Báo cáo khoa học: Transient potential receptor channel 4 controls thrombospondin-1 secretion and angiogenesis in renal cell carcinoma ppt

13 583 0
  • Loading ...
    Loading ...
    Loading ...

Tài liệu hạn chế xem trước, để xem đầy đủ mời bạn chọn Tải xuống

Tài liệu liên quan

Thông tin tài liệu

Ngày đăng: 07/03/2014, 05:20

Transient potential receptor channel 4 controlsthrombospondin-1 secretion and angiogenesisin renal cell carcinomaDorina Veliceasa1, Marina Ivanovic2, Frank Thilo-Schulze Hoepfner1, Praveen Thumbikat1,Olga V. Volpert1and Norm D. Smith11 Department of Urology, Northwestern University Feinberg School of Medicine, Chicago, IL, USA2 Department of Pathology, Northwestern University Feinberg School of Medicine, Chicago, IL, USAKeywordsangiogenesis; calcium metabolism; renalcancer; thrombospondinCorrespondenceO. V. Volpert, Department of Urology,Northwestern University, 303 East ChicagoAve., Chicago, IL 60611, USAFax: +1 (312) 908 7275Tel: +1 (312) 503 5934E-mail: olgavolp@northwestern.edu(Received 4 June 2007, revised 14 Septem-ber 2007, accepted 18 October 2007)doi:10.1111/j.1742-4658.2007.06159.xAngiogenic switch in renal cell carcinoma (RCC) is attributed to theinactivation of the von Hippel–Lindau tumor suppressor, stabilization ofhypoxia inducible factor-1 transcription factor and increased vascularendothelial growth factor. To evaluate the role of an angiogenesis inhibitor,thrombopsondin-1 (TSP1), we compared TSP1 production in human RCCand normal tissue and secretion by the normal renal epithelium (humannormal kidney, HNK) and RCC cells. Normal and RCC tissues stainedpositive for TSP1, and the levels of TSP1 mRNA and total protein weresimilar in RCC and HNK cells. However, HNK cells secreted high TSP1,which rendered them nonangiogenic, whereas RCC cells secreted littleTSP1 and were angiogenic. Western blot and immunostaining revealedTSP1 in the cytoplasm of RCC cells on serum withdrawal, whereas, inHNK cells, it was rapidly exported. Seeking mechanisms of defective TSP1secretion, we discovered impaired calcium uptake by RCC in response tovascular endothelial growth factor. In HNK cells, 1,2-bis(o-aminophen-oxy)ethane-N,N,N¢,N¢-tetraacetic acid acetoxymethyl ester, a calcium chela-tor, simulated TSP1 retention, mimicking the RCC phenotype. Furtheranalysis revealed a profound decrease in transient receptor potential canon-ical ion channel 4 (TRPC4) Ca2+channel expression in RCC cells. TRPC4silencing in HNK cells caused TSP1 retention and impaired secretion. Dou-ble labeling of the secretory system components revealed TSP1 colocaliza-tion with coatomer protein II (COPII) anterograde vesicles in HNK cells.In contrast, in RCC cells, TSP1 colocalized with COPI vesicles, pointing tothe retrograde transport to the endoplasmic reticulum caused by misfold-ing. Our study indicates that TRPC4 loss in RCC leads to impaired Ca2+intake, misfolding, retrograde transport and diminished secretion of anti-angiogenic TSP1, thus enabling angiogenic switch during RCC progression.AbbreviationsBAPTA-AM, 1,2-bis(o-aminophenoxy)ethane-N,N,N¢,N¢-tetraacetic acid acetoxymethyl ester; bFGF, basic fibroblast growth factor; CEP,circulating endothelial precursor; CM, conditioned media; COP, coatomer protein; CXCR2, CXC chemokine receptor 2; EGF, epidermalgrowth factor; ER, endoplasmic reticulum; ERGIC, ER–Golgi intermediate compartment; FITC, fluorescein isothiocyanate; GAPDH,glyceraldehyde-3-phosphate dehydrogenase; HIF, hypoxia inducible factor; HMVEC, human microvascular endothelial cell; HNK, humannormal kidney, normal renal epithelial strain; HRP, horseradish peroxidase; HSP, heat shock protein; IL, interleukin; PDGFR, platelet-derivedgrowth factor receptor; PEDF, pigment epithelial-derived factor; PTEN, phosphatase and tensin analog; RCC, renal cell carcinoma; TIMP,tissue inhibitor of metalloproteinase; TRPC4, transient receptor potential canonical ion channel 4; TSP1, thrombospondin-1; VEGF, vascularendothelial growth factor; VHL, von Hippel–Lindau.FEBS Journal 274 (2007) 6365–6377 ª 2007 The Authors Journal compilation ª 2007 FEBS 6365The prevailing treatments for kidney cancer are sur-gery and immunotherapy. Until 2005, only high-doseinterleukin-2 (IL-2) had been approved by the USFood and Drug Administration (FDA) [1]. As immu-notherapy has unfavorable side-effects, new targetedtherapies to counter the molecular triggers of renal cellcarcinoma (RCC) are in high demand.Clear cell RCC is largely caused by inactivation ofthe von Hippel–Lindau (VHL) tumor suppressor [2].The main target of the VHL tumor suppressor ishypoxia inducible factor-1a (HIF1a), an oxygen-sens-ing transcription factor, which undergoes regulatoryhydroxylation at normal Po2[3]. The VHL tumorsuppressor binds hydroxylated HIF1a, targets it forproteasome degradation and thus suppresses HIF pro-angiogenic targets, vascular endothelial growth factor(VEGF) and erythropoietin, and pro-survival targets,enabling stress-induced apoptosis [4]. Novel RCCtherapies target VEGF (Avastin) [5] or its receptor(sunitinib, sorafenib) [6]. The latter also target VEGF-producing tumor stroma by inactivating another tyro-sine kinase, platelet-derived growth factor receptor-b(PDGFRb) [1]. However, VEGF induction by HIF1aalone is insufficient to promote