzymes and ligated into similarly digested YEp352-GAP-II [23] to yield YEp352-GAP-II-UGD1-VSV- G, Yep352-GAP-II-UGD1-His and YEp352-GAP-IIUXS3-c-Myc Next, BamHI fragments that included the AtUGD1 and AtUXS3 gene expression cassettes from YEp352-GAP-II-UGD1-VSV-G and YEp352-GAP-IIUXS3-c-Myc were inserted into the BamHI sites of pRS305 and pRS304 to yield pRS305-UGD1-VSV-G and pRS304UXS3-c-Myc, respectively The DNA sequence of the expression constructs was confirmed using an ABI PRISM 3100 Genetic Analyzer (Applied Biosystems, Foster, CA) Immunoblot analysis Protein concentration was determined using the bicinchoninic acid protein assay reagent (Pierce Biotechnology, Inc., Rockford, IL) with bovine serum albumin as a standard SDS ⁄ PAGE was performed on crude cell lysates (D600 nm ¼ 2.0) Proteins were then transferred to a polyvinylidene fluoride membrane filter using an electroblotter (ATTO, Tokyo, Japan) at 100 mA for h After incubation of the membrane filter for h in blocking buffer (3% skimmed milk, 10 mm phosphate buffer pH 7.4, 0.9% NaCl), the membrane was incubated in mL of blocking buffer with a : 1000 dilution of affinity-purified goat VSV-G polyclonal antibody (Bethyl, Inc., Montgomery, TX) or c-Myc monoclonal antibody 9E10 (CRP, Inc., Cumberland, VA) The membrane was next incubated for h at the room temperature, washed three times with 10 mm phosphate buffer (pH 7.4) and 0.9% (w ⁄ v) NaCl (NaCl ⁄ Pi buffer) for a total of 30 min, and then incubated for h with a : 1000 dilution of anti-goat IgG conjugate horse radish peroxidase (Santa Cruz Biotechnology, Inc., Santa Cruz, CA) or anti-mouse IgG conjugate horse radish peroxidase (Valeant Pharmaceuticals International, Costa Mesa, CA) Preparation of crude enzyme fractions First, yeast were grown in YPAD medium at 30 °C for 24 h Next, cells were harvested (D600 nm ¼ 150), resuspended in mL of 10 mm Tris ⁄ HCl buffer (pH 7.8) in the presence of a protease inhibitor, and finally lysed with glass beads The extract was subjected to 100 000 g centrifugation to remove the membrane fraction and the supernatant was used in subsequent enzymatic assays Table Yeast strains Yeast strains Genotype or description Source or reference W303a TOY1 TOY2 TOY3 TOY4 MATa leu2-3, his3-11, trp1-1, can1-100, ade2-1, ura3-1 As in W303a and leu2-3::pRS-305-UGD1-VSV-G As in W303a and trp1-1::pRS-304-UXS3-c-Myc As in W303a and leu2-3::pRS-305-UGD1-VSV-G, trp1–1::pRS-304-UXS3-c-Myc As in W303a harboring expression plasmid YEp352-GAP-II-UGD1-His [40] This This This This FEBS Journal 273 (2006) 2645–2657 ª 2006 The Authors Journal compilation ª 2006 FEBS study study study study 2653 Synthesis of UDP-glucuronic acid and UDP-xylose T Oka and Y Jigami UGD assay The in vitro assay for UGD was performed using the following reaction mixture (total volume 100 lL): mm UDPglucose; 0.5 mm NAD+; protease inhibitor (one tablet of Complete ⁄ 50 mL; Roche, Mannheim, Germany); 50 mm Tris ⁄ HCl (pH 8.6); and S cerevisiae cell extract supernatant (see above) at D600 nm ¼ 10 Reaction mixtures were incubated at 30 °C for 60 and the reaction was stopped by vortex mixing with 100 lL of ice-cold phenol ⁄ chloroform ⁄ isoamyl alcohol (25 : 24 : 1) Next, lL of the reacted cell supernatants were analyzed by HPLC with cosmosil 5C18AR-II (250 · 4.6 mm; Nacalai Tesque, Kyoto, Japan) The column was equilibrated with 20 mm triethylamine acetate (TEAA) buffer (pH 7.0) at a flow rate of mLỈmin)1 UDPsugars were detected by UV260 nm absorbance [13] acquired on an Esquire 3000-plus instrument (Bruker Daltonik GmbH, Bremen, Germany) in the negative-ion mode Conditions for ESI-MS were as follows: 68.95 kPa nebulizer flow, 300 °C nozzle temperature, and 5.0 LỈmin)1 flow of drying gas (N2) Negative-ion spectra were generated by scanning the m ⁄ z range 500–600 Analysis and quantification of UDP-sugar nucleotides The assay for in vitro UGD was adapted for detection of UDP-glucuronic acid decarboxylase activity by replacing mm UDP-Glc and 50 mm Tris ⁄ HCl (pH 8.6) with mm UDP-GlcA and 50 mm Tris ⁄ HCl (pH 6.8), respectively [2] The UDPS-C18 fractions were reseparated on a Develosil RPAQUEOUS column (250 · 4.6 mm; Nomura Chemical Co., Ltd, Seto, Japan) The column was equilibrated with 20 mm TEAA buffer (pH 7.0) at a flow rate of 0.7 mLỈ min)1 UDP-sugars were detected by UV260 nm absorbance The peaks of UDP-Glc, UDP-GlcA and UDP-Xyl that were detected were collected based on the retention times of the standards The combined fractions were designated ‘UDPS-C30’ The structures of the UDP-sugars were identified by the molecular mass, according to the ESI-MS results Sugar-nucleotides were quantified by absorbance intensity and expressed as UDP-Glc equivalents Independent experiments were done in triplicate Extraction of sugar nucleotides from yeast cells Purification of UGD Extraction of sugar nucleotides from yeast cells was done as follows Briefly, yeast cells were cultivated and harvested (D600 nm ¼ 150) Next, 15 mL of ice-cold m formic acid saturated with 1-butanol was added to the cells and incubated for h at °C [23] The samples were then centrifuged at 13 000 g for to remove cell debris Next, supernatants were lyophilized and redissolved in 300 lL of water Finally, samples were filtered using a filter with a pore size of 0.2 lm (Millipore, Billerica, MA) Dry weight of the yeast cells was measured after lyophilization Independent experiments were done in triplicate Dry weight of the yeast cells (g weight per D600 nm) was measured after lyophilization of the aliquot of cells (D600 nm ¼ 160– 180) The · His-tagged AtUGD1 protein was purified from yeast cell extracts using the AKTA explorer 10S FPLC System (GE Healthcare Bio-Sciences Corp., Piscataway, NJ) All steps were performed at °C unless otherwise stated To prepare the cell extracts, yeast cells were grown in SD (– uracil) medium at 30 °C for 24 h Cells were harvested (D600 nm ¼ 800), resuspended in approximately 100 mL of 10 mm Tris ⁄ HCl buffer (pH 8.0) containing protease inhibitor, and then lysed with glass beads Cell debris was removed by centrifugation at 15 000 g for 15 and the supernatant was loaded onto a 1-mL HisTrap HP column (GE Healthcare Bio-Sciences Corp.) that had been equilibrated with buffer A (10 mm Tris ⁄ HCl, pH 8.0) The column was washed with buffer A until the breakthrough peak of protein had been eluted The enzyme was then eluted by a gradient up to 500 mm imidazole The fractions containing · His-tagged AtUGD1 protein were pooled and concentrated with a YM30 membrane (Millipore), applied to a HiLoad 16 ⁄ 60 Superdex 200-pg column (1.6 cm · 60.0 cm; GE Healthcare Bio-Sciences Corp.), and equilibrated in buffer B (10 mm Tris ⁄ HCl, pH 8.0, and 150 mm NaCl) The sample was eluted at a rate of mLỈmin)1 in buffer B Active fractions were concentrated to mL by ultrafiltration over a YM30 membrane (Millipore), and stored at °C The purified enzymes were analyzed by SDS ⁄ PAGE Protein concentrations were determined with the bicinchoninic acid protein assay reagent (Pierce Biotechnology, Inc., Rockford, IL) using bovine serum albumin as a standard UDP-glucuronic acid decarboxylase assay Mass spectrometry Sugar nucleotide fractions were separated on a cosmosil 5C18-AR-II column (Nacalai Tesque) The column was equilibrated with 20 mm TEAA buffer (pH 7.0) at a flow rate of mLỈmin)1 UDP-sugars were detected by UV260 nm absorbance The peaks of UDP-Glc, UDP-GlcA and UDPXyl activity that were detected were collected based on the retention times of the standards UDP-Glc, UDP-Xyl and UDP-GlcA fractions from the W303a, TOY1 and TOY3 strains were harvested and mixed, respectively The mixed fractions were designated ‘UDPS-C18’ The UDPS-C18 fractions were analyzed by ESI-MS Mass spectra were 2654 FEBS Journal 273 (2006) 2645–2657 ª 2006 The Authors Journal compilation ª 2006 FEBS T Oka and Y Jigami Kinetic studies The level of activity of UGD was estimated by determining the amount of UDP-GlcA Reaction mixtures contained Tris ⁄ HCl (50 mm, pH 8.6), NAD+ (0.5 mm), UDP-Glc and 10.8 · 10)6 Units of purified AtUGD1 in a total volume of 50 lL Variations in the reaction mixture are noted in the text Reactions were started by the addition of NAD+ One unit of enzyme activity is defined as the amount of enzyme resulting in the production of lmol UDP-Glc min)1 at 25 °C Assay mixtures were incubated for 40 min, and the reaction was stopped by vortex mixing with 50 lL of ice-cold phenol ⁄ chloroform ⁄ isoamyl alcohol (25 : 24 : 1); this was followed by centrifugation (15 000 g for at °C) Next, 30 lL of each supernatant was applied to a Develosil RPAQUEOUS column (250 · 4.6 mm; Nomura Chemical Co.) The column was equilibrated with 20 mm TEAA buffer (pH 7.0) at a flow rate of 0.7 mLỈmin)1 UDP-sugars were detected by UV260 nm absorbance, and sugar nucleotides were quantified against UDP-Glc as a standard Linearity (r2 ¼ 0.99) was maintained between and 10 lm of UDP-Glc per 30 lL of injection volume The Km value was determined using the Michaelis–Menten equation For further mechanistic analysis, double-reciprocal plots and secondary replots were constructed The Ki parameter was determined by replot analysis Molecular mass determination of protein complex The functional molecular mass of active · His-tagged AtUGD1 enzyme complex was determined on a PROTEIN KW-803 column (Showa Denko K K., Tokyo, Japan) The column was equilibrated with buffer B (10 mm Tris ⁄ HCl, pH 8.0, and 150 mm NaCl) The protein complex was detected by UV220 nm absorbance Purified recombinant AtUGD1 was loaded onto the column with an HPLC system (Shimadzu Co., Kyoto, Japan) at a flow rate of 0.2 mLỈmin)1 Size determination was performed by comparison with molecular mass standards (GE Healthcare Bio-Sciences Corp.) loaded onto the column under the same conditions The molecular mass standards used were