A novel isoform of pantothenate synthetase in the Archaea Silvia Ronconi, Rafal Jonczyk and Ulrich Genschel Lehrstuhl fu ¨ r Genetik, Technische Universita ¨ tMu ¨ nchen, Freising, Germany Pantothenate is the essential precursor to CoA, which is of central importance for all parts of metabolism. This is shown by the fact that more than 400 enzyme- catalyzed reactions are known to involve CoA (KEGG database [1]). Many more enzymes utilize acylated forms of CoA or require the CoA-derived phospho- pantetheine as a prosthetic group. Typically, plants, fungi and microorganisms are able to synthesize panto- thenate de novo, whereas animals rely on pantothenate in their diet. Pantothenate synthetase (PS) catalyzes the last step in the biosynthesis of pantothenic acid, also known as vita- min B 5 . The enzyme (EC 6.3.2.1) has been extensively studied in Escherichia coli [2,3], Mycobacterium tubercu- losis [4,5], and Arabidopsis thaliana [6], and is highly conserved in the Bacteria and Eukaryota. Bacterial PS (Eqn 1) generates pantothenate from pantoate and b-alanine. It is an AMP-forming synthetase that proceeds via an acyl-adenylate intermediate and belongs to the HIGH superfamily of nucleotidyltransferases [3]. Keywords archaeal metabolism; CoA biosynthesis; evolution of metabolism; Methanosarcina mazei; pantothenate synthetase Correspondence U. Genschel, Lehrstuhl fu ¨ r Genetik, Technische Universita ¨ tMu ¨ nchen, Am Hochanger 8, 85350 Freising, Germany Fax: +49 8161 715636 Tel: +49 8161 715644 E-mail: genschel@wzw.tum.de (Received 7 February 2008, revised 17 March 2008, accepted 19 March 2008) doi:10.1111/j.1742-4658.2008.06416.x The linear biosynthetic pathway leading from a-ketoisovalerate to panto- thenate (vitamin B 5 ) and on to CoA comprises eight steps in the Bacteria and Eukaryota. Genes for up to six steps of this pathway can be identified by sequence homology in individual archaeal genomes. However, there are no archaeal homologs to known isoforms of pantothenate synthetase (PS) or pantothenate kinase. Using comparative genomics, we previously identi- fied two conserved archaeal protein families as the best candidates for the missing steps. Here we report the characterization of the predicted PS gene from Methanosarcina mazei, which encodes a hypothetical protein (MM2281) with no obvious homologs outside its own family. When expressed in Escherichia coli, MM2281 partially complemented an auxo- trophic mutant without PS activity. Purified recombinant MM2281 showed no PS activity on its own, but the enzyme enabled substantial synthesis of [ 14 C]4¢-phosphopantothenate from [ 14 C]b-alanine, pantoate and ATP when coupled with E. coli pantothenate kinase. ADP, but not AMP, was detected as a coproduct of the coupled reaction. MM2281 also transferred the 14 C-label from [ 14 C]b-alanine to pantothenate in the presence of panto- ate and ADP, presumably through isotope exchange. No exchange took place when pantoate was removed or ADP replaced with AMP. Our results indicate that MM2281 represents a novel type of PS that forms ADP and is strongly inhibited by its product pantothenate. These properties differ substantially from those of bacterial PS, and may explain why PS genes, in contrast to other pantothenate biosynthetic genes, were not exchanged horizontally between the Bacteria and Archaea. Abbreviations COG, clusters of orthologous groups; KPHMT, ketopantoate hydroxymethyltransferase; KPR, ketopantoate reductase; PANK, pantothenate kinase; PS, pantothenate synthetase. 2754 FEBS Journal 275 (2008) 2754–2764 ª 2008 The Authors Journal compilation ª 2008 FEBS D-pantoate þ b-alanine þ ATP ! D-pantothenate þ AMP þ PP i ð1Þ CoA biosynthesis is best understood in the Bacteria, where eight steps lead from a-ketoisovalerate to CoA (Fig. 1) [7,8]. The eukaryotic CoA pathway has been studied to various degrees in fungi, plants, and animals [9], and consists of both highly conserved bacterial-type enzymes and divergent isoforms. Much less is known about CoA biosynthesis in the Archaea. We previously used comparative genomics to reconstruct the universal CoA biosynthetic pathway in the Bacteria, Eukaryota, and Archaea [10]. Archaeal genes for the ultimate four steps can be identified by homology in all archaeal genomes, and experimental confirmation of this assign- ment is available for three of these steps [11,12]. In addition, bacterial-type genes for the first two steps are obvious in a number of the nonmethanogenic Archaea. However, homologs to bacterial PS or any of the three established isoforms of pantothenate kinase (PANK) [13] are generally missing from archaeal genomes. We approached this problem by using a nonhomology search strategy based on conserved chromosomal prox- imity, a method that exploits the tendency of function- ally related genes to cluster along the chromosome [14]. Using the archaeal CoA biosynthetic genes with homol- ogy to bacterial or eukaryotic genes on the CoA path- way as a starting point, this identified the clusters of orthologous groups (COG)1701 and COG1829 protein families as the best candidates for the PS and PANK steps in archaeal CoA biosynthesis [10]. (COG protein family identifiers cited in this report are defined in the COG database [15]). Here we report the characterization of the predicted PS gene from Methanosarcina mazei. We conclude that the COG1701 family represents the archaeal isoform of PS, which utilizes the same substrates as bacterial PS, but forms ADP instead of AMP and has distinct kinetic properties. This supports the view that the intermediates of pantothenate biosynthesis are univer- sally conserved, whereas the corresponding enzymes were recruited independently in the Bacteria and Archaea. Results Prediction of conserved archaeal protein families for PS and PANK Genomic context and phylogenetic pattern analysis previously identified the COG1701 and COG1829 pro- tein families as the best candidates for the missing steps leading from pantoate to 4¢-phosphopantothenate in archaeal CoA biosynthesis [10]. Meanwhile, many more archaeal genomes have been completed, and the comparative genomics search for the missing steps was repeated by using the STRING tool [16]. This analysis revealed additional, previously undetected, links between established archaeal