the growth of RCCxenografts [7].The exclusive role of VEGF in RCC progres-sion ⁄ angiogenesis has been challenged by the studiesof other angiogenic stimuli, including ELR+ CXCchemokines, such as IL-8, and CXC chemokine recep-tor 2 (CXCR2) ligands [8,9] or IL-2 via CXCR3 [10]or basic fibroblast growth factor (bFGF) and epider-mal growth factor (EGF) [11–14].In contrast, antiangiogenic proteins in RCC progres-sion and angiogenesis have been largely ignored. A fewstudies have implicated pigment epithelial-derived fac-tor (PEDF) in Wilms’ tumor [15]; however, there areno data that link PEDF and RCC. Other studies havedemonstrated that the more aggressive Wilms’ tumorsare characterized by low levels of antiangiogenicthrombospondin-1 (TSP1) [16]. TSP1 is also secretedby glomerular mesangial cells [17]. In another study,small, mildly angiogenic tumors were found to producemore TSP1 than more aggressive counterparts [18].We therefore hypothesize that TSP1 supports normalkidney angiostasis, and that its loss contributes to theRCC angiogenic phenotype.TSP1 is a multifunctional extracellular matrix pro-tein, and a potent and versatile angiogenesis inhibitorthat is critical for the maintenance of the antiangiogen-ic microenvironment in multiple organ sites, includingbreast, brain, colon and skin [19]. Conversely, re-intro-duction of TSP1 or its active peptides blocks angiogen-esis in a variety of experimental tumors and metastases[20]. The tumor suppressor genes p53, phosphataseand tensin analog (PTEN) and SMAD4 maintain nor-mal, high levels of TSP1 expression (reviewed in [21]).Conversely, the oncogenes Id-1, Jun, Myc, Ras andSrc repress TSP1 production and thus flip the angio-genic switch on and enable tumor growth [21]. TSP1inhibits multiple endothelial cell functions, such asmigration, proliferation and lumen formation [20]. Inaddition, TSP1 causes endothelial cell apoptosis andthus compromises the integrity of the tumor vascula-ture [22]. Finally, TSP1 regulates the numbers of circu-lating endothelial precursor (CEP) cells, and therebyimpinges on VEGF-mediated CEP cell recruitment tothe sites of neovascularization [23]. A knowledge ofthe molecular mechanisms that cause TSP1 loss in thetumor microenvironment is instrumental to determinea subset of tumors that would benefit from TSP1-based therapies and to aid in the development of noveltargeted therapies to control them.In this article, we show that disrupted TSP1 secre-tion renders RCC cells pro-angiogenic. Seeking under-lying mechanisms, we found that RCC cells fail tomount calcium uptake in response to growth factors,probably as a result of the low expression levels of thetwo calcium exchange proteins, calbindin and transientreceptor potential canonical ion channel 4 (TRPC4).Calcium deficiency is critical for the correct foldingand secretion of TSP1: the calcium chelator 1,2-bis(o-aminophenoxy)ethane-N,N,N¢,N¢-tetraacetic acid acet-oxymethyl ester (BAPTA-AM) caused retrogradetransport and retention of TSP1 by otherwise normalrenal epithelium (human normal kidney, normal renalepithelial strain, HNK). TSP1 misfolding caused bycalcium deficiency led to its retrograde transport, intra-cellular retention and diminished secretion. Thus, theloss of TSP secretion as a result of epigenetic changesmay deplete antiangiogenic TSP1 in the tumor envi-ronment and cause conditions permissive for angio-genesis.ResultsTSP1 suppresses angiogenesis in normal kidneyepitheliumSeeking a role for TSP1 in the evolution of the angio-genic response in RCC, we stained 11 human RCCspecimens and six specimens of adjacent normal tissuefor TSP1. Based on the assumption that TSP1 main-tains angiostasis in the kidney, we expected TSP1 tobe lower in RCC tissues. Surprisingly, RCC and adja-cent normal tissue showed similar staining intensities(Fig. 1A; Table 1).Thrombospondin-1 loss in renal cancer D. Veliceasa et al.6366 FEBS Journal 274 (2007) 6365–6377 ª 2007 The Authors Journal compilation ª 2007 FEBSABCDEFFig. 1. Role of TSP1 in angiogenesis, andlocalization in renal cells and tissue. (A) Sec-tions of RCC tumors and adjacent normaltissue (HNK) were stained for TSP1 andcounterstained with hematoxylin. (B, C) CMfrom HNK and P769 RCC cells were testedin the mouse corneal assay. TSP1 in HNKcells was silenced using siRNA; the silenc-ing was verified by RT-PCR and westernblot of CM (B). VEGF was neutralized withantibodies (C). Representative corneas areshown. There was a lack of angiogenicresponse to HNK CM and a robust responseto RCC CM. In addition, TSP1 neutralizationrestored the angiogenic activity of HNK CM;VEGF neutralizing antibodies reversed thiseffect and abolished the angiogenic activityof RCC CM. (D) RNA isolated from the indi-cated cell lines was subjected to semiquan-titative RT-PCR with TSP1 primers. HNK,normal cell strain; P769, PRC9, SW839,ARZ-1 and WT8, RCC cell lines. (E) Thesame cell lines were subjected to 24 hserum deprivation, CM and cell lysates (CMand L, respectively) were collected andTSP1 was detected by western blotting.Note the low TSP1 secretion and higherintracellular levels in RCC cells. (F) HNK andP769 cells were cultured for 24 h in fullserum or serum-free medium, fixed andstained for TSP1. Note the depletion ofTSP1 in the cytoplasm of normal cells.D. Veliceasa et al. Thrombospondin-1 loss in renal cancerFEBS Journal 274 (2007) 6365–6377 ª 2007 The Authors Journal compilation ª 2007 FEBS 6367In contrast, HNK and RCC cell lines differed intheir ability to induce angiogenesis. Conditioned media(CM) from P769 and other RCC cell lines werepotently angiogenic in rat and mouse corneal assay forangiogenesis. CM from normal HNK cells was non-angiogenic; however, it became angiogenic if TSP1was either neutralized with antibodies or silenced usingsiRNA (Fig. 1B,C; Table 2). 