as follows: thyroglobulin, 669 kDa; ferritin, 440 kDa; catalase, 232 kDa; ovalbumin, 43 kDa Acknowledgements This work was supported by grants from the New Energy and Industrial Technology Development Organization of Japan (NEDO) We thank Dr Shigeyasu Ito and Minako Takashiba for ESI-MS analysis, Toshihiko Kitajima for protein purification, and Dr Takehiko Yoko-o for critical reading of the manuscript We are indebted to Drs Ken-ichi Nakayama, Yasunori Chiba, Xiao-Dong Gao, Yoh-ichi Shimma Synthesis of UDP-glucuronic acid and UDP-xylose and the members of our laboratory for stimulating discussions References Seifert GJ (2004) Nucleotide sugar interconversions and cell wall biosynthesis: how to bring the inside to the outside Curr Opin Plant Biol 7, 277–284 Bar-Peled M, Griffith CL & Doering TL (2001) Functional cloning and characterization of a UDP-glucuronic acid decarboxylase: the pathogenic fungus Cryptococcus neoformans elucidates UDP-xylose synthesis Proc Natl Acad Sci USA 98, 12003–12008 Hwang HY & Horvitz HR (2002) The SQV-1 UDP-glucuronic acid decarboxylase and the SQV-7 nucleotidesugar transporter may act in the Golgi apparatus to affect Caenorhabditis elegans vulval morphogenesis and embryonic development Proc Natl Acad Sci USA 99, 14218–14223 Moriarity JL, Hurt KJ, Resnick AC, Storm PB, Laroy W, Schnaar RL & Snyder SH (2002) UDP-glucuronate decarboxylase, a key enzyme in proteoglycan synthesis: cloning, characterization, and localization J Biol Chem 277, 16968–16975 Strasser R, Mucha J, Mach L, Altmann F, Wilson IB, Glossl J & Steinkellner H (2000) Molecular cloning and functional expression of beta1,2-xylosyltransferase cDNA from Arabidopsis thaliana FEBS Lett 472, 105–108 Wilson IB (2004) The never-ending story of peptide O-xylosyltransferase Cell Mol Life Sci 61, 794–809 Hase S, Nishimura H, Kawabata S, Iwanaga S & Ikenaka T (1990) The structure of (xylose) 2glucose-O-serine 53 found in the first epidermal growth factor-like domain of bovine blood clotting factor IX J Biol Chem 265, 1858–1861 Gotting C, Kuhn J, Zahn R, Brinkmann T & Kleesiek K (2001) Molecular cloning and expression of human UDP-d-xylose: proteoglycan core protein beta-d-xylosyltransferase and its first isoform XT-II J Mol Biol 304, 517–528 Faik A, Price NJ, Raikhel NV & Keegstra K (2002) An Arabidopsis gene encoding an alpha-xylosyltransferase involved in xyloglucan biosynthesis Proc Natl Acad Sci USA 99, 7797–7802 10 Kanter U, Usadel B, Guerineau F, Li Y, Pauly M & Tenhaken R (2005) The inositol oxygenase gene family of Arabidopsis is involved in the biosynthesis of nucleotide sugar precursors for cell-wall matrix polysaccharides Planta 221, 243–254 11 Sieberth V, Rigg GP, Roberts IS & Jann K (1995) Expression and characterization of UDP-Glc dehydrogenase (KfiD), which is encoded in the type-specific region of the Escherichia coli K5 capsule genes J Bacteriol 177, 4562–4565 FEBS Journal 273 (2006) 2645–2657 ª 2006 The Authors Journal compilation ª 2006 FEBS 2655 Synthesis of UDP-glucuronic acid and UDP-xylose T Oka and Y Jigami 12 Griffith CL, Klutts JS, Zhang L, Levery SB & Doering TL (2004) UDP-glucose dehydrogenase plays multiple roles in the biology of the pathogenic fungus Cryptococcus neoformans J Biol Chem 279, 51669– 51676 13 Tenhaken R & Thulke