CoA genes and the COG1701 and COG1829 families, confirming that the latter are strong candidates for archaeal PS and PANK (Fig. 1). Fig. 1. The CoA biosynthetic pathway and its reconstruction in the Archaea. The linear pathway leading from a-ketoisovalerate to CoA comprises eight steps in the Bacteria and Eukaryota. It proceeds via pantoate, pantothenate (vitamin B 5 ), and 4¢-phosphopantothe- nate. The remaining intermediates, as well as the branch for pro- duction of b-alanine, are left out for clarity. For six of these steps, homologs can be established in the Archaea, and the corresponding COG families are shown in color to indicate the average level of sequence identity to the respective E. coli or human CoA biosyn- thetic enzymes [10]. Nonhomologous functional links to the archa- eal homologs were obtained from the STRING database [16], as described in Experimental procedures. Taken together, the links to COG1701 and COG1829 clearly support these protein families as the best candidates for the missing steps in archaeal CoA biosyn- thesis. The functional assignments for COG1701 (archaeal PS) and COG1829 (archaeal PANK) are explained in the main text. PPCS, phosphopantothenoylcysteine synthetase; PPCDC, phospho- pantothenoylcysteine decarboxylase; PPAT, phosphopantetheine adenylyltransferase; DPCK, dephospho-Co A kinase; P-pantothe- nate, 4¢-phosphopantothenate. S. Ronconi et al. Pantothenate synthetase from Methanosarcina mazei FEBS Journal 275 (2008) 2754–2764 ª 2008 The Authors Journal compilation ª 2008 FEBS 2755 Consistent with the assumption that both protein families represent archaeal isoforms of CoA biosyn- thetic enzymes, their members are found in nearly all archaeal genomes, but not outside the archaeal domain. Furthermore, COG1701 and COG1829 share a strictly conserved phylogenetic profile and frequently occur in tandem in potential operons (e.g. in Me. maz- ei; Fig. 2). A straightforward general function predic- tion is possible for the COG1829 family, which belongs to a superfamily of small molecule kinases (GHMP kinases [17]) and is therefore proposed to rep- resent archaeal PANK. This leaves COG1701, an orphan family with no obvious links to other protein families, as the best candidate for archaeal PS. Using the hhpred prediction server [18], COG1701 was found to be a distant homolog of acetohydroxyacid synthase, which ligates two molecules of pyruvate to yield acetolactate. Specifically, there is approximately 20% sequence identity between COG1701 proteins and the b-domain of acetohydroxyacid synthases. This domain has no specific catalytic function but is thought to be important for the structural integrity of acetohydroxyacid synthase [19]. Functional complementation of an E. coli panC mutant In the genome of Me. mazei, the predicted ORF for PS (MM2281) is situated in a potential operon together with the predicted PANK gene and the dfp gene (Fig. 2), and this cluster is therefore expected to cover the CoA biosynthetic steps leading from panto- ate to 4¢-phosphopantetheine. The MM2281 ORF was cloned by PCR and tested for its ability to comple- ment the E. coli panC mutant strain AT1371 in liquid minimal medium (Fig. 3). The panC gene, which encodes PS in E. coli, and the empty pBluescript KS vector served as positive and negative controls in this experiment, respectively. All transformants grew well in cultures supplemented with pantothenate (not shown). The cultures generally showed long lag peri- ods, during which the cells recovered from the starving procedure in pantothenate-free medium (see Experi- mental procedures). In the absence of supplements, AT1371 cells harboring MM2281 showed a shorter lag period and faster growth than the negative control, but did not grow as well as the positive control (Fig. 3A). The same pattern was observed in minimal medium containing 1 mm pantoate, a substrate of PS, except that the growth of cells containing MM2281 or the negative control was stimulated (Fig. 3B). In our hands, the E. coli panC mutant carrying empty vector (negative control) showed minor growth in minimal Fig. 2. Potential operon for CoA biosynthesis in Me. mazei. The predicted genes for PS and PANK, as well as the dfp gene encod- ing the bifunctional enzyme PPCS ⁄ PPCDC (MM2281 through MM2283), occur in a cluster, which corresponds to the steps lead- ing from pantoate to 4¢-phosphopantetheine. PPCS, phospho- pantothenoylcysteine synthetase; PPCDC, phosphopantothenoyl cysteine decarboxylase. Fig. 3. Functional complementation of an E. coli pantothenate auxotrophic mutant. The pantothenate-requiring E. coli mutant car- rying the Me. mazei MM2281 gene (d), the E. coli panC gene (h) or empty vector (s) was grown in liquid culture in the absence of pantothenate, as described in Experimental procedures. The mini- mal medium contained no supplements (A) or an additional 1 m M pantoate (B). All transformants grew equally well when the medium was supplemented with 1 m M pantothenate (not shown). Pantothenate synthetase from Methanosarcina mazei S. Ronconi et al. 2756 FEBS Journal 275 (2008) 2754–2764 ª 2008 The Authors Journal compilation ª 2008 FEBS medium. This might be caused by an endogenous non- specific activity able to produce pantothenate or by the emergence of revertants. Nevertheless, regardless of the actual reason for this behavior, the observation that MM2281-carrying cells recovered more quickly from pantothenate starvation and grew faster than the nega- tive control in two independent experiments indicates that expression of MM2281 partially complements the auxotrophic phenotype of E. coli AT1371. PS activity of recombinant MM2281 The MM2281 protein was overproduced as an N-ter- minal His-tag fusion protein in E. coli and had a sub- unit molecular mass in good agreement with its predicted size (30 kDa as judged by SDS ⁄ PAGE). The native molecular mass of MM2281 estimated by gel filtration was 57 000 Da, indicating that the enzyme is apparently a dimer in solution. Purified recombinant MM2281 was checked for its ability to synthesize pantothenate from pantoate, b-alanine and ATP by using a sensitive isotopic assay procedure. However, we were not able to demonstrate PS activity of MM2281 alone. Even after incubation for 3 h, the amount of [ 14 C]b-alanine