786-O-WT8 cells wereweakly angiogenic in vivo and in vitro as a result of thelow levels of secreted VEGF; angiogenesis was onlymarginally altered by TSP1 depletion (Table 2).Both HNK and RCC cells produced VEGF (mea-sured by ELISA); RCC cells produced three- to four-fold more VEGF than HNK or 698-O-WT8 cells(Table 3). In contrast, quantitative western blotsshowed that HNK CM were high in TSP1[ 2.6 lgÆ(100 lg total protein))1], whereas RCC cellssecreted less than 0.12 lgÆ(100 lg protein))1, regardlessof VHL status (Table 3; Fig. 1E). Using human micro-vascular endothelial cell (HMVEC) chemotaxis as anin vitro measure of angiogenesis, we determined thespecific activity (ED50) of each CM alone and withVEGF or TSP1 neutralized (Table 3). CM from 786-O-ARZ, PRC9, SW839 and p769 showed high specificactivity, reflective of the VEGF levels. In contrast, theHNK CM was nonangiogenic: TSP1 depletion withneutralizing antibodies revealed underlying angiogenicactivity in HNK cells, which, in turn, was blocked byVEGF antibodies (Table 3).RCC, but not normal kidney epithelium, retainsTSP1Despite the difference in secreted TSP1, TSP1 mRNAlevels were similar in HNK and RCC cells (Fig. 1D).RCC and HNK cells also produced roughly equaltotal TSP1 protein [43 ± 5.3 and 42 ± 7.1 ngÆ(10 lgprotein))1, respectively, P ¼ 0.48], as calculated usingdata from Fig. 1E.However, RCC cells secreted noticeably less TSP1than did HNK cells (Fig. 1E). In contrast, lysatesof serum-starved HNK cells contained no detectableTSP1, whereas TSP1 was found at high levels in thecytoplasm of all RCC lines (Fig. 1E). Immunocyto-chemistry of fixed cells showed robust cytoplasmicstaining for TSP1 in both HNK and RCC cells culturedTable 1. TSP1 and VEGF immunostaining of kidney cancer andnormal tissue. Human tumor samples were stained for TSP1 andVEGF, respectively. The slides were scored by two independentpathologists (double-blind study).Tissue ortumor typeTSP1 VEGFCase (n)Stainingintensity Case (n)StainingintensityNormal tissue 4 +++ 5 +2 ++ 1 +++RCC, grade 1–2 4 +++ 4 +++3++21+++RCC grade 3–4 1 +++ 2 +++3++3++Table 2. Corneal angiogenesis by conditioned media (CM). Media conditioned by the indicated cell lines were tested in rataor mousebcor-neal neovascularization assay (see Experimental procedures). The results are expressed as positive corneas of the total implanted. To evalu-ate the statistical significance of the changes in angiogenic activity as a result of inactivation of TSP1 and ⁄ or VEGF, the results wereexpressed as the percentage of positive responses, grouped and subjected to Student’s t-test. TSP1 inactivation in the HNK CM (antibodyor siRNA silencing) significantly increased its angiogenic activity (P ¼ 0.023); further addition of VEGF inactivating antibodies returned theangiogenic activity to levels that were not significantly different from those of the initial HNK CM (P ¼ 0.085); angiogenesis by CM from allthe tumor cell lines was significantly different from that of the HNK cells and WT8 revertant (P ¼ 0.0026). VEGF neutralizing antibodydecreased angiogenesis by P769 to a value that was not significantly different from that of unaltered HNK CM (P ¼ 0.13) and was signifi-cantly lower than the activity of unaltered tumor CMs (P ¼ 0.0002).AntibodyPositive responses per total implants for CMHNK PRC9 P769 SW839 786-O-ARZ 786-O-WT8None 0 ⁄ 6a(0%) 7 ⁄ 8a(87.5%) 8 ⁄ 8a(100%)5 ⁄ 6b(83.3%)6 ⁄ 8a(75%) 7 ⁄ 8a(87.5%) 2 ⁄ 7a(28.5%)TSP1 Ab 5 ⁄ 8a(62.5%)VEGF Ab 1 ⁄ 8a(12.5%) 3 ⁄ 8a(37.5%)1 ⁄ 8b(12.5%)2 ⁄ 8a(25%) 1 ⁄ 8a(12.5%) 0 ⁄ 5a(0%)TSP1 Ab + VEGF Ab 2 ⁄ 9b(2.2%)Scrambled siRNA 1 ⁄ 9b(11%)TSP1 siRNA 8 ⁄ 10b(80%)TSP1 siRNA + VEGF Ab 4 ⁄ 10b(40%)aTested in rat.bTested in mouse.Thrombospondin-1 loss in renal cancer D. Veliceasa et al.6368 FEBS Journal 274 (2007) 6365–6377 ª 2007 The Authors Journal compilation ª 2007 FEBSin full serum. After 12–24 h without serum, TSP1 wasdepleted from the HNK cytoplasm as a result of secre-tion, but retained by P769 RCC (Fig. 1F). VHL tumorsuppressor had no effect on secreted TSP1: TSP1 secre-tion was comparable in 786-O-WT8, 786-O-ARZ andother RCC lines (Fig. 1C,D).RCC cells show decreased calcium uptakeImproper folding may cause protein retention. Impor-tantly, calcium binding strongly affects TSP1 folding[24]. In the case of pseudoachondroplasia, TSP5 muta-tions in the calcium-binding cassette alter its ability totransit endoplasmic reticulum (ER) and to undergosecretion [25,26]. We hypothesized that different TSP1secretion may result from different calcium availabilityin HNK and RCC cells. We measured calcium uptakeby the cells stimulated by VEGF: 10 ngÆmL)1VEGFcaused no measurable intake of Ca2+in RCC cells,whereas HNK cells developed a robust response(Fig. 2A,B). Moreover, RCC cells responded