O (1996) Cloning of an enzyme that synthesizes a key nucleotide-sugar precursor of hemicellulose biosynthesis from soybean: UDP-glucose dehydrogenase Plant Physiol 112, 1127–1134 14 Lind T, Falk E, Hjertson E, Kusche-Gullberg M & Lidholt K (1999) cDNA cloning and expression of UDP-glucose dehydrogenase from bovine kidney Glycobiology 9, 595–600 15 Seitz B, Klos C, Wurm M & Tenhaken R (2000) Matrix polysaccharide precursors in Arabidopsis cell walls are synthesized by alternate pathways with organ-specific expression patterns Plant J 21, 537–546 16 Turner W & Botha FC (2002) Purification and kinetic properties of UDP-glucose dehydrogenase from sugarcane Arch Biochem Biophys 407, 209–216 17 Harper AD & Bar-Peled M (2002) Biosynthesis of UDP-xylose Cloning and characterization of a novel Arabidopsis gene family, UXS, encoding soluble and putative membrane-bound UDP-glucuronic acid decarboxylase isoforms Plant Physiol 130, 2188–2198 18 Pattathil S, Harper AD & Bar-Peled M (2005) Biosynthesis of UDP-xylose: characterization of membranebound AtUxs2 Planta 221, 538–548 19 Douglas CM, Foor F, Marrinan JA, Morin N, Nielsen JB, Dahl AM, Mazur P, Baginsky W, Li W, el-Sherbeini M, Clemas JA, Mandala SM, Frommer BR & Kurtz MB (1994) The Saccharomyces cerevisiae FKS1 (ETG1) gene encodes an integral membrane protein which is a subunit of 1,3-beta-D-glucan synthase Proc Natl Acad Sci USA 91, 12907–12911 20 Mazur P, Morin N, Baginsky W, el-Sherbeini M, Clemas JA, Nielsen JB & Foor F (1995) Differential expression and function of two homologous subunits of yeast 1,3beta-D-glucan synthase Mol Cell Biol 15, 5671–5681 21 Shahinian S & Bussey H (2000) beta-1,6-Glucan synthesis in Saccharomyces cerevisiae Mol Microbiol 35, 477–489 22 Mattila P, Rabina J, Hortling S, Helin J & Renkonen R (2000) Functional expression of Escherichia coli enzymes synthesizing GDP-L-fucose from inherent GDP-D-mannose in Saccharomyces cerevisiae Glycobiology 10, 1041–1047 23 Nakayama K, Maeda Y & Jigami Y (2003) Interaction of GDP-4-keto-6-deoxymannose-3,5-epimerase-4-reductase with GDP-mannose-4,6-dehydratase stabilizes the enzyme activity for formation of GDP-fucose from GDP-mannose Glycobiology 13, 673–680 24 Sommer BJ, Barycki JJ & Simpson MA (2004) Characterization of human UDP-glucose dehydrogenase CYS-276 is required for the second of two successive oxidations J Biol Chem 279, 23590–23596 2656 25 Campbell RE, Mosimann SC, van De Rijn I, Tanner ME & Strynadka NC (2000) The first structure of UDP-glucose dehydrogenase reveals the catalytic residues necessary for the two-fold oxidation Biochemistry 39, 7012–7023 26 Bar-Peled M, Griffith CL, Ory JJ & Doering TL (2004) Biosynthesis of UDP-GlcA, a key metabolite for capsular polysaccharide synthesis in the pathogenic fungus Cryptococcus neoformans Biochem J 381, 131–136 27 Scheible WR & Pauly M (2004) Glycosyltransferases and cell wall biosynthesis: novel players and insights Curr Opin Plant Biol 7, 285–295 28 Bindschedler LV, Wheatley E, Gay E, Cole J, Cottage A & Bolwell GP (2005) Characterisation and expression of the pathway from UDP-glucose to UDP-xylose in differentiating tobacco tissue Plant Mol Biol 57, 285– 301 29 Hinterberg B, Klos C & Tenhaken R (2002) Recombinant UDP-glucose dehydrogenase from soybean Plant Physiol