converted into [ 14 C]pantothenate was below the lower limit of detec- tion (1% conversion). This means that PS activity of MM2281 was absent or below 0.6 nmolÆmin )1 Æmg )1 in our assay. In an attempt to confirm pantothenate as a product of MM2281, we coupled the reaction with excess E. coli PANK, which converts pantothenate to 4¢- phosphopantothenate. MM2281, individual helper enzymes or combinations of these were assayed for their ability to convert [ 14 C]b-alanine into [ 14 C]panto- thenate or [ 14 C]4¢-phosphopantothenate under stan- dard conditions. The 14 C-labeled reaction products were separated by TLC, revealed by phosphoimaging (Fig. 4), and quantified to calculate specific PS activi- ties (Table 1). Whereas MM2281 alone had no signifi- cant pantothenate-synthesizing activity in this assay, it was obvious that E. coli PS efficiently converted [ 14 C]b-alanine into [ 14 C]pantothenate (Fig. 4, lanes 2 and 3). E. coli PANK alone did not act on [ 14 C]b-ala- nine but was conducive to quantitative formation of [ 14 C]4¢-phosphopantothenate when coupled with E. coli PS (Fig. 4, lanes 4 and 5). As the products of E. coli PS and E. coli PANK are firmly established, the reac- tions with these enzymes provide chromatography standards for pantothenate and 4¢-phosphopantothe- nate and also confirm that the E. coli PANK prepara- tion used here was not contaminated with detectable PS activity. Therefore, the [ 14 C]4¢-phosphopanto- Fig. 4. Synthesis of pantothenate or 4¢-phosphopantothenate through MM2281 (Me. mazei PS) or helper enzymes. Standard enzyme assays were carried out as described in Experimental procedures, containing no enzyme (control), individual enzymes, or enzyme combinations, as indicated. The figure shows the 14 C-labeled products after a reaction time of 3 h. Separation was achieved by TLC. The enzyme abbreviations are as follows: EcPS, E. coli PS; EcPANK, E. coli PANK; PyrK, rabbit pyruvate kinase; bAla, b-alanine; PA, pantothenate; PPA, 4¢-phosphopantothenate. Table 1. Formation of pantothenate or 4¢-phosphopantothenate through MM2281 and helper enzymes. MM2281 and helper enzymes were tested individually or in combinations for their ability to form [ 14 C]pantothenate or [ 14 C]4¢-phosphopantothenate from [ 14 C]b-alanine, pantoate and ATP under the conditions of the stan- dard assay (Fig. 4). ND, not detectable; PyrK, rabbit pyruvate kinase. Enzyme(s) Specific pantothenate synthetase activity (nmolÆmin )1 Æmg )1 ) [ 14 C] Pantothenate [ 14 C] 4¢-Phosphopantothenate MM2281 ND ND E. coli PS > 900 a ND E. coli PANK ND ND E. coli PS + E. coli PANK ND > 900 a MM2281 + E. coli PANK ND 94 ± 11 b MM2281 + PyrK ND ND MM2281 + PyrK + E. coli PANK ND 140 ± 22 b a With respect to E. coli PS. This value is a lower estimate because the reaction was complete within the first interval. b With respect to MM2281. S. Ronconi et al. Pantothenate synthetase from Methanosarcina mazei FEBS Journal 275 (2008) 2754–2764 ª 2008 The Authors Journal compilation ª 2008 FEBS 2757 thenate produced by the combined action of MM2281 and E. coli PANK clearly demonstrates the capacity of MM2281 to synthesize pantothenate from pantoate and b-alanine (Fig. 4, lane 6). The rate of 4¢-phospho- pantothenate synthesis in this assay corresponds to a PS activity of 94 nmolÆmin )1 Æmg )1 with respect to MM2281, indicating that the E. coli PANK-mediated removal of pantothenate accelerated the synthesis of pantothenate through MM2281 at least 100-fold. Principally, the above behavior can be explained by assuming either that MM2281 is potently inhibited by pantothenate or that equilibrium is reached after only a small fraction of substrates has reacted. In both cases, the reaction is expected to accelerate when pan- tothenate is removed, because this should abolish inhi- bition or displace the equilibrium. It should be mentioned that active removal of pantothenate has no significant effect on the reaction rate of bacterial PS, essentially excluding the possibility that the MM2281 preparation was contaminated with bacterial PS. This is because pantothenate was shown to be a very weak product inhibitor of My. tuberculosis PS [4] and the equilibrium of the reaction catalyzed by bacterial PS lies far on the product side. The latter statement can be derived by considering the equilibrium constant of the reaction catalyzed by bacterial PS (Eqn 1). The equilibrium constant for Eqn (1) has not been deter- mined experimentally, but can be deduced from the equilibrium constants for the hydrolysis of pantothe- nate into pantoate and b-alanine (K¢ = 42 at pH 8.1 and 25 °C [20]) and the phosphorolysis of ATP into AMP and PP i (K¢ =3· 10 9 at pH 8 and 25 °C [21]). Combining the above constants gives the overall equi- librium constant for Eqn (1) at approximately pH 8 and 25 °C(K¢ Eqn (1) = 7.2 · 10 7 ). The large value means that the reaction in Eqn (1) will go to comple- tion under physiological conditions, including the enzyme assay used in this study (pH 8.0, 37 °C). Given the large effect of removing pantothenate on MM2281, we also tested the effect of removing the possible coproduct ADP. ADP was removed by pyru- vate kinase, which generates ATP from ADP in the presence of excess phosphoenolpyruvate. This system did not detectably accelerate pantothenate synthesis by MM2281 alone but, interestingly, increased the rate of 4¢-phosphopantothenate formation through MM2281 and E. coli PANK approximately 1.5-fold (Fig. 4, lanes 7 and 8). With a view to directly observing possible adenosine nucleotide coproducts of MM2281-catalyzed pantothe- nate synthesis, standard assays were analyzed by using a TLC system that provides separation of ATP, ADP, and AMP (Fig. 5). Whereas MM2281 alone had no discernible hydrolytic activity towards ATP, the cou- pled reaction of MM2281 and E. coli PANK generated a substantial amount of ADP. AMP was not detected as a coproduct, suggesting that MM2281 is not an AMP-forming PS according to Eqn (1). By compari- son, stoichiometric coupling of E. coli PANK, which produces ADP, with a bacterial, AMP-forming PS would lead to the accumulation of equimolar amounts of ADP and AMP. The observations that synthesis of phosphopantothenate through MM2281 and E. coli PANK was accelerated by removing ADP and not accompanied by