poorly toIonomycin, a potent Ca2+ionophore, relative toHNK (Fig. 2B). In addition, treatment of HNK withBAPTA-AM, a cell-permeating calcium chelator,caused a significant increase in cytoplasmic TSP1 anda concomitant decrease in secreted TSP1 (measured bywestern blot and immunostaining; Fig. 2C,D). TSP1appeared unique in this respect: 10 mm BAPTA-AMhad no effect on the intracellular content and secretionof VEGF, but induced TSP1 retention and diminishedsecretion (Fig. 2E).RCC expresses low TRPC4 and calbindinSeeking reasons for the altered calcium metabolism,we examined TRPCs, which mediate agonist-stimu-lated Ca2+influx [27]. Semiquantitative and real-timeRT-PCR showed significant expression of TRPC1,TRPC4, TRPC6 and TRPC7 in HNK cells(Fig. 3A,B). In RCC cells, TRPC4 expression wasdecreased four-fold (Fig. 3A,B). TRPC4 expressionand function are established in the vasculature, butnot in the kidney. Importantly, TRPC5, the TRPC4analog, was not expressed in HNK or RCC cells(Fig. 3A,B); thus, there was no functional redundancy.HNK cells expressed high levels of the calcium-bind-ing protein, calbindin D28K [28] (Fig. 3C). In normalkidney, calbindins transport calcium ions across theglomerular epithelium and serve as buffers, to preventtoxic concentrations of intracellular calcium [29]. Con-sistent with published data, RCC cells expressed nocalbindin D28K, probably because of their poorlydifferentiated state (Fig. 3C).Functional TRPC4 was indeed critical for TSP1secretion: TRPC4 siRNA transfection of HNK cellscaused an increase in cytoplasmic and a decrease insecreted TSP1 (Fig. 3D).RCC cells retain TSP1 in the EROne possible consequence of misfolding is protein‘recall’ to the ER from the ER–Golgi intermediatecompartment (ERGIC), a site for concentrating retro-grade cargo [30]. Anterograde transport vesicles con-tain coatomer protein II (COPII), whereas retrogradevesicles contain COPI [31,32]. In RCC cells and HNKcells treated with BAPTA-AM, TSP1 colocalized withER markers, but not with Golgi, suggesting retrogradetransport (Fig. 4A–E). When HNK and p769 cells weresubjected to 4 h of serum deprivation to prompt secre-tion, fixed and stained for TSP1 and Sec23 (COPIIcomponent) or c2-Cop (COPI marker), TSP1 colocal-ized with Sec23 ⁄ COPII in HNK cells; colocalizationwith c2-Cop ⁄ COPI was minimal in HNK cells,Table 3. Angiogenic characteristics of the conditioned media (CM). CM from the indicated cell lines were collected and subjected to the fol-lowing analyses: (a) VEGF levels were measured by ELISA; (b) TSP1 levels were measured by densitometry analysis of western blots; (c)ED50was measured in the endothelial cell chemotaxis assay; ED50of RCC CM was also measured in the presence of VEGF neutralizingantibody (1 lgÆmL)1) and TSP1 neutralizing antibody (2.5 lgÆmL)1) where shown; (d) corneal angiogenesis was tested in rat assay (seeExperimental procedures) and scored. Pellets contained 1.25 or 2.5 lg of total protein. The antibodies were added at 2 and 5 lg per pelletwhere indicated. N ⁄ A, not assessed.CMSecretedVEGF (pgÆmg)1)Secreted TSP(lgÆmg)1)ED50(lgÆmL)1) Corneal angiogenesisTSP1 Ab No Ab VEGF Ab TSP1 Ab No Ab VEGF AbHNK 320 ± 80 2.6 ± 0.46 > 20 N ⁄ A 0.33 – N ⁄ A+PRC9 1140 ± 310 0.15 ± 0.08 0.10 7.9 N ⁄ A++ – N⁄ ASW839 830 ± 220 0.07 ± 0.05 0.17 9.2 N ⁄ A++ +⁄ –N⁄ AP769 1060 ± 270 0.19 ± 0.1 0.12 6.8 N ⁄ A++ +⁄ –N⁄ A786-O-ARZ 1310 ± 330 0.11 ± 0.4 0.05 12.0 N ⁄ A++ – N⁄ A786-O-WT8 130 ± 30 0.06 ± 0.03 0.52 > 20 N ⁄ A+⁄ –– +⁄ –D. Veliceasa et al. Thrombospondin-1 loss in renal cancerFEBS Journal 274 (2007) 6365–6377 ª 2007 The Authors Journal compilation ª 2007 FEBS 6369ABCDFig. 3. Calcium channels and calbindin in HNK and P769 cells. (A, B) mRNA levels for TRPC1–7 were evaluated in HNK and P769 cells bysemiquantitative RT-PCR (A) or Q-PCR (B), using GAPDH message as control. (C) Western blot for calbindin D28K. (D) HNK cells were trans-fected with TRPC4 siRNA or scrambled control siRNA and cultured for 12 h in full medium. After an additional 48 h in serum-free medium,RNA and CM were collected. The silencing was ascertained by semiquantitative RT-PCR (approximately 45% decrease in the messagelevel). Lysates (L) and CM were analyzed by western blotting for TSP1 content. Note the cytoplasmic retention and decreased TSP1 secre-tion in HNK-siTRPC4.ABCDEFig. 2. Calcium uptake and mediators in HNK and RCC cells. (A) Ca2+uptake in response to VEGF by HNK and RCC cells. HNK and RCCcells were preloaded with fluo-4 acetoxymethyl ester and treated with 10 ngÆmL)1VEGF. Ca2+uptake was measured at 10 s intervals byvideofluorescence imaging. (B) Representative images of fluo-4 acetoxymethyl ester-loaded cells prior to and after VEGF exposure. (C, D)Changes in TSP1 secretion ⁄ retention in response to the calcium chelator BAPTA-AM. HNK cells were cultured for 12 h in serum-free med-ium with the indicated BAPTA-AM concentrations. (C) The TSP1 content per milligram of protein was calculated using comparison with serialTSP1 dilutions (standard curve) on western blot. (D) Representative blots of cell lysates (L, top, 20 lg per lane) and CM (CM, bottom, 5 lgper lane) were collected in parallel experiments. (E) HNK and P769 cells were cultured for 12 h with or without BAPTA-AM (1 nM). CM andlysates were collected as