Biochem 40, 1011–1017 30 Nakamura Y, Gojobori T & Ikemura T (2000) Codon usage tabulated from the international DNA sequence databases: status for the year Nucleic Acids Res 28, 292 31 Stewart DC & Copeland L (1998) Uridin 5¢-diphosphate-glucose dehydrogenase from soybean nodules Plant Physiol 116, 349–355 32 Ernst C & Klaffke W (2003) Chemical synthesis of uridine diphospho-D-xylose and UDP-L-arabinose J Org Chem 68, 5780–5783 33 Seifert GJ, Barber C, Wells B, Dolan L & Roberts K (2002) Galactose biosynthesis in Arabidopsis: genetic evidence for substrate channeling from UDP-D-galactose into cell wall polymers Curr Biol 12, 1840–1845 34 Burget EG, Verma R, Molhoj M & Reiter WD (2003) The biosynthesis of l-arabinose in plants: molecular cloning and characterization of a Golgi-localized UDPD-xylose 4-epimerase encoded by the MUR4 gene of Arabidopsis Plant Cell 15, 523–531 35 Molhoj M, Verma R & Reiter WD (2004) The biosynthesis of D-galacturonate in plants: functional cloning and characterization of a membrane-anchored UDP-D-glucuronate 4-epimerase from Arabidopsis Plant Physiol 135, 1221–1230 36 Molhoj M, Verma R & Reiter WD (2003) The biosynthesis of the branched-chain sugar d-apiose in plants: functional cloning and characterization of a UDP-dapiose ⁄ UDP-d-xylose synthase from Arabidopsis Plant J 35, 693–703 37 Usadel B, Kuschinsky AM, Rosso MG, Eckermann N & Pauly M (2004) RHM2 is involved in mucilage pectin synthesis and is required for the development of the seed coat in Arabidopsis Plant Physiol 134, 286–295 38 Kainuma M, Ishida N, Yoko-o T, Yoshioka S, Takeuchi M, Kawakita M & Jigami Y (1999) Coexpression of FEBS Journal 273 (2006) 2645–2657 ª 2006 The Authors Journal compilation ª 2006 FEBS T Oka and Y Jigami alpha1,2 galactosyltransferase and UDP-galactose transporter efficiently galactosylates N- and O-glycans in Saccharomyces cerevisiae Glycobiology 9, 133–141 39 Chiba Y, Suzuki M, Yoshida S, Yoshida A, Ikenaga H, Takeuchi M, Jigami Y & Ichishima E (1998) Production of human compatible high mannose-type (Man5GlcNAc2) sugar chains in Saccharomyces cerevisiae J Biol Chem 273, 26298–26304 40 Thomas BJ & Rothstein R (1989) The genetic control of direct-repeat recombination in Saccharomyces: the Synthesis of UDP-glucuronic acid and UDP-xylose effect of rad52 and rad1 on mitotic recombination at GAL10, a transcriptionally regulated gene Genetics 123, 725–738 41 Sherman F (1991) Getting started with yeast Methods Enzymol 194, 3–21 42 Gietz D, St Jean A, Woods RA & Schiestl RH (1992) Improved method for high efficiency transformation of intact yeast cells Nucleic Acids Res 20, 1425 FEBS Journal 273 (2006) 2645–2657 ª 2006 The Authors Journal compilation ª 2006 FEBS 2657 ... 2647 Synthesis of UDP-glucuronic acid and UDP-xylose T Oka and Y Jigami Similarly, we assayed UDP-Xyl synthesis by providing UDP-GlcA as substrate and NAD+ as cofactor The cytoplasmic fraction from. .. FEBS T Oka and Y Jigami Synthesis of UDP-glucuronic acid and UDP-xylose nucleotides UDP-GlcA and UDP-Xyl, similar to what was done for production of recombinant yeasts that make GDP-Fuc from GDP-Man.. .Synthesis of UDP-glucuronic acid and UDP-xylose T Oka and Y Jigami of oligosaccharides to proteins in a variety of organisms For example, O-xylosyltransferase