production of AMP gave rise to the hypothesis that MM2281 is an ADP-forming synthe- tase according to Eqn (2): D-pantoate þ b-alanine þ ATP ! D-pantothenate þ ADP þ P i ð2Þ The equilibrium constant for Eqn (2) can be calcu- lated in the same way as that for Eqn (1) (see above). Using the equilibrium constant for phosphorolysis of ATP into ADP and P i (K¢ = 1.6 · 10 7 at pH 8 and 25 °C [21]), the overall equilibrium constant for Eqn (2) at approximately pH 8 and 25 °C becomes Fig. 5. Detection of adenosine nucleotides produced by MM2281 (Me. mazei PS) and E. coli PANK. Standard assays containing MM2281 alone (lane 4) or together with E. coli PANK (lane 5) were carried out as described in Experimental procedures. Reaction mix- tures were separated by TLC, and nucleotides were visualized under UV light. Authentic standards of ATP, ADP and AMP were cochro- matographed on the same plate (lanes 1–3). EcPANK, E. coli PANK. Pantothenate synthetase from Methanosarcina mazei S. Ronconi et al. 2758 FEBS Journal 275 (2008) 2754–2764 ª 2008 The Authors Journal compilation ª 2008 FEBS K¢ Eqn (2) = 3.9 · 10 5 . Although K¢ Eqn (2) is smaller than K¢ Eqn (1) , the reaction shown in Eqn (2) will still essentially go to completion in our enzyme assay or under physiological conditions. MM2281-catalyzed pantothenate–b-alanine isotope exchange The role of ATP and ADP in the MM2281-catalyzed de novo synthesis of pantothenate could not be investi- gated independently, because the assay for this forward activity required the presence of E. coli PANK, which utilizes ATP and generates ADP. In order to circum- vent this problem, we assayed MM2281 alone for its ability to catalyze an isotope exchange between [ 14 C]b- alanine and pantothenate (Table 2). The cosubstrate dependence of this exchange activity then allowed con- clusions about the role of adenosine nucleotides and the mechanism of MM2281. Generally, isotope exchange between a given substrate–product pair occurs in the presence of all cosubstrates and coprod- ucts (complete system) or, if the enzyme catalyzes a partial reaction, in the presence of a subset of reac- tants. Each cosubstrate may either be indispensable for the exchange reaction to occur or merely affect the exchange rate [22]. The MM2281-catalyzed incorporation of 14 C-label from [ 14 C]b-alanine into pantothenate was investigated in the presence of full sets or subsets of the reactants in Eqn (1) or Eqn (2), respectively (Table 2, Experi- ment I). In the presence of the full set of reactants (complete system), the assay based on Eqn (2) revealed a five-fold higher rate than that based on Eqn (1). Removing pantoate reduced the incorporation of 14 C-label into pantothenate to negligible levels in both the Eqns (1,2) systems. In contrast, removing ATP abolished the accumulation of [ 14 C]pantothenate only in the Eqn (1) system, whereas the Eqn (2) system retained approximately 50% exchange activity. This means that the pantothenate–b-alanine exchange in the Eqn (2) system has no absolute requirement for ATP, and this result was confirmed by a second set of iso- tope exchange assays (Table 2, Experiment II). When inorganic phosphate (P i ) was removed from the Eqn (2) system in addition to ATP, there was no sig- nificant further reduction in exchange activity, showing that both ATP and P i are dispensable. However, when both ATP and ADP were removed, the resulting exchange activity was negligible. In summary, MM2281 catalyzed significant transfer of 14 C-label from b-alanine to pantothenate in presence of pantoate and ADP. When pantoate was removed, the resulting pantothenate–b-alanine exchange was negligible. Also, the exchange reaction occurred only in the presence of adenosine nucleotide, and ADP but not AMP could satisfy this requirement. Again, this behavior shows that the MM2281 prepa- rations were not contaminated with E. coli PS, because bacterial PS requires only AMP to catalyze the panto- thenate–b-alanine isotope exchange [4,6]. The data in Table 2 also show that, apart from pantoate, both ATP and ADP have a strong effect on the rate of the MM2281-catalyzed pantothenate–b-alanine exchange reaction. The simplest explanation for this behavior is that pantoate, ATP and ADP are all substrates or products of MM2281, which is consistent with the notion that the enzyme is a synthetase that drives pantothenate formation by hydrolysis of ATP. MM2281 alone showed no detectable net synthesis of pantothenate in the forward assay (see above; Fig. 4), and the forward rate would be expected to be even lower in the presence of products. We assume, therefore, that the transfer of 14 C-label from b-alanine to pantothenate was due to isotope exchange. Maximal exchange activity occurred in the complete system of Eqn (2), pointing to Eqn (2) as the basic reaction for MM2281. Moreover, our data suggest that MM2281 is able to catalyze an ADP-dependent, but not an AMP-dependent, pantothenate–b-alanine exchange Table 2. MM2281-catalyzed isotope exchange between [ 14 C]b-ala- nine and pantothenate. MM2281 was assayed for its ability to transfer 14 C-label from [ 14 C]b-alanine to pantothenate in the pres- ence or absence of cosubstrates. The cosubstrates in the complete system are ATP, AMP, PP i , and pantoate (Eqn 1), or ATP, ADP, P i , and pantoate (Eqn 2). Different preparations of MM2281 were used in two independent experiments (Experiments I and II). Missing val- ues indicate that the cosubstrate combination indicated was not tested. ND, not detectable. Reactants Initial exchange rate a (%) Experiment I Experiment II Eqn (2) Complete system 100 100 Minus pantoate 2 Minus ATP 46 50 Minus ATP, minus pantoate 3 Minus ATP, minus P i 45 Minus ATP, minus ADP 3 Eqn (1) Complete system 20 Minus pantoate 1 Minus ATP ND Minus ATP, minus pantoate ND a Normalized to the value in the complete system of Eqn (2), which was equal to 2.5 and 1.5 · 10 )3 Æmin )1 in Experiments I and II, respectively. S. Ronconi et al. Pantothenate synthetase from Methanosarcina mazei FEBS Journal 275 (2008) 2754–2764 ª 2008 The Authors Journal compilation ª 2008 FEBS 2759 reaction in the presence of pantoate. This is difficult to reconcile with Eqn (1), and further supports Eqn (2) as the overall reaction catalyzed by MM2281. The resid- ual exchange