above and analyzed by western blotting. Note the retention of TSP1 in the cytoplasm and decreased secretion bythe BAPTA-AM-treated HNK cells. Also note the higher VEGF levels in the cytoplasm and CM of P769 cells, and the lack of response toBAPTA-AM. C, purified TSP1 or VEGF, respectively.Thrombospondin-1 loss in renal cancer D. Veliceasa et al.6370 FEBS Journal 274 (2007) 6365–6377 ª 2007 The Authors Journal compilation ª 2007 FEBSindicating anterograde transport and secretion (Fig. 5).By contrast, in p769 cells, TSP1 colocalized withc2-Cop ⁄ COPI, suggesting retrograde transport (Fig. 5).DiscussionNormal adult vasculature is quiescent as a result of thebalanced expression of pro- and antiangiogenic factors[33,34]. Multiple inducers of angiogenesis (VEGF,bFGF, IL-8, stromal cell-derived factor-1, etc.), whenexpressed at high levels, expand tumor vasculature[35]. Most strategies target angiogenic stimuli, theirreceptors or receptor tyrosine kinase activity [36].However, an expanding pool of natural molecules actas brakes for angiogenesis [33]. Similar to tumorsuppressors, inhibitors are frequently lost in tumors,creating a permissive environment for expansion.Re-expression of such inhibitors in angiogenic tumorsimpedes their progression: these include angiostatin,endostatin, tumstatin, PEDF, SPARC (secreted pro-tein, acidic and rich in cysteine), tissue inhibitor ofmetalloproteinases (TIMPs) and TSP1. An emergingconcept is to view natural angiogenesis inhibitors asendothelial-specific tumor suppressors [33].TSP1 is one of the most studied angiogenesis inhibi-tors [21], both in terms of regulation and mechanismof action. It is lost in multiple tumor types: fibrosar-coma, glioblastoma and carcinomas of the breast,bladder, colon, prostate and thyroid [19]. TSP1 expres-sion is associated with dormancy of nonangiogenictumors, and predicts a favorable outcome in multipletumor types [37]. It blocks angiogenesis via endothelialcell apoptosis, which requires receptors CD36 and Fas,and Fas ligand [38], and causes CD36-independent cellcycle arrest [39]. TSP1 suppresses recruitment of thecirculating endothelial progenitors [40] and signalingby nitric oxide (NO) [41].The causes of TSP1 loss vary. They include geneticalterations, e.g. the loss of tumor suppressor genesCBAPTAP769P769HNKHNKABCDEFig. 4. TSP1 localization in HNK and P769 cells. (A) HNK cells wereserum-starved to prompt secretion and treated with BAPTA-AM(1 lM), where indicated. After 12 h, HNK cells were fixed, stainedfor TSP1 (green) and ER marker HSP-70 (red). Note the depletionof TSP1 from the cytoplasm of untreated cells (C, top) and accumu-lation in BAPTA-AM-treated cells (BAPTA-AM, bottom). (B–E) P769and HNK cells were serum-starved for 24 h. HNK cells were trea-ted with BAPTA-AM to achieve TSP1 retention. The cells werethen stained for TSP1 as in (A), and for either Golgi marker A58 (B,C) or ER marker HSP-70 (D, E). Note the lack of TSP1 export inBAPTA-AM-treated HNK cells and colocalization (shown in yellow)with ER, but not with Golgi, in both RCC and BAPTA-AM-treatedHNK cells.D. Veliceasa et al. Thrombospondin-1 loss in renal cancerFEBS Journal 274 (2007) 6365–6377 ª 2007 The Authors Journal compilation ª 2007 FEBS 6371(APC, p53, PTEN, SMAD-4 and THY-1) [42–46] orthe gain of activated oncogenes (Akt ⁄ PI-3K, Id-1,Jun, MCT-1, Mts1 ⁄ S100A4, Myc, Ras and Src) [47–50]. Some of these pathways interact: Ras can acti-vate c-Myc [51], which acts via microRNA clustermiR-17-92 [52]. Epigenetic events may also contrib-ute: TSP1 can be repressed by anoxia [53] or hyper-glycemia [54]. A knowledge of the pathways alteringTSP1 production may yield therapies to restoreangiogenic balance and reduce or arrest tumor bur-den.Our study yielded two findings. First, the loss ofsecreted TSP1 contributed to angiogenesis by RCCcells in cooperation with the increase in VEGF. Sec-ond, TSP1 secretion, which determines the state of theangiogenic switch, was impaired in RCC because ofcytoplasmic retention, whilst healthy cells maintainednormal secretion. Seeking molecular causes of failureto secrete TSP1, we focused on misfolding caused bylimited calcium availability [55]. This was indeed thecase: in RCC or BAPTA-AM-treated normal renalcells, TSP1 resided in the ER, and not in the Golgiapparatus. In RCC cells, the analysis of transportvesicles showed strong TSP1 association with COPI-positive vesicles responsible for retrograde transport, amechanism by which the cells ‘recall’ misfolded pro-teins from the ERGIC [56]. By contrast, in HNK cells,TSP1 was localized predominantly in COPII-positiveanterograde vesicles, pointing to Golgi accumulationprior to secretion.Seeking reasons for impaired calcium metabolism,we found that RCC cells expressed lower levels ofTRPC4, which, together with TRPC1, forms hetero-meric channels [27] that mediate growth factor-stimu-lated calcium influx [27]. Although TRPC4 expressionin the renal epithelium has been shown, its role inrenal tissue is unknown. Our data indicate that TRPC4is a key regulator of calcium intake in this tissue. Fur-ther analysis showed that, in agreement with publisheddata [57], most RCC cell lines expressed no detectablecalbindin, possibly because of their undifferentiatedstate. In addition to transepithelial calcium