activity in the complete system of Eqn (1) may be due to contamination of the commer- cial ATP preparation with ADP. We also considered the theoretical possibility that MM2281 is a hydrolase, which facilitates the equilib- rium between pantoate, b-alanine and pantothenate according to Eqn (3): D-pantoate þ b-alanine $ D-pantothenate ð3Þ Although there is no simple argument to rule out Eqn (3) as the basic reaction of MM2281, explaining the overall behavior of MM2281 in this way is very difficult and also generates a conflict with the reported value for K¢ Eqn (3) . Most importantly, Eqn (3) implies that ATP and ADP are not substrates of MM2281. The observed effects of ADP and ATP on the isotope exchange rate can then be explained by assuming that ADP and ATP effectively promote a switch from inac- tive to active enzyme. However, this is at odds with the observation that enzymatic removal of ADP accel- erated MM2281 in the forward direction (see above). Second, considering the equilibrium constant of Eqn (3) (K¢ Eqn (3) =1⁄ 42 at pH 8.1 and 25 °C [21]), this reaction clearly favors hydrolysis of pantothenate. Thus, based on Eqn (3) and K¢ Eqn (3) , the majority of the pantothenate in the isotope exchange assay used here would be converted to pantoate and b-alanine. Using K¢ Eqn (3) and the initial concentrations of panto- ate, b-alanine and pantothenate in the assay, the maximum fraction of 14 C-label associated with panto- thenate at equilibrium would be 35%. However, we observed that [ 14 C]pantothenate accumulated up to 60% of the total 14 C-label during the assay. This cor- responds to an equilibrium constant of ‡ 1 ⁄ 15, which is much larger than the reported value for K¢ Eqn (3) . Discussion Experimental confirmation of computationally predicted archaeal PS Metabolic reconstruction of the CoA biosynthetic pathway in representative organisms previously revealed that the Archaea lack known genes for the conversion of pantoate into 4¢-phosphopantothenate. The protein families COG1701 and COG1829 were then identified as the best candidates for the missing steps by comparative analysis of the 16 completely sequenced archaeal genomes available at the time [10]. The STRING database, which currently integrates 26 archaeal genomes, revealed additional functional asso- ciations that support a role for COG1701 and COG1829 in archaeal CoA biosynthesis (Fig. 1). On the basis of distant homology relationships, we tenta- tively assigned the PS and PANK functions to the COG1701 and COG1829 protein families, respectively. Three lines of experimental evidence support the computational prediction of archaeal PS. First, the cloned COG1701 member from Me. mazei (MM2281) partially complemented the auxotrophic phenotype of an E. coli mutant lacking PS activity (Fig. 3). Second, the recombinant proteins MM2281 and E. coli PANK together facilitated the synthesis of 4¢-phosphopantoth- enate from pantoate, b-alanine, and ATP (Fig. 4). Arguably, the enzyme preparations were not contami- nated with bacterial PS, allowing the conclusion that pantothenate synthesis in the coupled assays was due to MM2281. Third, MM2281 catalyzed the transfer of 14 C-label from b-alanine to pantothenate, presumably by isotope exchange, in a cosubstrate-dependent man- ner (Table 2). Given that function is typically con- served within orthologous groups [15], demonstration of PS activity for one member of the group provides strong support for the prediction that COG1701 repre- sents the archaeal PS protein family. Properties of MM2281 (Me. mazei PS) Our data suggest that MM2281 is an ADP-forming pantothenate synthetase (Eqn 2) that is subject to strong product inhibition by pantothenate. The behav- ior of MM2281 in the isotope exchange experiments clearly suggests that MM2281 is an adenosine nucleo- tide-dependent pantothenate synthetase and not a reversible pantothenate hydrolase. On the basis of the large values of the equilibrium constants for Eqns (1,2) (see above), the equilibria of both reactions can be assumed to lie on the side of pantothenate formation. In other words, regardless of the type of synthetase reaction, coupling of pantothenate synthesis from pan- toate and b-alanine to the hydrolysis of ATP will drive the equilibrium to the product side. Therefore, the strong acceleration of MM2281-catalyzed pantothenate synthesis by the removal of pantothenate is very prob- ably not due to a shift in the equilibrium of the reac- tion, leaving potent inhibition of MM2281 by pantothenate as the best explanation. We propose that MM2281 is an ADP-forming synthetase according to Eqn (2), because this is consistent with the observation that the synthesis of 4¢-phosphopantothenate through MM2281 and E. coli PANK was accompanied by the accumulation of ADP but not AMP (Fig. 5) and accel- erated by removing ADP. Furthermore, the isotope Pantothenate synthetase from Methanosarcina mazei S. Ronconi et al. 2760 FEBS Journal 275 (2008) 2754–2764 ª 2008 The Authors Journal compilation ª 2008 FEBS exchange data can readily be accounted for by Eqn (2) but not by Eqn (1). The highest PS activity of MM2281 observed in this study was 140 nmolÆmin )1 Æmg )1 , which is equivalent to a turnover of 0.07 s )1 . This is significantly below typi- cal values for k cat , which range from about 0.8 s )1 to 2 · 10 5 s )1 [22]. More specifically, the MM2281 activ- ity reported here was more than 15-fold lower than that of E. coli PS under optimal conditions (calculated from data in [2]) and nearly 50-fold lower than the k cat reported for My. tuberculosis PS [4]. Given the com- paratively low activity of MM2281, it is possible that the enzyme requires an activator or cofactor that was absent from the standard assay. One attractive candi- date for this role is the predicted PANK in Me. mazei (MM2282; Fig. 2), which may be more effective than E. coli PANK in accelerating MM2281. Moreover, conserved phylogenetic profiles and chromosomal proximity indicate a strong functional link between archaeal PS (COG1701) and archaeal PANK (COG1829) (Fig. 1). Also, lack of an interacting pro- tein required for optimal activity could explain why expression of MM2281 achieved only partial comple- mentation of the E. coli panC mutant (Fig. 3). How- ever, our attempts to express and purify