transport,calbindin acts as a buffer, absorbing excess calcium[28,29]. The lack of calbindin increases apoptosis inresponse to growth factor-initiated calcium intake [58].Thus, TRPC4 reduction may be an adaptation ofRCC cells to the lack of calbindin protective function.The protection from apoptosis despite the lack of cal-bindin could be explained by the decrease in TRPC4,or by retention of the Ca2+-binding TSP1. However,TSP1 knockdown with siRNA had no effect on theviability of P769 cells (see supplementary Fig. S1), sug-gesting that the loss of TRPC4 was sufficient to com-pensate for the lack of calbindin.Therefore, we have demonstrated diminished TSP1secretion by RCC cells as a result of active retro-grade transport. This active retrograde transport wastriggered by protein misfolding, which, in turn, wascaused by changes in calcium metabolism. Calciumintake in response to growth stimuli was reducedbecause of the decrease in TRPC4 and the lack ofcalbindin. This is a novel pathway by which cancercells down-regulate TSP1, an angiogenesis inhibitor,and flip their angiogenic switch. Further analysis ofcalcium metabolism and its modifiers may yieldnovel strategies to suppress RCC angiogenesis andgrowth.Experimental proceduresCells and reagentsHuman renal epithelial cells (HNK, P3-8; Clonetics, Walk-ersville, MD) were grown in keratinocyte growth medium(Gibco Invitrogen, Carlsbad, CA) with 10% fetal bovineserum. RCC cells (PRC9, SW839, p769; American TissueABFig. 5. TSP1 association with retro- and anterograde transport vesi-cles. The cells were starved for 6 h to initiate secretion, fixed andstained for TSP1 (red) and for COPII component Sec23, a markerof anterograde vesicles, or with COPI component c2-COP, a mar-ker of retrograde vesicles (green). Note the predominant TSP1 colo-calization with Sec23 (anterograde vesicles) in normal HNK andwith c2-COP (retrograde vesicles) in P769 tumor cells.Thrombospondin-1 loss in renal cancer D. Veliceasa et al.6372 FEBS Journal 274 (2007) 6365–6377 ª 2007 The Authors Journal compilation ª 2007 FEBSType Culture Collection, Manassas, VA) and 786-O RCCexpressing wild-type (WT8) or inactive VHL tumor sup-pressor (ARZ; a gift from R. Kerbel, Sunnybrook andWomen’s Hospital, Toronto, Canada) were maintained inkeratinocyte growth medium with 10% fetal bovine serum.HMVECs (Clonetics) were maintained in MDCB131(Sigma, St Louis, MO) with the endothelial cell bullet kit(BioWhittaker, Walkersville, MD).BAPTA-AM, fluo-4 acetoxymethyl ester and PluronicF127 were obtained from Molecular Probes (Invitrogen).VEGF and EGF were purchased from R&D Systems(Minneapolis, MN).TSP1 antibodies (Ab-1, Ab-3, Ab-11) were obtained fromNeoMarkers (Fremont, CA). VEGF antibodies were pur-chased from R&D Systems. A-58 monoclonal antibody wasobtained from Sigma. Antibodies for heat shock protein-70(HSP-70), c2-Cop and Sec23 were obtained from SantaCruz (Santa Cruz, CA, USA) and Calbindin D-28K fromAbCam (Cambridge, MA). Fluorescein isothiocyanate(FITC)-conjugated goat anti-mouse IgG were purchasedfrom Sigma. Rhodamine (TRITC)-conjugated, horseradishperoxidase (HRP)-conjugated and Alexa Fluor-conjugatedantibodies were obtained from Jackson Immunoresearch(Westgrove, PA). TSP1 was purified from platelets asdescribed previously [59].CM preparationThe cells were grown to 70–80% confluence, rinsed twiceand transferred to serum-free medium. After 4 h, thismedium was removed and replaced by fresh medium. After24–48 h, CM were collected and concentrated in centifugalfilters (3 kDa cut-off; Millipore, Billerica, MA).TransfectionTRPC4, TSP1, glyceraldehyde-3-phosphate dehydrogenase(GAPDH) and scrambled siRNA were obtained fromDharmacon (Lafayette, CO). The cells were seeded in six-well plates (4 · 105,3· 105and 2 · 105per well) in thegrowth medium. siRNA in 200 lL of serum-free medium(100 nm final concentration) and DharmaFECT reagent(4 lL in 200 lL of serum-free medium) were incubated for20 min at room temperature and added to the cells. After24, 48 and 72 h, CM were collected and the cells were pro-cessed further (total RNA and ⁄ or cell lysates).Cell survival ⁄ proliferation assayThe cells were seeded in a 96-well plate. 3-(4,5-Di-methylthiazol-2-yl)-2,5-diphenyl-tetrazolium bromide reagent(Chemicon, Billerica, MA) was added at 24, 48 and 72 hand incubated for 4 h at 37 °C. The assay was performedfollowing the manufacturer’s instructions.Endothelial cell chemotaxisHMVECs starved overnight in MDCB131 with 0.1% BSAwere plated at 1.5 · 106mL)1on the lower side of porousmembranes (8 mm, Nucleopore Corp., Kent, WA) in modi-fied Boyden chambers (Neuroprobe, Gaithersburg, MD);the samples were added to the top. Cells migrating to theopposite side of the membrane were counted in · 10 400fields (controls: 0.1% BSA, 10 ngÆmL)1bFGF).Specific activityCM were tested as above, at 0.01–40 lgÆmL)1, to generatedose–response curves. The ED50values (concentrations pro-ducing 50% maximal response) were extrapolated from thebest-fit curves (sigmaplot, Systat Software, San Jose, CA).To evaluate VEGF and TSP1 contributions, the appro-priate neutralizing antibodies were added at 1.0 and2.5 lgÆmL)1, respectively.Corneal angiogenesisCM from HNK and RCC cell lines were analyzed in therat or mouse corneal assay [60,61]. Briefly, micropocketswere