MM2282 did not meet with success (data not shown), so this hypothesis could not be tested. The observation that MM2281 facilitated the panto- thenate–b-alanine exchange in the absence of ATP and P i may be taken to indicate that MM2281 is a Ping Pong enzyme able to catalyze a partial reaction. How- ever, the isotope exchange data in Table 2 show clearly that the kinetic mechanism of MM2281 is different from the Ping Pong system of bacterial PS. The latter consists of two half-reactions, which proceed via an enzyme-bound pantoyl adenylate intermediate [2–5]. As a result, the pantothenate–b-alanine exchange reac- tion of bacterial PS is independent of pantoate and has an absolute requirement for only AMP. By com- parison, the cosubstrate dependence of the MM2281- catalyzed exchange reaction differs on several counts (see above) and is inconsistent with the Ping Pong system of bacterial PS. This shows that archaeal PS evolved a distinct mechanism to synthesize pantothenate. Evolution of phosphopantothenate biosynthesis We hypothesize that the entire upstream portion of CoA biosynthesis, leading from common precursors to phosphopantothenate, evolved independently in the Bacteria and Archaea. This view was initially based on the finding that many archaeal genomes contain no homologs to any of the corresponding bacterial enzymes and on the prediction of distinct archaeal forms of PS and PANK [10]. The experimental evidence in this study provides strong support for the predicted identity of archaeal PS (COG1701). This, in turn, also supports the prediction of archaeal PANK (COG1829), because there are strong nonhomologous links between the two families (Fig. 1). The linear pathway from a-ketoisovalerate to phos- phopantothenate comprises four steps in the Bacteria (Fig. 1). So far, unrelated archaeal genes on this path- way have been computationally predicted for the third and fourth steps (i.e. PS and PANK), but not for the first and second steps [i.e. ketopantoate hydroxymeth- yltransferase (KPHMT) and ketopantoate reductase (KPR)]. Interestingly, the phyletic distribution of PS genes indicates that they were not subject to horizontal transfer, in either direction, between the archaeal and bacterial domains. Archaeal PS and PANK isoforms show strict co-occurrence and are present in most of the Archaea, except in the Thermoplasmata class of the Euryarchaeota and in Nanoarchaeum equitans. Also, they are absent from the Bacteria and Eukaryota. All of the Archaea that have archaeal-type PS and PANK universally lack homologs to bacterial or eukaryotic PS and PANK isoforms. In fact, bacte- rial PS is entirely absent from the archaeal domain, and archaeal homologs to bacterial PANK are limited to the Thermoplasmata class. A different situation is encountered for the first two CoA biosynthetic steps. In the Bacteria, these steps are catalyzed by KPHMT and KPR, which convert a-ketoisovalerate into pantoate. A subset of the non- methanogenic Archaea acquired these enzymes, pre- sumably by horizontal gene transfer, from thermophilic bacteria [10]. Individual archaeal genomes encode either both bacterial-type KPHMT and bacterial-type KPR or either one or none of them. This pattern suggests that some archaeal species produce pantoate by combining an archaeal KPHMT isoform with bacterial-type KPR or by combining an archaeal KPR isoform with bacterial-type KPHMT. In other words, the distribution of bacterial-type KPHMT and KPR genes supports the view that the majority of the Archaea contain so far unidentified genes that encode unrelated isoforms of KPHMT and KPR. Moreover, the observed distribution may well be the result of nonorthologous gene displacement [23], where the archaeal isoforms of KPHMT and KPR were individually replaced by their bacterial counterparts in certain archaeal species. Verification of this hypothesis awaits, of course, identification of the archaeal genes for pantoate synthesis. S. Ronconi et al. Pantothenate synthetase from Methanosarcina mazei FEBS Journal 275 (2008) 2754–2764 ª 2008 The Authors Journal compilation ª 2008 FEBS 2761 Given that horizontal gene transfer occurred exten- sively between the thermophilic Bacteria and Archaea [24,25], the question arises of why KPHMT and KPR genes were transferred, whereas PS genes were not. The archaeal PS (MM2281) characterized in this study produces pantothenate from the same precursors as bacterial PS but has clearly distinct kinetic properties. The most striking difference is the apparent inhibition of MM2281 by pantothenate, raising the possibility that this step has a role in regulating archaeal CoA biosynthesis. In contrast, the most important control point in bacterial CoA biosynthesis is PANK [9], and no regulatory function is known for PS. It is attractive to speculate, therefore, that horizontal gene transfer of PS, and possibly PANK, was suppressed by incom- patible regulatory properties. Experimental procedures Materials E. coli strain AT1371 [panC4, D(gpt-proA)62, lacY1, tsx-29, glnV44(AS), galK2(Oc), LAM-, Rac-0, hisG4(Oc), rfbD1, xylA5, mtl-1, argE3(Oc), thi-1] [26] was obtained from the E. coli Genetic Stock Center, Yale University. [3- 14 C]b-alanine (55 mCiÆmmol )1 ) was from American Radiolabeled Chemicals ⁄ Biotrend Chemikalien (Cologne, Germany). Rabbit pyruvate kinase and all other reagents were from Sigma-Aldrich (Munich, Germany) unless indi- cated otherwise. d-Pantoate was prepared from d-pantoyl lactone as described elsewhere [27]. Genomic DNA from the Me. mazei strain Goe1 (DSM 3647) was a gift from K. Pflu ¨ ger, Universita ¨ tMu ¨ nchen. Cloning of the Me. mazei and E. coli genes for PS The Me. mazei ORF MM2281 (GenBank accession number AE008384) was PCR-amplified from genomic DNA by using Pfu polymerase (Stratagene, Amsterdam, the Nether- lands) and the primers dGCGCGCATATGACcGATATtC CGCACGAtCACCCGcGcTACGAATCC and dGCGCGC TCGAGTtAGTAgCCgGTTTCCGCGGCCATGGT. The start and stop codons are in bold. Lower-case letters desig- nate silent nucleotide changes that were introduced to reduce the number of rare codons for expression in E. coli. The amplified ORF was subcloned via NdeI and XhoI restriction sites in the primers into the pET28-a vector (Novagen ⁄ Merck Chemicals, Darmstadt, Germany). The resulting plasmid, pET–MM2281, contains