aseptically created in the cornea of female Fisher 344rats or C57Bl6 mice (Harlan), 1.5–2.0 mm and 0.5–1 mmfrom the limbus, respectively. In rats, Hydron (HydroMed,Cranbury, NJ, USA) implants ( 5 lL, 2 lg CM protein)were placed in the micropockets and angiogenesis wasscored on day 7. Animals were perfused with colloidal car-bon, and the corneas were fixed, flattened and photo-graphed. Vascular growth from the limbus to the pelletwas graded as positive or negative. In mice, Hydron sucral-fate pellets (1 lL, 0.4 mg protein) were implanted andangiogenesis was scored on day 5 by slit-lamp microscopy.All animals were handled following the National Institutesof Health guidelines and protocols approved by the North-western University Animal Care and Use Committee.Statistical evaluationQuantitative results were evaluated using Student’s t-test.P < 0.05 was considered to be significant.Tissue acquisition and stainingDeidentified specimens were obtained from the pathologydepartment with Institutional Review Board approvalfor archived tissues. Five micrometer sections were stainedwith hematoxylin–eosin to select the areas of carcinomaand noncancerous tissue. Sections were deparaffinized, re-hydrated in graded ethanol solutions, treated for 5 minwith 3% H2O2, rinsed and blocked for 30 min in 10%D. Veliceasa et al. Thrombospondin-1 loss in renal cancerFEBS Journal 274 (2007) 6365–6377 ª 2007 The Authors Journal compilation ª 2007 FEBS 6373horse serum at room temperature. The sections were incu-bated with TSP1 antibodies in blocking solution (Ab-1,1 : 250, 4 °C overnight), followed by rabbit anti-mouse IgG(Vectastain ABC kit, Vector, Burlingham, CA, 1 : 125, 1 hat room temperature), rinsed and incubated with avidin–biotin complex (Vectastain; 1 h, room temperature). Slideswere developed with 2,4-diaminobutyric acid, counterstainedwith hematoxylin, rehydrated and mounted.Western blottingTo detect TSP1, the cells were lysed for 1 h at 4 °Cin1%Nonidet P-40, 1% sodium deoxycholate, 0.1% SDS and150 mm NaCl in 10 mm sodium phosphate pH 7.2, withprotease inhibitors. The lysates were loaded at 30 lg perlane; concentrated CM were loaded at 10 lg per lane. Theblots were probed with TSP1 Ab-11 (1 : 400), and the sig-nal was detected with a LumiGLO Kit (KPL, Gaithersburg,MD). Calbindin antibodies (1 : 5000) were applied over-night (4 °C).Calcium imagingIntracellular calcium was detected by videofluorescenceimaging. Cells were grown on chamber slides, rinsed inHank’s balanced salt solution, 10 mm Hepes, 11 mm glu-cose, 2.5 mm CaCl2and 1.2 mm MgCl2, loaded for 30 minin 5 lm fluo-4 acetoxymethyl ester, Pluronic F127 (1 : 1,Molecular Probes), treated and monitored (488 nm excita-tion, 520 nm emission) with a fluorescent microscope(Leica, Bannockburn, IL, · 20 objective). Images wereacquired with a Hamamatsu (Bridgewater, NJ) camera(10 s intervals, openlab software, Improvision, Waltham,MA) and analyzed with imagej software (minimum of 30cells per treatment).RT-PCROne microgram of total RNA extracted with an RNeasykit (Qiagen, Valencia, CA) was used for reverse transcrip-tion with oligo(dT)15primers (protocol and reagents fromPromega, Madison, WI). Serial dilutions of cDNA werePCR-amplified in a 23-cycle reaction with b-actin primers(HotStartTaqTM, Qiagen). Dilutions yielding similar prod-uct amounts were chosen for analysis; products wereresolved on 1.5% agarose gels. Primers ⁄ conditions aregiven in Table 4.ImmunofluorescenceCells grown on coverslips were fixed in ice-cold methanol–acetone (1 : 1) and blocked for 30 min (1% horse serum).To detect TSP1, the cells were incubated for 1 h at roomtemperature with Ab-1 (1 : 50 in blocking solution), fol-lowed by the Alexa Fluor 488 goat anti-mouse IgM(5 lgÆmL)1in blocking solution). A-58 Golgi protein anti-body (1 : 500) was followed by goat anti-mouse TRITC-IgG (1 : 100). ER marker antibody, HSP-70 (1 : 100), wasfollowed by Alexa Fluor 546 goat anti-mouse IgG(5 lgÆmL)1). To analyze TSP1 localization to transport ves-icles, the slides were blocked for 30 min in 10% donkeyserum and incubated with TSP1 Ab-3 (1 : 50) and Sec23 orc2-Cop antibodies (1 : 50) in 2% donkey serum for 1 h atroom temperature. The slides were rinsed three times andincubated for 1 h with FITC-conjugated donkey anti-mouseIgG and Texas Red conjugated donkey anti-goat IgG(1 : 100, 2% donkey serum). The slides were mounted inFluoromount-G.AcknowledgementsThis work was funded by National Institutes of Health(NIH) grant RO1 HL077471 (OV).References1 Brugarolas J (2007) Renal-cell carcinoma – molecularpathways and therapies. N Engl J Med 356, 185–187.2 Kim WY & Kaelin WG (2004) Role of VHL genemutation in human cancer. J Clin Oncol 22, 4991–5004.3 Kaelin WG Jr (2003) The von Hippel–Lindau gene, kid-ney cancer, and oxygen sensing. J Am Soc Nephrol 14,2703–2711.4 Semenza GL (2003) Targeting HIF-1 for cancer therapy.Nat Rev Cancer 3, 721–732.Table 4. Primers used in RT-PCR analysis.Gene Primers (5¢-to3¢)AnnealingT (°C)CyclenumberActin TGTTGGCGTACAGGTCTTTGC 60 23GCTACGAGCTGCCTGACGGGAPDH TATCGTGGAAGGACTCATGACC 55 20TACATGGCAACTGTGAGGGGTSP1 CCGGCGTGAAGTGTACTAGCTA 65 25TGCACTTGGCGTTCTTGTTRPC1 GATTTTGGAAAATTTCTTGGGATGT 55 35TTTGTCTTCATGATTTGCTATCATRPC2 CATCATCAT-GGTCATTGTGCTGC 55 35GGTCTTGGTCAGCTCTGTGAGTCTRPC3 GACATATTCAAGTTCATGGTCCTC 55 35ACATCACTGTCATCCTCAATTTCTRPC4 GCTTTGTTCGTGCAAATTTCC 55 35CTGCAAATATCTCTGGGAAGATRPC5 CAGCATTGCGTTCTGTGAAAC 55 35CAGAGCTATCGATGAGCCTAACTRPC6 GACATCTTCAAGTTCATGGTCATA 55 35ATCAGCGTCATCCTCAATTTCTRPC7 CAGAAGATCGAGGACATCAGC 55 35GTGCCGGGCATTCACGTGGTAThrombospondin-1 loss in renal cancer D. Veliceasa et al.6374 FEBS Journal 274 (2007) 6365–6377 ª 2007 The Authors Journal compilation ª 2007 FEBS[...]... Endogenous stimulators and inhibitors of angiogenesis in FEBS Journal 2 74 (2007) 6365–6377 ª 2007 The Authors Journal compilation ª 2007 FEBS 6375 Thrombospondin-1 loss in renal cancer 35 36 37 38 39 40 41 42 43 44 45 46 47 48 D Veliceasa et al gastrointestinal cancers: basic science to clinical application Gastroenterology 129, 2076–2091 Carmeliet P (2003) Angiogenesis in health and disease Nat Med 9,... Thrombospondin secretion by cultured human glomerular mesangial cells Am J Pathol 129, 3 64 372 18 Miyata Y, Koga S, Takehara K, Kanetake H & Kanda S (2003) Expression of thrombospondin-derived 4N1K peptide-containing proteins in renal cell carcinoma tissues is associated with a decrease in tumor growth and angiogenesis Clin Cancer Res 9, 17 34 1 740 19 Lawler J (2002) Thrombospondin-1 as an endogenous inhibitor... J Med Genet 106, 244 –250 27 Desai BN & Clapham DE (2005) TRP channels and mice deficient in TRP channels Pflugers Arch 45 1, 11–18 28 Lambers TT, Bindels RJ & Hoenderop JG (2006) Coordinated control of renal Ca2+ handling Kidney Int 69, 650–6 54 29 Hemmingsen C (2000) Regulation of renal calbindinD28K Pharmacol Toxicol 87 (Suppl 3), 5–30 30 Behnia R & Munro S (2005) Organelle identity and the signposts... Res 66, 1313–1319 8 Garkavtsev I, Kozin SV, Chernova O, Xu L, Winkler F, Brown E, Barnett GH & Jain RK (20 04) The candidate tumour suppressor protein ING4 regulates brain tumour growth and angiogenesis Nature 42 8, 328–332 9 Mestas J, Burdick MD, Reckamp K, Pantuck A, Figlin RA & Strieter RM (2005) The role of CXCR2 ⁄ CXCR2 ligand biological axis in renal cell carcinoma J Immunol 175, 5351–5357 10 Pan... of antiangiogenesis Cancer Cell 7, 101–111 Isenberg JS, Jia Y, Fukuyama J, Switzer CH, Wink DA & Roberts DD (2007) Thrombospondin-1 inhibits nitric oxide signaling via CD36 by inhibiting myristic acid uptake J Biol Chem 282, 1 540 4–1 541 5 Gutierrez LS, Suckow M, Lawler J, Ploplis VA & Castellino FJ (2003) Thrombospondin 1 – a regulator of adenoma growth and carcinoma progression in the APC (Min ⁄ +)... Schmidt-Hansen B, et al (20 04) Functional significance of metastasis-inducing S100A4 (Mts1) in tumor–stroma interplay J Biol Chem 279, 244 98– 245 04 51 Watnick RS, Cheng YN, Rangarajan A, Ince TA & Weinberg RA (2003) Ras modulates Myc activity to repress thrombospondin-1 expression and increase tumor angiogenesis Cancer Cell 3, 219–231 52 Dews M, et al (2006) Augmentation of tumor angiogenesis by a Myc-activated... Baker CH, Killion JJ, Dinney CP & Fidler IJ (2002) Blockade of the epidermal growth factor receptor signaling inhibits angiogenesis leading to regression of human renal cell carcinoma growing orthotopically in nude mice Clin Cancer Res 8, 3592–3600 13 Inoue K, Kamada M, Slaton JW, Fukata S, Yoshikawa C, Tamboli P, Dinney CP & Shuin T (2002) The prognostic value of angiogenesis and metastasis-related... Yang JC (20 04) Bevacizumab for patients with metastatic renal cancer: an update Clin Cancer Res 10, 6367S–6370S 6 Motzer RJ & Bukowski RM (2006) Targeted therapy for metastatic renal cell carcinoma J Clin Oncol 24, 5601–5608 7 Kurban G, Hudon V, Duplan E, Ohh M & Pause A (2006) Characterization of a von Hippel Lindau pathway involved in extracellular matrix remodeling, cell invasion, and angiogenesis. .. Chaudhry MA & Rhoten WB (20 04) Calbindin-D28k and calcium sensing receptor cooperate in MCF-7 human breast cancer cells Int J Oncol 24, 1111–1119 59 Volpert OV, Lawler J & Bouck NP (1998) A human fibrosarcoma inhibits systemic angiogenesis and the growth of experimental metastases via thrombospondin-1 Proc Natl Acad Sci USA 95, 6 343 –6 348 60 Good DJ, Polverini PJ, Rastinejad F, Le Beau MM, Lemons RS, Frazier... Carcinogenesis 24, 199– 207 Dameron KM, Volpert OV, Tainsky MA & Bouck N (19 94) Control of angiogenesis in fibroblasts by p53 regulation of thrombospondin-1 Science 265, 1582–15 84 Wen S, Stolarov J, Myers MP, Su JD, Wigler MH, Tonks NK & Durden DL (2001) PTEN controls tumorinduced angiogenesis Proc Natl Acad Sci USA 98, 46 22 46 27 Schwarte-Waldhoff I & Schmiegel W (2002) Smad4 transcriptional pathways and . Transient potential receptor channel 4 controls thrombospondin-1 secretion and angiogenesis in renal cell carcinoma Dorina Veliceasa1, Marina Ivanovic2,. profound decrease in transient receptor potential canon-ical ion channel 4 (TRPC4) Ca2+ channel expression in RCC cells. TRPC4silencing in HNK cells caused
- Xem thêm -

Xem thêm: Báo cáo khoa học: Transient potential receptor channel 4 controls thrombospondin-1 secretion and angiogenesis in renal cell carcinoma ppt, Báo cáo khoa học: Transient potential receptor channel 4 controls thrombospondin-1 secretion and angiogenesis in renal cell carcinoma ppt, Báo cáo khoa học: Transient potential receptor channel 4 controls thrombospondin-1 secretion and angiogenesis in renal cell carcinoma ppt