the MM2281 ORF in translational fusion with the vector-encoded N-terminal His-tag, leading to the expression of NH 2 - MGSSHHHHHHSSGLVPRGSH-MM2281. For functional complementation of the E. coli panC mutant (AT1371), the MM2281 ORF was reamplified from pET-MM2281 using the primers dGCGCG AGAAGGAG ATATACCATGACCGATATTCCGCACGATCACCCGC GC and dGCGCGCTCGAGTTAGTAGCCGGTTTCCG CGGCCATGGT. The ribosome-binding site in the for- ward primer is underlined, and the start and stop codons are in bold. The PCR product was inserted into the pGEM-T vector (Promega, Mannheim, Germany), and a clone carrying the MM2281 ORF in the correct orientation for expression under the lac promoter was selected and named pGEM–MM2281. The E. coli panC ORF was amplified from genomic DNA of E. coli strain XL1Blue (Stratagene) using Pfu polymerase and the primers dCGCGCCTCG AGGAGGAGTCACGTTATGTTAATTA TCGAAACC and dGCGCGTCTAGATTACGCCAGCTC GACCATTTT. The PCR product was inserted into pBlue- script KS (Stratagene) via the restriction sites XhoI and XbaI. The resulting plasmid (pBKS–panC) harbors the panC gene under the control of the lac promoter and served as a positive control in the functional complementation experiment. Automated DNA sequencing of the inserts in pET–MM2281, pGEM–MM2281 and pBSK–panC con- firmed the desired sequences. Functional complementation of E. coli AT1371 (panC – ) The plasmids pGEM–MM2281 and pBKS–panC (positive control) and the empty pBluescript KS– vector (negative control) were introduced into the pantothenate-auxotrophic E. coli strain AT1371. Single colonies of the transformants were grown overnight at 37 °C in 5 mL of liquid dYT medium (1.6% tryptone, 1% yeast extract, 0.5% NaCl) containing 100 lgÆlL )1 ampicillin. The E. coli cells were pelleted and washed twice in 5 mL of GB1 buffer [100 mm potassium phosphate, pH 7.0, 2 gÆL )1 (NH 4 ) 2 SO 4 ]. The pelleted cells were resuspended in GB1 buffer, adjusted to an D 600 nm of 0.3, and incubated at 25 °C for 1 h. The starved cells were then used to inoculate [0.5% (v ⁄ v)] the experimental cultures (4 gÆL )1 glucose, 0.25 gÆL )1 MgSO 4 .10H 2 O, 0.25 mgÆL )1 FeSO 4 .7H 2 O, 5 mgÆL )1 thia- mine, 68 mgÆL )1 adenine, 127 mgÆL )1 l-arginine, 16 mgÆL )1 l-histidine, 230 mgÆL )1 l-proline, and 100 mgÆL )1 ampicil- lin in GB1 buffer), which were grown at 37 °C with shaking. For each transformant, three cultures were started that contained an additional 1 mm pantothenate, 1 mm pantoate, or no further supplements, respectively. D 600 nm was determined over an incubation time of 24 h. Overexpression and purification of MM2281 and helper enzymes The MM2281 protein was expressed in E. coli BL21(DE3) carrying the pET–MM2281 plasmid described above and purified on Ni–nitrilotriacetic acid agarose (Qiagen, Hilden, Pantothenate synthetase from Methanosarcina mazei S. Ronconi et al. 2762 FEBS Journal 275 (2008) 2754–2764 ª 2008 The Authors Journal compilation ª 2008 FEBS Germany) following the manufacturer’s standard protocol. After affinity chromatography, MM2281 was loaded onto a MonoQ anion exchange column equilibrated in 50 mm Tris ⁄ HCl (pH 8.8). In a linear 0–1 m KCl gradient, MM2281 eluted at approximately 350 mm KCl. The enzyme preparation was then dialyzed exhaustively against 50 mm Tris ⁄ SO 4 (pH 8.0) and 5 mm dithiothreitol, frozen in liquid N 2 , and stored in aliquots at )70 °C. The native molecular mass of MM2281 was estimated by gel filtration chromatography as previously described [6]. E. coli PS [6] and E. coli PANK [28] were overexpressed and purified as previously described. Protein concentrations were deter- mined using the Bradford protein assay kit (Bio-Rad, Munich, Germany) with BSA as standard. Enzyme assays The standard assay for PS activity contained 20 mm potas- sium d-pantoate, 1 mm b-alanine, 0.08 mm [3- 14 C]b-alanine (55 mCiÆmmol )1 ), 5 mm ATP, 10 mm MgSO 4 , 7.5 mm K 2 SO 4 ,5mm dithiothreitol, 50 mm Tris ⁄ SO 4 (pH 8.0) and 2.5 lg of MM2281 in a final volume of 25 lL. The reaction was initiated by the addition of substrates, and incubated at 37 °C, and 5 lL aliquots were removed at 30, 90 and 180 min time points. Separation of reaction products (10 nCi aliquots) by TLC, quantitation of 14 C-label above nonenzymatic activity and estimation of initial rates was as previously described [6]. The detection of 14 C-label was lin- ear between 0.1 and 20 nCi, covering a range of 1–100% of the amount analyzed per time point. The assay was carried out in the absence or presence of E. coli PANK (2.5 lg) or pyruvate kinase from rabbit (2 units). Phosphoenolpyruvate (2 mm) was included in the assay when pyruvate kinase was present. Control reactions in the absence of MM2281 con- tained either or both of the helper enzymes E. coli PS (1 lg) and E. coli PANK (2.5 lg) or no enzymes. In order to detect possible adenosine nucleotide products of MM2281, standard assays containing MM2281 alone or together with E. coli PANK were carried out as described above, except that [3- 14 C]b-alanine was omitted. The reac- tion was quenched after 180 min, and the products were cochromatographed with authentic ATP, ADP and AMP standards (Sigma). Adenosine nucleotides were separated on silica plates using dioxane ⁄ NH 3 (25%) ⁄ H 2 O(6:1:4) as a mobile phase and detected under UV light (254 nm). Isotope exchange assay The pantothenate–b-alanine isotope exchange was assayed at 25 °C, and the standard reaction contained 1 mm b-ala- nine, 0.07 mm [3- 14 C] b-alanine (55 mCiÆmmol )1 ), 5 mm pantothenate, 5 mm ADP, 5 mm sodium phosphate, 5 mm ATP, 20 mm potassium d-pantoate, 10 mm MgSO 4 , 7.5 mm K 2 SO 4 ,5mm dithiothreitol, 50 mm Tris ⁄ SO4 (pH 8.0), and 1.1 lgÆlL )1 MM2281. Individual reactions contained all of the above components [Eqn (2), complete system] or lacked one or more of the reactants ATP, ADP, pantoate, or sodium phosphate. A second set of exchange reactions was carried out with AMP and sodium pyrophos- phate replacing ADP and sodium phosphate in the above scheme [Eqn (1), complete system]. Aliquots were removed from the reactions at 7, 24 and 48 h after initiation by the addition of MM2281. Quantitation of 14 C-label associated with pantothenate and b-alanine and estimation of initial exchange velocities was as previously described [6]. Nonhomologous functional links In order to verify the prediction of COG1701 and COG1829 as the missing steps in archaeal CoA biosynthesis [10], the STRING database [16] was searched for nonho- mologous functional links using the criteria ‘Neighborhood’ (conserved chromosomal proximity) and ‘Co-occurrence’ (conserved phylogenetic profile). To this end, the archaeal members of the protein families COG0413, COG1893, COG0452, COG1019, and COG0237, which are implied in archaeal CoA biosynthesis through homology (Fig. 1), were used as protein queries. Functional links to COG1701 or COG1829 were classified as strong links (high or highest confidence in STRING) or weak links (low or medium con- fidence in STRING). Acknowledgements We would like to thank Katharina Pflu ¨ ger, Universita ¨ t Mu ¨ nchen, for genomic DNA from Me. mazei, and Ishac Nazi, McMaster University, for the E. coli PANK expression plasmid pPANK. We also thank Erich Glawischnig for critically reading this manu- script. S. Ronconi was funded by graduate scholar- ships from the German Academic Exchange Service (DAAD) and Technische Universita ¨ tMu ¨ nchen (Frauenbu ¨ ro). Work on pantothenate and CoA biosynthesis in this laboratory was funded by the Deutsche Forschungsgemeinschaft. References 1 Kanehisa M, Goto S, Hattori M, Aoki-Kinoshita KF, Itoh M, Kawashima S, Katayama T, Araki M & Hirak- awa M (2006) From genomics to chemical genomics: new developments in KEGG. Nucleic Acids Res 34, D354–D357. 2 Miyatake K, Nakano Y & Kitaoka S (1979) Pantothe- nate synthetase from Escherichia coli [D-pantoate: beta- alanine ligase (AMP-forming), EC 6.3.2.1]. Methods Enzymol 62, 215–219. 3 von Delft F, Lewendon A, Dhanaraj V, Blundell TL, Abell C & Smith AG (2001) The crystal structure of S. Ronconi et al. Pantothenate synthetase from Methanosarcina mazei FEBS Journal 275 (2008) 2754–2764 ª 2008 The Authors Journal compilation ª 2008 FEBS 2763 [...]... Crystal structure of the pantothenate synthetase from Mycobacterium tuberculosis, snapshots of the enzyme in action Biochemistry 45, 1554–1561 Jonczyk R & Genschel U (2006) Molecular adaptation and allostery in plant pantothenate synthetases J Biol Chem 281, 37435–37446 Jackowsky S (1996) Biosynthesis of pantothenate and coenzyme A In Escherichia coli and Salmonella typhimurium: Cellular and Molecular.. .Pantothenate synthetase from Methanosarcina mazei 4 5 6 7 8 9 10 11 12 13 14 15 S Ronconi et al E coli pantothenate synthetase confirms it as a member of the cytidylyltransferase superfamily Structure 9, 439–450 Zheng R & Blanchard JS (2001) Steady-state and pre-steady-state kinetic analysis of Mycobacterium tuberculosis pantothenate synthetase Biochemistry 40, 12904–12912 Wang S & Eisenberg... Schwarz W (2006) 4¢-Phosphopantetheine biosynthesis in Archaea J Biol Chem 281, 5435–5444 Brand LA & Strauss E (2005) Characterization of a new pantothenate kinase isoform from Helicobacter pylori J Biol Chem 280, 20185–20188 Overbeek R, Fonstein M, D’Souza M, Pusch GD & Maltsev N (1999) The use of gene clusters to infer functional coupling Proc Natl Acad Sci USA 96, 2896–2901 Tatusov RL, Koonin EV... Littel KJ & Jackowski S (1982) Genetic and biochemical analyses of pantothenate biosynthesis in Escherichia coli and Salmonella typhimurium J Bacteriol 149, 916–922 27 King HL Jr, Dyar RE & Wilken DR (1974) Ketopantoyl lactone and ketopantoic acid reductases Characterization of the reactions and purification of two forms of ketopantoyl lactone reductase J Biol Chem 249, 4689– 4695 28 Nazi I, Koteva KP & Wright... different protein folds: the hexokinase, ribokinase, and galactokinase families of sugar kinases Protein Sci 2, 31–40 18 Soding J (2005) Protein homology detection by HMM– ¨ HMM comparison Bioinformatics 21, 951–960 19 Pang SS, Duggleby RG & Guddat LW (2002) Crystal structure of yeast acetohydroxyacid synthase: a target for herbicidal inhibitors J Mol Biol 317, 249–262 20 Airas RK (1988) Pantothenases from... scenario based on comparative genomics Mol Biol Evol 21, 1242–1251 Armengaud J, Fernandez B, Chaumont V, Rollin-Genetet F, Finet S, Marchetti C, Myllykallio H, Vidaud C, Pellequer JL, Gribaldo S et al (2003) Identification, purification, and characterization of a eukaryotic-like phosphopantetheine adenylyltransferase (coenzyme A biosynthetic pathway) in the hyperthermophilic archaeon Pyrococcus abyssi J... (Neidhardt FC, ed), pp 687–694 American Society for Microbiology, Washington, DC Begley TP, Kinsland C & Strauss E (2001) The biosynthesis of coenzyme A in bacteria Vitam Horm 61, 157–171 Leonardi R, Zhang YM, Rock CO & Jackowski S (2005) Coenzyme A: back in action Prog Lipid Res 44, 125–153 Genschel U (2004) Coenzyme A biosynthesis: reconstruction of the pathway in archaea and an evolutionary scenario... YI, Walker DR & Koonin EV (1998) Evidence for massive gene exchange between archaeal and bacterial hyperthermophiles Trends Genet 14, 442–444 25 Nelson KE, Clayton RA, Gill SR, Gwinn ML, Dodson RJ, Haft DH, Hickey EK, Peterson JD, Nelson WC, Ketchum KA et al (1999) Evidence for lateral gene transfer between Archaea and bacteria from genome sequence of Thermotoga maritima Nature 399, 323–329 26 Cronan... Koonin EV & Lipman DJ (1997) A genomic perspective on protein families Science 278, 631–637 2764 16 von Mering C, Jensen LJ, Kuhn M, Chaffron S, Doerks T, Kruger B, Snel B & Bork P (2007) ¨ STRING 7 – recent developments in the integration and prediction of protein interactions Nucleic Acids Res 35, D358–D362 17 Bork P, Sander C & Valencia A (1993) Convergent evolution of similar enzymatic function on... from pseudomonads produce either pantoyl lactone or pantoic acid Biochem J 250, 447–451 21 Alberty RA (1993) Levels of thermodynamic treatment of biochemical reaction systems Biophys J 65, 1243– 1254 22 Segel IH (1975) Enzyme Kinetics, pp 79–80 John Wiley & Sons, New York, NY 23 Koonin EV, Mushegian AR & Bork P (1996) Nonorthologous gene displacement Trends Genet 12, 334– 336 24 Aravind L, Tatusov RL, . most of the Archaea, except in the Thermoplasmata class of the Euryarchaeota and in Nanoarchaeum equitans. Also, they are absent from the Bacteria and Eukaryota homology in individual archaeal genomes. However, there are no archaeal homologs to known isoforms of pantothenate synthetase (PS) or pantothenate kinase. Using